HOGS CRYING OVER TRUMP INDICTMENT

Поделиться
HTML-код
  • Опубликовано: 20 сен 2024
  • Conservative hogs react to the news that Donald Trump was indicted and was arraigned in New York over business fraud casein this episode of HOGWATCH
    Live everyday at / hasanabi
    Edited by: / ddohasanabi
    Other Links
    TikTok: / hasandpiker
    Twitter: / hasanthehun
    Instagram: / hasandpiker
    Second Channel: / @hasanyoutube
    Gaming channel - / @hasanabigaming

Комментарии • 1,3 тыс.

  • @natacee566
    @natacee566 Год назад +784

    My friend was a trans sex worker, and she said 90% of her clients were literally these guys.

    • @PartnershipsForYou
      @PartnershipsForYou Год назад

      Tell that person to be careful: righties are mentally unstable and could snap at any moment

    • @MajorasWrath1
      @MajorasWrath1 Год назад +260

      I salute her for her service. She's been through more unpleasantness than any troop or cop. Genuinely.
      🫡

    • @MultiKatieBee
      @MultiKatieBee Год назад +149

      I believe it. Lots of closeted homosexuality in the world of hogs.

    • @fluidthought42
      @fluidthought42 Год назад +1

      ​@@MultiKatieBee
      I wouldn't call it homosexuality, but at the same time chasers do be weird about girldick

    • @sergeant_salty
      @sergeant_salty Год назад

      @FishTacoDeluxe i know you think that biological women are born with a penis and testicles but science would spit in your face on that one lol. stop lying to yourself that your trans "girlfriend" is a girl. it's a boy. your significant other is a man and you are a homosexual

  • @yellowbutterfly6796
    @yellowbutterfly6796 Год назад +2504

    republicans: but if trump is held accountable then any president can be held accountable!
    everyone else: yes! do that! we fully support that!

    • @whatdatdogdo
      @whatdatdogdo Год назад

      I wouldn't say the liberals are advocating for penalizing previous presidents given their record. But I agree all American presidents should be tried at the hague

    • @sirdrchefwangiii1841
      @sirdrchefwangiii1841 Год назад +12

      Thats the point. It wont ever happen which begs the question why do the elites want trump out the way?

    • @rio5725
      @rio5725 Год назад

      @@sirdrchefwangiii1841 dude, the elite IS trump and his funders lmfao

    • @lumisussy
      @lumisussy Год назад +167

      @@sirdrchefwangiii1841 what makes trump different from the other "elites"?

    • @yellowbutterfly6796
      @yellowbutterfly6796 Год назад

      @@sirdrchefwangiii1841 ikr, you cant even pretend to win and tell your followers to storm the capital when you lose an election anymore in this country, us republicans are uniquely persecuted for no good reason

  • @TheEclecticDyslexic
    @TheEclecticDyslexic Год назад +1221

    "I thought stormy daniels was a senator"
    This is definitely the guy we should be getting our political opinions from, he clearly has his finger on the pulse

    • @chucku00
      @chucku00 Год назад +15

      Well, they're the same people who elected Empty G, so there's some logic in his delusion.

    • @Mumiah862
      @Mumiah862 Год назад +4

      @@chucku00 what is empty g

    • @chucku00
      @chucku00 Год назад +28

      @@Mumiah862 Margarine Tumour Gene

    • @Student0Toucher
      @Student0Toucher Год назад

      Its funny seeing libs happy that this indictment clears the way for Ron DeSantis a actual by the book smart conservative that can actually win and really change stuff in a smart way that democrats wont be able to do anything about

    • @marinemanaphy101
      @marinemanaphy101 Год назад +21

      Kinda insane that somebody who’s been following Trump closely didn’t know that tbh. Like, *every* article and news story about Stormy Daniels goes out of its way to call her a porn star.

  • @sanderness
    @sanderness Год назад +1108

    god I LOVE the ambulance conspiracy theory. it has just the right amount of crazy

    • @das_it_mane
      @das_it_mane Год назад +214

      Every time there's an ambulance behind me in traffic, I automatically become president.

    • @DRACOCHIEF
      @DRACOCHIEF Год назад +102

      Every time an ambulance passes, the president is in there. 😔

    • @whoreshoe
      @whoreshoe Год назад +49

      all ambulances have at least one "alien disguised as a president" occupant

    • @bazzfromthebackground3696
      @bazzfromthebackground3696 Год назад

      Ambulance drivers are all actors.

    • @ratboy4169
      @ratboy4169 Год назад

      Only the best for trump, only the most loyal brain dead followers. Are they tired of winning yet?

  • @itsd0nk
    @itsd0nk Год назад +157

    “Wake up people!”
    “Woke people are the devil!”
    “But you all better wake the fuck up!”

