Why flat earthers scare me

Поделиться
HTML-код
  • Опубликовано: 18 ноя 2024

Комментарии • 27 тыс.

  • @lipsterman1
    @lipsterman1 6 месяцев назад +5488

    Social media has taught me two things. First, there are some incredibly brilliant people in the world. Second, they are vastly outnumbered.

    • @GeorgeSmiley77
      @GeorgeSmiley77 6 месяцев назад +56

      Okay, but I learned that in school.

    • @duran9664
      @duran9664 6 месяцев назад

      🚩FACT🚩
      Flat earthers r TOTALY right when it comes to the fact that many of space videos & photos r CGs, manipulated or fake; including the ones that get released by NASA🤏

    • @voidagent
      @voidagent 6 месяцев назад +32

      LOL (Lack of Logic)!

    • @tempname8263
      @tempname8263 6 месяцев назад

      @@craigdavidson2977 Internet and social media shown that they're much more likely to write word "WAR" 50 thousand times in a row and spend all of their bananas funding two big monkeys, that will go on to beat up half of monkey's population each

    • @andyhu9542
      @andyhu9542 6 месяцев назад +5

      Hold that thought for a while. This is as dangerous if not even more than flat-earth theory. This comment is very libertarian and would lead to pretty extreme ideas if accepted blindly.

  • @Martin_Siegel
    @Martin_Siegel 6 месяцев назад +2161

    Isaac Asimov said: "Anti-intellectualism has been a constant thread winding its way through our political and cultural life, nurtured by the false notion that democracy means that 'my ignorance is just as good as your knowledge."

    • @johndonson1603
      @johndonson1603 6 месяцев назад

      As much as I know flat earth theory is completely ridiculous, I disagree with that statement, people have the right to hold views that are clearly wrong , it’s their right as human beings , otherwise we end up with free thought and free speech being censored and controlled by those who believe they know better .

    • @puddintame7794
      @puddintame7794 6 месяцев назад +51

      God save us form the arrogance of the experts.

    • @iloveitall
      @iloveitall 6 месяцев назад +11

      Brilliant.

    • @TheSulross
      @TheSulross 6 месяцев назад

      that precisely defines the contemporary Woke mind virus

    • @Vaeldarg
      @Vaeldarg 6 месяцев назад +268

      @@puddintame7794 Actual experts have earned the right to be arrogant. Amateurs arrogantly claiming to know more than the experts have not.

  • @alandenton1024
    @alandenton1024 6 месяцев назад +1781

    Wikipedia says "The Flat Earth Society has members from all over the globe" Now that is what i call humour.

  • @OfentseMwaseFilms
    @OfentseMwaseFilms 3 месяца назад +87

    I also used to believe the Earth is flat, then I turned 5!

    • @ronpapi9539
      @ronpapi9539 3 месяца назад +1

      @@OfentseMwaseFilms Get back to me when you turn six.LMAO

    • @ronpapi9539
      @ronpapi9539 3 месяца назад +5

      @@OfentseMwaseFilms When you turn 6 ,rethink your answer.Its Flat and you were right at 4yrs old.

    • @myfrequencies1912
      @myfrequencies1912 3 месяца назад +4

      That's absolutely not how it works! lol
      You learned as a child that Earth was a globe, the same way you learned that a fat bearded magical man delivers presents into every home on Earth on Christmas Eve night.
      One of these beliefs you were allowed to doubt at a certain age, & to release.

    • @ronpapi9539
      @ronpapi9539 3 месяца назад +2

      @@myfrequencies1912 Thanks for confirming FE. WET Spinning Ball Earth is Lunacy .

    • @jeremywallis1960
      @jeremywallis1960 2 месяца назад +1

      And were propagandized... lol... you are so proud of your memorization of lies?

  • @mintonmiller
    @mintonmiller 6 месяцев назад +511

    Maybe we can get them to compromise. First get them to settle on the idea on Earth being a cube. Then we can gradually round off the edges over time.

