What is Genomics - Full Length

Were pleased to present our latest video, What is Genomics? developed in collaboration with Ontario Genomics Institute and Genome British Columbia.
It looks at what genomics means to us and our world and how it relatetes to DNA & genetics, and what studying genomics means to human health, our environment and our knowledge about how we fit into our world.

[@kennylong7281]

We humans have been practicing science for hundreds of years. Thousands of beneficial technologies have changed the way we live. Unfortunately, too few scientific pursuits have lead directly to improving the human metabolism. We are all subject to hundreds of ailments, diseases, and metabolic defects. With the science of Genomics, we now have the chance to greatly improve upon human biology, help to prevent dozens of deadly diseases, and the relieve the suffering of millions.

[@maximumquake1]

I still have no idea what genomics is.....

[@user-xp1eh9vn5b]

1:31

[@Nate3145-zt8rh]

Lol. No one does, if we did we would live in a utopia(maybe)

[@WTFbrownie]

It is the same thing as computer programming/packet sniffing. In computing, you have a byte, which is consisted of 8 bits. Each bytes can be a letter like "A" or "Z". Same method applies in genes. A gene contains a code for a protein or a unknown code consisted of codes of ACTG. Compile that code and then you have a scripture how the human/animal/plant i built. Same with computers, compile your binary code and you have a program.

[@fadimalouf9876]

Good point...

[@swarnavasamanta2628]

That is exactly why DNA codification so massively complex, far more than computers. Computers only act on 0 and 1, binary coding. But DNA is of 4 building blocks, so it carries more dense information and also more complex.

[@shiweanyswami7371]

Thank you!

[@AltafHussain-rr3yg]

Hello could you please tell me which software do you use for these animations

[@smackalligator]

found this very useful. thanks

[@MrWalo1990]

Here, after the Ark Invest results in 2020 from Genomics funds.

[@chrisfranz]

GATCGAAACTGACTGTTACTGATGCAGTCACTGACTGACTATGACTACTCTACCTGAATTGCTGTACCTAGGGTACCTCAGTTTCCGAAATAGATAATAGTGTCCTATACTTGTATATGTATCTATAGATCGAAACTGACTGTTACTGATGCAGTCACTGACTGACTATGACTACTCTACCTGAATTGCTGTACCTAGGGTACCTCAGTTTCCGAAATAGATAATAGTGTCCTATACTTGTATATGTATCTATAGATCGAAACTGACTGTTACTGATGCAGTCACTGACTGACTATGACTACTCTACCTGAATTGCTGTACCTAGGGTACCTCAGTTTCCGAAATAGATAATAGTGTCCTATACTTGTATATGTATCTATAGATCGAAACTGACTGTTACTGATGCAGTCACTGACTGACTATGACTACTCTACCTGAATTGCTGTACCTAGGGTACCTCAGTTTCCGAAATAGATAAC i ran out of room...

[@devononiel]

OMG you know me so well!

[@fadimalouf9876]

Great illustration of Genomics. Thanks!

[@user-kg9qy1vv4b]

can someone provide the proper citation for this video APA 7 format?

[@sawairagul251]

Well explained 🥰💜🥰💃

[@mohanagrawal2378]

very useful to me..

[@s1zzel]

Very nice! THX

[@broytingaravsol]

even for the surfacial curvature of bodies?

[@theyang209]

Who’s here because of BNGO?

[@novaicapital]

Me don't worry it's going to the moon If you invest more than $100 in BNGO you well see you wil be rich in 2-3 years

[@LC2460]

Me

[@toshikitaya2029]

I think there might be a grammatical mistake about 1:28, "the cell that houses it TWO factors outside..." shouldn't it be "to" instead of "two"?

[@dabble4609]

h

[@osslayer8976]

He never made a mistake

[@MeanMachineRex]

Hi there, I think there's a mistake on the visual of two copies of genes in the copy number variation section. The two copies should be on the chromosome and its pair not on the same chromosome.

[@rhysman0001]

is there any websites that show you the human genome?
plz tell me if there are.

[@Hshsuiiien]

very nice, thanks!

[@Dinocrap1101]

cool vid

[@Trent-tr2nx]

It's pretty cool that in 2015 we live in a world in which you can get your DNA sequenced for $99 instead of the $1000 it estimated in the video. Amazing!

[@KoreyKruse]

+Trent Dye DNA cannot be sequenced for $99. There are genetic tests by 23andme.com that provide very limited tests of only certain genes for $199. Whole genotype sequencing is still well over $1000.

[@evanstafford55]

I'd love to see an actual human genome mapping.

[@hazetechs7141]

Bngo

[@muhammadsaleemfazal7765]

nice

[@augurelite]

I wanna be a genomist

[@chapterchatter]

It’s been 9 years. How’s that going?

[@augurelite]

@@chapterchatter HAHA now I'm an aerospace engineer :3

[@chapterchatter]

@@augurelite wow, very impressive :) Thanks for the reply

[@peepdi]

@@augurelite OMG great.

[@Juliana-rw6pt]

whyd u decide to be an aerospace engineer instead?

[@j1der698]

1:44 3D illusion

[@seanhunsicker7418]

Anyone here to find out what arkg is about

[@christophermartin972]

The guy who made my lawn Gnome is a Gnomist

[@THX1146]

I wonder if they thought of making genomic changes with a vaccine. Ask your doctor to read the insert that comes with the bottle.Ask him him if he cares.

[@anilkumarsharma1205]

put the genome mixing with coconut genome mixing with pumpkin genome mixing with water melon genome mixing with melons genome mixing with mustard oil plants mustard seeds genome mixing with oil production plants genome mixing with rubber plants genome mixing with coconut genome mixing with plum genome mixing with pumpkin genome mixing so we got more edibles and complex compound for fractional distillations and patrol solution become easy forever

[@tahirashakeel327]

🐢🐳🐳🐳🐚🐚

[@RozyRoPink150]

okaaaaaaayyy?? I learned nothing from this