  • @SuperTonyony
    @SuperTonyony Год назад +919

    For any right-wingers out there: "Liberalism" means "individual rights, voting, property rights, and free enterprise".
    "Socialism" means "worker ownership and control of the means of production".
    "Communism" means "the abolition of class, money, and the state".
    Words have meanings. Look them up.

    • @pllpsy665
      @pllpsy665 Год назад +221

      You expect them to understand 3 words? Very optimistic of you.

    • @Silvermoon424
      @Silvermoon424 Год назад +69

      I wish this would have an effect on them but they'll continue to insist that all three words are the same thing. Which is "when the gubmint does something I don't like."

    • @lc360
      @lc360 Год назад

      no communism is when trump sees the bare minimum consequences for his actions and socialism is when poor people can go see a doctor (this is bad)

    • @shanefoster2132
      @shanefoster2132 Год назад

      You sound like one of those gawd dang liberal communists.

    • @zagorim7469
      @zagorim7469 Год назад

      Now that's something only a liberal communist would say !

  • @t33nyplaysp0p
    @t33nyplaysp0p Год назад +219

    Grown ass men crying over a 70 year old, who doesn't even know them, getting indicted for financial fraud, while not getting put in cuffs, is absolutely amazing .

    • @bigjohnson7415
      @bigjohnson7415 Год назад +13

      76 years old!

    • @mpjstuff
      @mpjstuff Год назад +5

      "He didn't even get his pillow fluffed or a chocolate on his pillow -- witch hunt!"

    • @t33nyplaysp0p
      @t33nyplaysp0p Год назад +2

      @@mpjstuff that part

  • @elkosins1686
    @elkosins1686 Год назад +151

    “You can’t punish a former president think of the optics! This is communism!”
    These are the same people who say Biden should go to jail cuz his sons laptop has pics of him doing coke

    • @mpjstuff
      @mpjstuff Год назад +3

      "This is communism" -- well, sure. Communism distributes power to the people, and they would be able to hold leaders accountable. But have we have communism or did the world experience "lot's of farming with big words and a totalitarian government"?

  • @desolationlovesIHOP
    @desolationlovesIHOP Год назад +703

    Divorce is such a disease guys please support your local divorced dad

    • @Goatchild90
      @Goatchild90 Год назад +4

      lmao

    • @PartnershipsForYou
      @PartnershipsForYou Год назад +16

      As a guy with a divorced dad I can relate
      . Marriage is a failed structure

    • @pinkcatacombs
      @pinkcatacombs Год назад +64

      All of these men are proof that every divorce proceeding should have court mandated therapy afterwards

    • @futuristicgirl14
      @futuristicgirl14 Год назад +7

      my dad 👁️👄👁️

    • @IanMcGarrett
      @IanMcGarrett Год назад +30

      These guys are just divorced from reality.

  • @PhoenixFireZero
    @PhoenixFireZero Год назад +155

    "go out like a warrior," says the sapient ball of cholesterol and regrets.

    • @Tearintime
      @Tearintime Год назад

      Fr, like feel free to go out. We’ll be happy to be rid of you

    • @noahboucher125
      @noahboucher125 Год назад +10

      Theatre kid energy

    • @PhoenixFireZero
      @PhoenixFireZero Год назад

      @@noahboucher125 the most american tradition is to talk big shit and do nothing

    • @mpjstuff
      @mpjstuff Год назад

      @@noahboucher125 Yes, but a good method actor can get ripped and kick some butts! Jean Claude Van Damme -- theater kid. Sean Hannity -- no theater. I rest my case.

  • @matthewh.9523
    @matthewh.9523 Год назад +59

    50% of US adults read at a 6th grade level- 20% of US adults read at a 3rd grade level- and they are represented here.

    • @fmlAllthetime
      @fmlAllthetime Год назад

      Agreed... but I don't wonder if that's not common across literate people on the planet in general. Obviously 76% know it's somewhat political, and yet 60% still say fuck him ya know? So like, the majority ain't wrong here, even at their 6th grade reading level.

  • @TheMosayat
    @TheMosayat Год назад +139

    "Imagine coming in to see your dad making these videos" "The reality is the kids aren't coming, this weekend" lmaoooo

  • @Drwildy
    @Drwildy Год назад +503

    I miss hog talk. This shit needs an episode weekly

    • @arnoldfreeman2885
      @arnoldfreeman2885 Год назад +1

      I mean you could just watch The Leftovers with Hasan and Ethan

    • @soyborne.bornmadeandundone1342
      @soyborne.bornmadeandundone1342 Год назад +14

      This this this! Not just because it's fun but it's educational. DIVE DEEP into the minds of the mindless lol. I think it's good that folks know what kind of scum is out there. As Carlin always said... Life is about detecting stupid bs in order to then learn to avoid it lol.