    • @raminagrobis6112
      @raminagrobis6112 6 месяцев назад +15

      😂😂

    • @johnhough7738
      @johnhough7738 6 месяцев назад +9

      Genius! I love it ...

    • @paulkolodner2445
      @paulkolodner2445 6 месяцев назад +10

      I think you're on to something here.

    • @mar_twa_wod_aa
      @mar_twa_wod_aa 6 месяцев назад +4

      This or add polygons 😂

    • @johnjeffreys6440
      @johnjeffreys6440 6 месяцев назад +4

      Ask a flat-earther to call the earth a disc instead of flat. Most won't because the earth is flat from the surface, but not from space.

  • @dianafarmer5445
    @dianafarmer5445 6 месяцев назад +560

    As an Aussie I'm worried about them too. They said Australia dosen't exist, so I'm worried about where I've been for the last 65 years.

    • @stevenvarner9806
      @stevenvarner9806 6 месяцев назад +32

      Your country also resembles a hot dog in their flat earth models.

    • @dianafarmer5445
      @dianafarmer5445 6 месяцев назад +8

      @@stevenvarner9806 How lovely😅

    • @jagobabarron5501
      @jagobabarron5501 6 месяцев назад +27

      Your country is nothing but a huge tv studio in area 51.

    • @Roybotski
      @Roybotski 6 месяцев назад

      ​@@jagobabarron5501 uh what

    • @TeaParty1776
      @TeaParty1776 6 месяцев назад +9

      inside a kangaroo

  • @Mozart4000
    @Mozart4000 6 месяцев назад +1353

    I watch a lot of flat earth stuff on YT. What I've learned is that flat earthers don't want to learn anything. They just want their opinion confirmed. Anything that deviates from that is rejected.

    • @iamTheSnark
      @iamTheSnark 6 месяцев назад +88

      Many are able to escape. STST (Seek Truth Speak Truth) is a notable example. Recently, Rachie 00000 escaped, and she is now a debunker. And not even a bad one. FTFE (FIght the Flat Earth) has his own story of many people who saw his videos, and after a while sent Thank You mail to FTFE, helping them escape the nonsense.
      There must be more.

    • @Kim_YoJong
      @Kim_YoJong 6 месяцев назад +13

      That's everyone lol

    • @VonJay
      @VonJay 6 месяцев назад +69

      I remember bumping into an old friend of mine from middle school who was actually in my science class. Really cool guy as we got along really well. We went to Highschool together but didn’t hang out much maybe because we never had any classes together. Years later I bump into him and for some reason we talk about the earth being flat. And we argue for hours and hours and it’s crazy to me think that he’d take such a position. He even used “math” and “science” to try to prove his point. I asked him about the astronaut photos and he said fish eye lens to which I said that’s not how a fish eye lens works. It got to the point where I just said “everything you’re saying is irreproducible in the real world. Nothing you’re saying can lead to any type of invention or (like Sabine said) real world prediction. It can only satisfy your paranoia.”

    • @ptrinch
      @ptrinch 6 месяцев назад +81

      Flat earthers are more interested in the argument than the science. If you ignore them, they won't get what they are looking for and will eventually go away. Alternatively, in the immortal words of the half dozen people attributed to this quote.... "Never argue with stupid people, they will drag you down to their level and then beat you with experience."

    • @QuantumPhyZ
      @QuantumPhyZ 6 месяцев назад

      It's schizophrenia. Or another mental illness.

  • @vladimiraltuve
    @vladimiraltuve Месяц назад +8

    Some flat earther wrote in a forum "Chile does not exist. It's a fictional country and all those people are just payed actors". Then, one of those actors wrote this answer: "So, please let me switch my role from poor to rich, at least for next season"

  • @caravanlifenz
    @caravanlifenz 6 месяцев назад +270

    As a New Zealander, I'm concerned by how dangerously close they've placed us next to the edge of the world where the water drops off 💧😭

    • @johnkean6852
      @johnkean6852 6 месяцев назад +9

      The flat earth society model is unrepresentative of current flat earth beliefs. Do more research before you spout ignorance.