    • @777L777E777
      @777L777E777 Год назад +5

      ​@@arnoldfreeman2885 I don't like Ethan

    • @2guys1cliplol
      @2guys1cliplol Год назад +5

      That guy at 4:03 lived in Cuba till he was most likely 6 months old before his family moved to the US and then tells everyone the "horrors of cuba" 😂😂😂

    • @DarrienGlasser
      @DarrienGlasser Год назад

      @@arnoldfreeman2885 Leftovers doesn't happen weekly ... or does it? It feels like there's a month in-between episodes

  • @alexanderg.i1991
    @alexanderg.i1991 Год назад +85

    Wait people still believe trump is the acting president? So why do they hate the direction the country is going if they love trump so much and he’s acting president.

    • @celticcomradelad1850
      @celticcomradelad1850 Год назад

      Because they're idiots that will say anything to save face. These are the same people that used to call Angela Murkle a Communist, you know the conservative Christian leader of Germany. Simply being pro EU and not being as bigoted as them was enough for them to label her as a communist, that's the point, it's easier for them to blame commies/liberals even when it's not commies/liberals

    • @t33nyplaysp0p
      @t33nyplaysp0p Год назад +17

      Don't try to reason with them lol

    • @erikvan9582
      @erikvan9582 Год назад +9

      Logic isn't the strong suit of conservatives?

    • @IAmTheBugInsideYou
      @IAmTheBugInsideYou Год назад +6

      You're giving their bullshit way too much credence lol

    • @goldenwolfae
      @goldenwolfae Год назад

      that takes too much intelligence to think more than 5 seconds ahead. a goldfish has better reasoning than these people

  • @FJK22
    @FJK22 Год назад +108

    “Wake the f*** up” he’s saying he’s woke

    • @mpjstuff
      @mpjstuff Год назад

      He's not THAT kind of woke. He's awake. Being woke means you were asleep and now you aren't. He's never been a fool and nobody can fool him because his facts don't care about your feelings. You think this doesn't make any sense? Well talk to the hand!

  • @cjboyo
    @cjboyo Год назад +194

    Continually shocked my crazy ass uncle and his wife haven’t shown up in any of these hogwatch videos

    • @itsd0nk
      @itsd0nk Год назад +42

      You have a crazy trump Uncle who isn’t divorced? That’s a unicorn right there.

    • @MatataMcCleskey
      @MatataMcCleskey Год назад

      Soon, young grasshopper

    • @jaiadlakha212
      @jaiadlakha212 Год назад

      @@itsd0nk cause his wife is probably a hog too lmao

    • @MrGared22
      @MrGared22 Год назад +8

      Give it time, my friend
      Also, holy shit, he isn't divorced?

    • @carverjohnson2941
      @carverjohnson2941 Год назад +2

      Same here, he actually used to be further left than my folks - but his wife is the conservative one.

  • @amy1160
    @amy1160 Год назад +196

    Where I work 2 old people were talking about how crazy the indictment was and that "this is not what our country stands for" lmao

    • @callofmetals24
      @callofmetals24 Год назад +57

      Glad they won't be around for long

    • @jfk8540
      @jfk8540 Год назад

      our country doesn’t stand for rich in powerful people being held accountable for their crimes, technically they’re right. but they couldn’t be further from right in the sentiment. they want one man to wield power without accountability, without the possibility of consequences. they believe he is infallible and above the law, they quite literally dwell in opposition to the core principles behind the foundation of american democracy and the republic. that is the most infuriating thing about them, they believe they’re these righteous crusaders defending american principles, when their ideology and reactionary beliefs are in direct opposition to the principles held by the founders of this country.

    • @dmoneyonair
      @dmoneyonair Год назад +28

      *our country stands for letting them get away with it*

    • @Katimashi
      @Katimashi Год назад

      Maga is American Taliban

    • @0bsmith0
      @0bsmith0 Год назад

      So the country stands for complete dishonesty and criminal behavior? That's about right.

  • @alandewhirst7211
    @alandewhirst7211 Год назад +180

    As a proud pittsburgher, that dude is a disgrace to that pirate hat. Only the pirates get to embarrass Pittsburgh like that

  • @Culled
    @Culled Год назад +150

    Imagine simping for someone like this holy shit. It’s their whole personality

    • @MultiKatieBee
      @MultiKatieBee Год назад

      And it's extra sick they are simping for Dumpster Trump!

    • @Badtown1988
      @Badtown1988 Год назад

      And of all the people to simp for, they pick a dude who wouldn’t piss on them if they were on fire. Not only are they losers, but they’re the least perceptive people on the planet.

    • @rolloxra670
      @rolloxra670 Год назад +17

      Fr 😂 I wouldn’t be surprised if a whole religion creates around Trump

    • @H56Nooc
      @H56Nooc Год назад +16

      ​@@rolloxra670 feels like it already has tbh

    • @rbustamante86
      @rbustamante86 Год назад +8

      I never understood anyone being a fan of any politician at all. Why would you simp for anyone who got their job by going through a popularity contest.

  • @catcatcatcatcatcatcatcatcatca
    @catcatcatcatcatcatcatcatcatca Год назад +28

    I love the ambulance guy. The theory that democrats took over the office of president illegally but because of some legal technicality need to respect the true presidents legal status by providing a single ambulance is my new favourite conspiracy theory.

  • @Frolickingflounder
    @Frolickingflounder Год назад +664

    So glad Hasan is finally streaming hogwatch legacy

    • @Myst1cSoul
      @Myst1cSoul Год назад +24

      Damn it that was good

    • @thechief043
      @thechief043 Год назад +8

      The sequel we needed but didn't deserve.

    • @soyborne.bornmadeandundone1342
      @soyborne.bornmadeandundone1342 Год назад

      Enjoying a nazi terf wizard game that's about as good in terms of game design as any generic ubisoft trash? Eyeah.... Not a great look lol. How about no to that...
      Laughing at nazi lover dikheds who have no life on tik tok? Now that's what I'm phuckin talkin about! Actual fun happens here haha.

    • @rjv-rw2ef
      @rjv-rw2ef Год назад

      Libs gotta eat too

    • @SuperKiao
      @SuperKiao Год назад +1

      Such a hypocrite 😂😂😂😂😂

  • @PaullyRobots
    @PaullyRobots Год назад +78

    Listening to these people do their lil "investigative" thing is like watching your cat investigate what happened to the red dot after you turn off the laser.

    • @mpjstuff
      @mpjstuff Год назад +1

      I'm laughing too hard at this. I'm imagining Tucker Carlson doing "Cats" on Dancing with the Stars. It's so vivid. He really does want to swat that glowing red light. Probably missed his calling.

  • @MisterPenguin42
    @MisterPenguin42 Год назад +75

    "Is the indictment of your predecessor politically divisive?"
    It's New York, they have states' rights.

  • @RustyWalker
    @RustyWalker Год назад +208

    He gets to have his time in court just like everyone else. Which part do they think is unfair?

    • @blackwatertv7018
      @blackwatertv7018 Год назад +64

      They think him being held accountable is “unfair” that’s it. He’s above the law in their eyes.

    • @kalixaudnari309
      @kalixaudnari309 Год назад +40

      ​@@blackwatertv7018 Rules for thee but not for me

    • @majortom4711
      @majortom4711 Год назад +39

      He's not even having to be handcuffed or take a mugshot, it's actually insulting that they're coddling him

    • @slideszi
      @slideszi Год назад +2

      Because it is politically motivated , this is like what banana republics in africa do

    • @derpeth2101
      @derpeth2101 Год назад

      @@slideszi Based banana republics in Africa

  • @phantomyouneverwanted7378
    @phantomyouneverwanted7378 Год назад +20

    Fun fact: That cover of "Zombie" was done by Bad Wolves and it was to honour the death of Dolores Riordan and the proceeds from that song had gone to her children. Not saying the song isn't butt rock but a nice story to come for a funny joke on stream!

  • @CreechNBong
    @CreechNBong Год назад +49

    All I could think with the Kid Rock thing was "You destroyed.. about $8 worth of Bud Light? I don't get it."

    • @batman40528
      @batman40528 Год назад +17

      $8 worth of bud light THAT HE BOUGHT

    • @rve420
      @rve420 Год назад +15

      @@batman40528 Reminds me of people cutting up and burning the Nike products they already paid for. Nike already has your money....

    • @kylecook7187
      @kylecook7187 Год назад +5

      Right? Like, a 30 rack is only about 25 bucks.

    • @SilverPrince_
      @SilverPrince_ Год назад

      What's funny is that Kid Rock drinks Bud Light lmao A shit beer destroyed by a shit person who bought it lmao

    • @OfficerDva444
      @OfficerDva444 Год назад +1

      He's not a Kid or a rock either! D:

  • @kandimeep
    @kandimeep Год назад +12

    "schizophrenic" - sir do not associate my crazy with his crazy pls. 😂

    • @JulietteKernDiamond
      @JulietteKernDiamond Год назад +3

      Right I just hear voices that "aren't there" you'd never catch me being a hog lol

  • @pimpymcswaggins208
    @pimpymcswaggins208 Год назад +66

    Hasan reviewing these TikToks in a Texan Tie is too funny. Man’s looking fly af 💀

  • @Aetoyt
    @Aetoyt Год назад +16

    Fun fact that cover of Zombies was approved by Dolores (lead singer of Cranberries & original singer of Zombies) and she was meant to sing on it herself but a week before she flew out to LA to record vocals she took her own life. They released that version of Zombies as a tribute to her life and work and the song itself is heavily anti-war and anti-conservativism. So he just talked about how great Trump is and how liberals are stupid in front of the absolute worst song choice.
    But it had a man singing growly a popular song so he thought it'd be badass.