    • @russell2952
      @russell2952 6 месяцев назад +23

      No worries. Flat earthers don't have a model. They usually take a polar projection and call that their map, but it obviously doesn't fit any real world observations. As Sabine said, they can't so much as explain a sunrise.

    • @jacksonknock1833
      @jacksonknock1833 6 месяцев назад +17

      @@russell2952 For real. It always goes like this:
      - "You still don't have a map"
      - "Lmao, have you heard of Gleason's? Do your research!"
      - "None of the distances there seem to correlate with actual real life distances, what's up with that?"
      And then it's either "It's just a representation, not an actual map" or they just ignore you and pretend the conversation never happened.
      Same with model. Never seen a flerf take any conversation to its logical conclusion - they always run away.

    • @cullen3624
      @cullen3624 6 месяцев назад +7

      I have a large wall map of the world and new Zealand isn't even it.😂

    • @ZlatnoPeroTV
      @ZlatnoPeroTV 6 месяцев назад +5

      Wait, aren't they denying the existence of Australia?

  • @johnmaynard869
    @johnmaynard869 6 месяцев назад +484

    “Those who can make you believe absurdities, can make you commit atrocities.”
    Voltaire

    • @johnmaynard869
      @johnmaynard869 6 месяцев назад +1

      @GoldIsSilent0 Games without frontiers.

    • @AngryGroceries
      @AngryGroceries 6 месяцев назад +6

      funny thing about that... on some level, everything is absurd

    • @johnmaynard869
      @johnmaynard869 6 месяцев назад +11

      @@AngryGroceries that’s absurd. 😜

    • @travcollier
      @travcollier 6 месяцев назад +5

      @@AngryGroceries The original quote is longer, more nuanced, and in French.

    • @justincase4812
      @justincase4812 6 месяцев назад +1

      The US government apparatus, most governments likely.

  • @Vohtwomax
    @Vohtwomax 6 месяцев назад +510

    I recently had a....debate with a flat earther. We were proceeding with the discussion up until he told me, AND I QUOTE, “not to use science and logic” when trying to persuade him.
    So ended THAT conversation.

    • @godfreyofbouillon966
      @godfreyofbouillon966 6 месяцев назад

      Well that was your first mistake. Someone honestly believing in flat earth has IQ of a chimp at best and no reasonable debate is possible.

    • @MyrKnof
      @MyrKnof 6 месяцев назад +29

      Its because he wont understand it, so he asks you to not talk gibberish. You cant start at that point, because he is too dumb, you need to start at improving his fundamental knowledge of before talking "advanced" stuff like.. simplified gravity.

    • @k_tell
      @k_tell 6 месяцев назад +7

      He may have fallen for the charlatan Samuel Rowbotham's so called "Zetetic Method". Interesting question to ask someone who actually believes in the Zetetic Method is "What is the Zetetic Method?".

    • @DragonOfTheMortalKombat
      @DragonOfTheMortalKombat 6 месяцев назад +17

      So what were you supposed to use ? Feelings ? Lol
      You can tell earth ain't by using very common knowledge

    • @ryzikx
      @ryzikx 6 месяцев назад

      there are non-scientific arguments to convince someone out of flat earth

  • @Fraser142
    @Fraser142 4 месяца назад +7

    False information is so dangerous and scary i actually have a friend that believes the earth is flat and i try to show him videos constantly to prove its not
    and he refuses to trust what im showing him thinking that the information has holes in it.Seeing first hand experience its so baffling to witness in person.

    • @ronpapi9539
      @ronpapi9539 4 месяца назад +1

      @@Fraser142 CGI is all you have.Sad!

    • @daddy4934
      @daddy4934 4 месяца назад +4

      ​@@ronpapi9539Provide evidence for that claim.
      Oh wait, you have none.
      Sad story.
      Now where is the accurate FE map, still nothing ?
      I thought so.