    • @ham7307
      @ham7307 Год назад

      same energy as conservatives using american idiot by greenday

    • @davidnissim589
      @davidnissim589 Год назад +1

      the singer of the band that did the cover is actually a hardcore Trump sympathizer (which is ironic, because he covered Zombie). He left the band a few years ago and tried to frame it as "cancel culture", which he's been getting a lot of praise from right-wing media for, so maybe that's why the guy in the video is using it.

  • @j-dubb614
    @j-dubb614 Год назад +34

    I live in Ohio. Every day is hogwatch.

  • @jonhamilton5789
    @jonhamilton5789 Год назад +20

    It’s hilarious that Tucker has 2 “lawyers” on his show that apparently can’t figure out what crimes are listed in the indictment. Such brilliant legal minds.

  • @getoffamycloud9844
    @getoffamycloud9844 Год назад +26

    You'll note that these cowards weren't in NYC. Come out of your box and deal with society.

    • @PhoenixFireZero
      @PhoenixFireZero Год назад +6

      ​@tinyloonavebaby70thstreetit's almost like the American condition entails talking a lot of big shit and giving no follow-through

    • @PartnershipsForYou
      @PartnershipsForYou Год назад +6

      Mommy and Daddy’s farm property is sooo much nicer and safer. Plenty of room to run around, Fox News on 24/7. Why would they leave Hog Paradise?

    • @Velvetx4cove
      @Velvetx4cove Год назад

      I'm reminded that everytime self-proclaimed Nazis show up to places like Philadelphia they get a big ass reality check. They'll get knocked tf out and leave with their tails between their legs in a heartbeat.

  • @Gram72534
    @Gram72534 Год назад +22

    I got caught behind Obama's group in Colorado when he was running for president. They closed the hwy until the whole group passed. There were at least 4 bus's and cop car's and bikes ect, there was also a ambulance and he was only a senator... These people are as sharp as a weffle ball!!!

  • @eviebee
    @eviebee Год назад +25

    after ppl staring, laughing, harassed and being generally creepy towards me for being trans, it makes me feel so comfortable to watch hasan

  • @pllpsy665
    @pllpsy665 Год назад +62

    9:44 This is the damn problem. This is the level of ignorance about everything these people are working with. The sad part is that instead of reassessing everything he thinks when he realized how fucked his knowledge base is he decided to double down.

    • @Rexini_Kobalt
      @Rexini_Kobalt Год назад +3

      dude is living in an rv it looks like, so...

  • @littleealyssax0x
    @littleealyssax0x Год назад +24

    @hasanabi you can call Hogs paranoid, but please don’t use “Schizophrenic” as an adjective. Someone can HAVE schizophrenia, but to say someone IS Schizophrenic makes the already stigmatized diagnosis into a Caricature.
    If someone is sad they don’t say “they are so depression”.

    • @rexana_rexana
      @rexana_rexana Год назад +3

      FINALLY I found someone else who noticed that! It made me feel really bad that he kept using that. He has such a large audience, he's just reinforcing that stigma to them.

    • @Julia-tk2em
      @Julia-tk2em Год назад +3

      Thank you. I have Schizophrenia and the overuse of the term is both harmful and hurtful.

    • @littleealyssax0x
      @littleealyssax0x Год назад

      @@Julia-tk2em I think people with schizophrenia have a gift. They see the world in a different lens & society needs ppl who think outside of those narrow boxes that we are supposed to conform to.
      I work mental health and it irks me when even doctors say “they’re schizophrenic”. No they HAVE schizophrenia.
      So thanks 4 being u!! 🖤

    • @littleealyssax0x
      @littleealyssax0x Год назад

      @@rexana_rexana I know, I hope he sees this so he can just learn the right verbiage.

  • @douchopotamus3755
    @douchopotamus3755 Год назад +28

    What's crazy to me is all these people thought that other people should hear their thoughts. The ego of it.

  • @smolapril
    @smolapril Год назад +19

    there's a thin line between hog watch being funny and borderline vomit inducing

  • @harrydsgn
    @harrydsgn Год назад +32

    Something about MTG saying Jesus was killed by a 'Radical' government is so funny to me. He was literally killed for being that time period's version of a 'radical' lmao

    • @SuperKiao
      @SuperKiao Год назад

      Ew. Do you think you’re a woman?