    • @insersed6525
      @insersed6525 3 месяца назад

      Your friend has visible observations as evidence of Flat Earth. All you have are images from a company directly controlled by the US government. And we all know how trustworthy the government is.

  • @janthony721
    @janthony721 6 месяцев назад +615

    Flat Earthers have nothing to fear but Sphere itself.

    • @roberteatwell6827
      @roberteatwell6827 6 месяцев назад +18

      Brilliant pun. Love it. Deserves more recognition.

    • @TheBreenGene
      @TheBreenGene 6 месяцев назад +11

      Underrated comment for sure

    • @paulg444
      @paulg444 6 месяцев назад +8

      That one is for the ages !!

    • @vibaj16
      @vibaj16 6 месяцев назад +2

      @@roberteatwell6827 i mean, it's a _very_ common joke

    • @paulward4268
      @paulward4268 6 месяцев назад +3

      janthony721. Magnificent.

  • @exokitten
    @exokitten 6 месяцев назад +78

    I tried my best to debate a flat earther while remaining respectful. I was unsuccessful at swaying him, but here are my best, easy to digest arguments that anyone facing the same type of situation can use:
    • Ships and airlines use globe coordinates to navigate. Ask a pilot or a captain and they will confirm.
    • If the Earth were flat you would be able to see all mountain ranges with a telescope.
    • Light cannot shine down in an isolated location without being visible to all those on the same plane beneath it. The flat earth map does not align with how light functions.
    • If we were all on a flat surface we would all see the same constellations.

    • @brucetucker4847
      @brucetucker4847 6 месяцев назад +7

      The Sun has a lampshade. A lampshade that changes shape with the seasons. Didn't you know?
      (RIP Sci Strike, you are missed but never forgotten)

    • @mcv2178
      @mcv2178 6 месяцев назад +2

      I like your mountain range example.

    • @BOO-ii3ni
      @BOO-ii3ni 6 месяцев назад

      You are dumber than him for trying to debate about physics with someone that never tried to learn physics.

    • @goodfortunetoyou
      @goodfortunetoyou 6 месяцев назад

      Looks somewhat fun.
      1. Using spherical coordinates does not in and of itself imply the earth is a sphere. Indeed, I believe that they can be mapped into the euclidean coordinate system.
      2. There can be fog, and objects obstructing your view. Additionally, there could be an effective render distance.
      3. If light is emitted as if from a flashlight, the light illuminates a cone between the source and the plane. Now, you might argue that the sun is a sphere, and is a point source. However, all we can observe is the 2D dome of the sky, where it presents as a disk.
      4. The world loads in semi-continuous chunks, where each star can be seen a a puncture of the sky-dome (let's call it the firmament or something) and is only visible from chunks illuminated by the star's light cone.

    • @livestock9722
      @livestock9722 6 месяцев назад +5

      1 minute of latitude/longitude equals 1 nautical mile (slightly off in Northerly/Southerly airspace due to... well duh?). Pretty handy on aeronautical maps when trying to find coordinates. This would absolutely not work in a flat earth universe.

  • @passais
    @passais 6 месяцев назад +148

    I think part of the attraction is also being part of a select club and feeling smarter than the "sheeple" because you "figured something out" that others haven't.

    • @betaorionis2164
      @betaorionis2164 6 месяцев назад

      I think this is the main reason to be a flatearther. It's like a drug which (like all drugs) gives you a pleasurable sensation (to be smarter than the rest), but detaches you from the reality (that the Earth is not flat).
      Also, most flatearthers seem to have had very poor school records and it may have made them resentful against knowledge.

    • @LoneHorizons
      @LoneHorizons 6 месяцев назад

      That’s it exactly. Who wants to be successful and accepted in society if society is all based on a lie? So they become a flerfer and feel superior.