    • @OfficerDva444
      @OfficerDva444 Год назад

      Conservatism also tends 2 fantasize about The Roman government that ended up killing Jesus too...

  • @johnathanwalker8395
    @johnathanwalker8395 Год назад +33

    The irony of military industrial cumplex loser ranting with an anti war song literally calling him a ZOMBIE in the background is so rich I'm having to take really small bites.

  • @Silvermoon424
    @Silvermoon424 Год назад +76

    Hasan's Tucker Carlson impersonation is always 10/10

  • @lizardbytheriver1567
    @lizardbytheriver1567 Год назад +17

    Biden just smiling/laughing at that Trump Question is lowkey one of the coolest things Biden's done.

  • @smileymalaise
    @smileymalaise Год назад +45

    Hasan's cover of Zombie has now hit #7 on Billboard top 100.

    • @A2Z83
      @A2Z83 Год назад

      better than that buttrock cover by bad wolves who had to ditch their singer because he was too much of an unhinged trump supporter.

  • @clusterfox6143
    @clusterfox6143 Год назад +10

    The Trump court sketch makes him look like the grinch. I love it.

  • @richarddavenport6756
    @richarddavenport6756 Год назад +14

    Hogwatch needs to be a weekly segment. I was crying with laughter watching this live

  • @Some_Dude062
    @Some_Dude062 Год назад +20

    Imagine being this angry when you're doing so well. The privilege of these people

  • @dickeyseamus
    @dickeyseamus Год назад +49

    It's like these dudes evolved so that beard development takes precedent over brain development. Fascinating!

  • @MexicanTeTe
    @MexicanTeTe Год назад +46

    Before social media you'd only see these people talking conspiracy theories and politics while stumbling around down at your local rural bar. Now they feel emboldened and extra vocal because they see each other post their nonsense online.

  • @Morecado
    @Morecado Год назад +7

    Cranberries singer O'Riordan was supposed to be part of that cover of the song, but unfortunately passed away some time right before the recording could take place.
    The cover band later recorded the song as a tribute to her. I believe they changed the lyrics slightly to reference O'Riordan's passing.
    I hate the way it was used for that goof's TikTok.

  • @patteraj
    @patteraj Год назад +9

    Hogs sure love to give money to a company for their product and then record themselves destroying said product.

  • @AlliSinned
    @AlliSinned Год назад +7

    5:23 Former Presidents famously don't ever need medical attention ever again

  • @spockmandia
    @spockmandia Год назад +30

    The best part about the Kid Rock video is that he missed most of the beer with his MACHINE GUN.

    • @drewgoin8849
      @drewgoin8849 Год назад +6

      There's a photo of Kid Rock hanging out with a drag queen from 2003 - and he's drinking a Bud Light!!!

    • @CoutureThug
      @CoutureThug Год назад

      ​@@drewgoin8849 he was at a drag show drinking bud light lol. But we all know he was a culture vulture, he's the biggest sheep and doesn't even know it

  • @Dudewithhat9531
    @Dudewithhat9531 Год назад +19

    its just sad to see the lack of critical thinking from most people in the world.

  • @MarillSweatshirt
    @MarillSweatshirt Год назад +8

    4:27: "this is the beginning of communism in this country....."
    With his American flags, police memorabilia, overt dedication to leaders that would rather watch him game end, no understanding of communism and......

  • @biskitboi2476
    @biskitboi2476 Год назад +4

    That cover of Zombies was meant to have the Cranberries' singer do the vocals but she died like the day before, they put a little commemorative thing at the start of the music video

  • @donaldlahoda8693
    @donaldlahoda8693 Год назад +26

    I can only watch a couple minutes of these before I start to feel my brain become smooth.

    • @xezevahc
      @xezevahc Год назад +1

      I suggest you broaden your scope of the content you consume then. While some of these people were very silly the main point still stands which is that this is an incredibly weak case and even after they pursue this do you genuinely think they're gonna go after anyone else who did the exact same thing? The answer is obviously no because this is a political move.

    • @t3rrschxx102
      @t3rrschxx102 Год назад +2

      @@xezevahc most of hasans viewers would agree with your statement

    • @donaldlahoda8693
      @donaldlahoda8693 Год назад +3

      @@xezevahc don't worry chavez, fact is I'm never going to be able to afford to illegally move 130,000 bucks around to keep a porn star quite while I'm running for office. So I'm not worried about what happens at all. I just think folks who follow politics like it's a wwe storyline are ridiculous.

    • @xezevahc
      @xezevahc Год назад +1

      @@donaldlahoda8693 that’s actually a great point. For the most part I was referring to politicians who have done the exact same thing. But you are right American politics for the majority of people is just a theatrical performance. It’s like people subconsciously think it’s not real and there aren’t real consequences to what these politicians are doing. The majority of people don’t take politics seriously at all.

  • @jturppa1234
    @jturppa1234 Год назад +25

    The butt rock singing 😂

  • @yellowfelloh
    @yellowfelloh Год назад +27

    Love to see him in his Sunday's best on this fine occasion. Thank you for reporting the Hogwatch o7

  • @lukecarter9531
    @lukecarter9531 Год назад +5

    The lead paint generation is really showing up today

  • @Gunbudder
    @Gunbudder Год назад +4

    14:55 that is literally a $50,000 gun. Bob is so far out of touch with his fake "trailer" persona that he's lapped back around to the rich kid he grew up as. And yes, his name is Bob Ritchie.

  • @paranoiddroid9570
    @paranoiddroid9570 Год назад +11

    What kills me the most is that these same people that preach about hating China are using a Chinese spyware app to post their content 😂 the jokes write themselves.

  • @NessaH
    @NessaH Год назад +2

    “I’ll be transitioning to a different beer company”💀💀

  • @pelletized
    @pelletized Год назад +29

    i say 'i'm sorry' all the time, what does that say about our society?! 😭

    • @pllpsy665
      @pllpsy665 Год назад +3

      We live in one ...

  • @PMac13
    @PMac13 Год назад +4

    I had an ambulance follow me for 6 miles last night while I did 20mph down the center of the road and its sirens blared.
    I am President now.

  • @Ironraven001
    @Ironraven001 Год назад +36

    Your reaction at 12:30 to that Boomer lady with the "describe your video" box 😂😂😂😂😂

  • @meanjeanmcqueen6171
    @meanjeanmcqueen6171 Год назад +5

    My Mom raised me on conspiracies. Thankfully I eventually got away from it, but I've noticed there ALL the same and none have come true, lol.

  • @thegargoylecumeth7932
    @thegargoylecumeth7932 Год назад +3

    That ambulance theory is the best pudding-brained evidence I've ever seen 😂

  • @Hankthespank
    @Hankthespank Год назад +8

    Dude im so fucking happy over this shit starting again. May the conspiracy theories flood and sustain me for another year!🤌

  • @braidena1633
    @braidena1633 Год назад +5

    "While we're on the subject of Biden"
    No we weren't

  • @thepolarphantasm2319
    @thepolarphantasm2319 Год назад +5

    Bro, Catturd 😂😂😂 "fetterman's head transplant" 😂😂😂 these people are definitely on one

    • @PartnershipsForYou
      @PartnershipsForYou Год назад

      Based catturd showing us the inner workings of a right winger/dementia patient’s mind

  • @miricobladetail9670
    @miricobladetail9670 Год назад +18

    God I wish I could read Tucker's texts during this.

  • @staomruel
    @staomruel Год назад +6

    Love the dude that thought the Stormy story was true until he found out she wasn't a senator.

  • @lazyxknight685
    @lazyxknight685 Год назад +12

    Fuk I'm so fortunate I'm Australian. Health care n no guns. No one refers to us as "socialist" for this

    • @xXRickTrolledXx
      @xXRickTrolledXx Год назад +3

      Stop rubbing it in, it hurts :(

    • @lazyxknight685
      @lazyxknight685 Год назад

      @@xXRickTrolledXx all the big fuk off spiders/snakes
      replace the fear of shootings so dont worry it balances out

  • @MultiKatieBee
    @MultiKatieBee Год назад +5

    Hasan in his suit era wearing a bolo tie is 🔥

  • @DizzyedUpGirl
    @DizzyedUpGirl Год назад +5

    Imagine crying over someone you've never met getting arrested

  • @mpjstuff
    @mpjstuff Год назад +1

    It's fun to laugh about these people -- and it's a way to release the tension we get from the threat they manifest. But we also need to realize that the best way out of this problem is to find a way to help these people. We are starting to sound like they did when talking about "broken families" and the hoodlums they produced. What yapping and complaining are we going to do that is going to undo the systemic problems that promoted the removal of dads from a home? We are feeding into this cycle. It doesn't matter if they deserve this problem or not; because their problems will end up being ours. I promise you; nobody loathes this Hog more than he does. They get into these echo chambers and cults and deify a loathsome man because that's the best way to avoid looking inward. Anyone can get this way if they spend all their time being angry at things they can't change. It's not about being right or wrong about a conspiracy theory; it's about spending your energy on things you have no control over.

  • @thenewmase
    @thenewmase Год назад +3

    they keep saying the crime is not listed because they know their audience it's either not going to read it or too stupid to know how to read

  • @ethankillion786
    @ethankillion786 Год назад +8

    I think the knee-jerk reaction is this will help him in the primary - at the very least providing a huge fundraising boost, but it’s hard to imagine this isn’t a massive blow to his chances with non-MAGA independents he needs to win the general.

  • @Gorbgorbenson
    @Gorbgorbenson Год назад +2

    For those who dont know, the Zombie cover was made in 2018 by Bad Wolves and was meant to have the orignial singer on it, but she unfortunately passed before it could happen. The lyrics are anti American-imperialiast, refrencing bomb strikes and drones.

    • @debadityabhowmik6533
      @debadityabhowmik6533 Год назад

      Pretty sure the song was written after the bombings of 1993 in UK by the IRA. The song lyrics seem more pro Britain invasion and anti IRA... Its not anti war, but anti revolution. The song blames IRA for everything yet never talks about how disgusting British were that gave rise to IRA

  • @thattheatrenerd1418
    @thattheatrenerd1418 Год назад +2

    Is it me or does the Trump courtroom sketch look like the original animated Grinch if he fell into a vat of Cheto dust

  • @abigaileldritch
    @abigaileldritch Год назад +4

    My favourite thing is a HOG using a cover of Zombie, and anti war song, to promote war.

    • @rve420
      @rve420 Год назад +4

      Rage FOR the Machine!

  • @mpjstuff
    @mpjstuff Год назад +1

    21:07 the joy I see in the Press Secretary's face is so infectious that it's making the two Fox reporters struggle to not start giggling while asking their question. That is perhaps the #1 skill they have to find in their employees at Fox -- the ability to keep a straight face. After this, those two reporters will drink heavily and have a "business meeting." That's why they keep a change of clothes in the trunk.

  • @limitbreak2966
    @limitbreak2966 Год назад +3

    1:14 did this guy literally just say head transplant? LMFAOOO that’s not possible yet

  • @DRACOCHIEF
    @DRACOCHIEF Год назад +6

    Thought the lady at 8:25 said "I'm gon need you to get a nazi" instead of "nice seat". Lol still the point stands though, she's talking a whole lot of nothing.

  • @ErikLeeTroche
    @ErikLeeTroche Год назад +23

    damn kidrock really bought beer just to shoot it. 😭

  • @vassinarain
    @vassinarain Год назад +5

    I love how she didn’t mention Assange or Snowden in the list of persecuted people

  • @ChrisVillagomez
    @ChrisVillagomez 6 месяцев назад +1

    8:04 "Anything said before the word But is horseshit."
    13:50 The Cranberries cover in the background was actually made by the lead singer's nephew's band. I don't remember the lead singer's name off the top of my head, she was supposed to be in the cover with her nephew but she passed away not too long before she could record her lines for it. It's honestly really bittersweet that the cover is out but with the knowledge that she could have been in it too :(

  • @zed739
    @zed739 Год назад +9

    10:10 who the fuck would just admit this to their friends and relatives lmfao

  • @WonLotto100M
    @WonLotto100M Год назад +1

    Hasán you roasting the MAGA HAT Cuban guy from Miami just made my day! Oh my goodness.

  • @awoodenbrain100
    @awoodenbrain100 Год назад +5

    We need to cut Wi-Fi off from trailer parks

  • @kevin04230
    @kevin04230 Год назад +1

    i love when they bring up “the children” like they aren’t the ones actively putting us in danger by refusing to institute gun regulations. A drag queen reading a book has never killed any children-

  • @bluesstinger1975
    @bluesstinger1975 Год назад +4

    The American Circus still rolls on, thank you for all your comedy gold repugs

  • @jacobkalbfleisch5431
    @jacobkalbfleisch5431 Год назад +1

    Conservatives on TikTok talk about Trump like he's Goku or some shit

  • @itsd0nk
    @itsd0nk Год назад +3

    I would be slowly dialing 911 in my pocket if that first guy came up to my face and started talking to me like that at the park somewhere.

  • @bloo9699
    @bloo9699 Год назад +6

    "go out like a man" (cause I'm too chicken to)

  • @nickroeder7512
    @nickroeder7512 Год назад +3

    I have to say this is one of the greatest videos ive seen in a while

  • @professorpancakes6545
    @professorpancakes6545 Год назад +14

    Yes hogwatch is back!!!

  • @KingJT80
    @KingJT80 Год назад +4

    i swear if i hear Hyena Carlson laugh one more time...

  • @thechief043
    @thechief043 Год назад +4

    Hogwatch is back baby!!

  • @pureelusion648
    @pureelusion648 Год назад +5

    I see they clipped out the tiny moment where Hasan almost made fun of the Cuban just for the way he said 'banana' 💀