    • @robvanderwell5695
      @robvanderwell5695 6 месяцев назад +8

      In the same fashion the masses feel superior because they belong to the 'true knowledge incrowd'.

    • @passais
      @passais 6 месяцев назад +5

      @@robvanderwell5695 no actually, I was convinced when I made my trip to IO.

    • @Enaiarr
      @Enaiarr 6 месяцев назад

      @@robvanderwell5695 But they don't though, do they. For the vast, vast, vast majority of people who know the earth is a globe or that 5G isn't mind control or that lizard people don't exist, it's not a big deal. They don't all gather on online forums to discuss the latest in globe-earth evidence - it's a total non-issue that barely ever gets thought about or brought up.
      The problem that causes flat earthers is the same problem that causes incels and pulls some people into religious cults: it's people with not a whole lot else going on in their life for whom "the earth is secretly flat" fills that void and forms the keystone of their identity.
      Normal well adjusted folk can weather individual beliefs or traits being scrutinised because it's only a small part of their overall personality. For flat earthers it's all they've got, so they take it much harder and are more likely to double-down and get defensive to protect such a core part of their life. It's why flat earthers need to in many cases be deprogrammed like incels and cult members by supporting them to build confidence in other areas of their life so they can safely tackle the lies they were fed from within the flat earth community.

  • @nagaraworkshop
    @nagaraworkshop 5 месяцев назад +17

    It makes me incredibly sad to think that a substantial number of people think that science is just 'made up' or 'bought into'; as if everything is 'a matter of opinion'. Conversations with those people are immensely frustrating bordering on the impossible. When rationality goes, so does safety, as history shows us time and again.

    • @frantaspacek
      @frantaspacek 5 месяцев назад +2

      @joenahhas4377 thank you for providing a great example of someone who can't be reasoned with

    • @crazymage9636
      @crazymage9636 5 месяцев назад +2

      Just recently everybody on earth was told to trust the science, allot of people injured and got sick anyway for putting their faith in scientists, doctors, govnment pharmacists. I can understand why people think the earth is flat and I don't blame them at all. Somewhere along the line we let them down and now we laugh at them and blame them for being stupid.

    • @frantaspacek
      @frantaspacek 5 месяцев назад +5

      ​@@crazymage9636 When did that happen? Did you mean the time where the doctors and researchers did their absolute best to save millions of lives but people still ignored their recommendations because they thought they knew better?
      The only reason why some things didn't make sense is because you only listen to celebrities and politicians, not the actual experts.

    • @crazymage9636
      @crazymage9636 5 месяцев назад

      @@frantaspacek celebrities and politicians? Millions saved? Scientists and researchers trying their best? Do you get all your information from your television? Or do you go looking for the answers you want on Google?
      Lol, millions saved! That's honestly too good! 😆 Scientists trying their best! Yeah I wouldn't have minded being at the top of that global pyramid scheme. Get them scared enough and they will turn on their families lol.
      Keep on following the news 👍

    • @frantaspacek
      @frantaspacek 5 месяцев назад

      @@crazymage9636 Did your last message contain any actual arguments? I can't see any, maybe you should try again.

  • @theronwolf3296
    @theronwolf3296 6 месяцев назад +342

    I got verbally attacked and blocked after asking a FE how it could be midnight in Tokyo and mid day in NY at the same time.

    • @GusOfTheDorks
      @GusOfTheDorks 6 месяцев назад

      I asked someone who believed in the round earth about how we know a vaccine is safe and effective if it hasnt been given the time for proper clinical trials.
      They started yelling at me that I was trying to kill people. I left after they started telling me I should be put against a wall and shot with a gun.

    • @rodmehta5356
      @rodmehta5356 6 месяцев назад +32

      Time is fake 😂

    • @rickinielsen1
      @rickinielsen1 6 месяцев назад +1

      Tokyo is obviously fake! Japanese people are all in on it!

    • @GusOfTheDorks
      @GusOfTheDorks 6 месяцев назад +2

      Oh fun, looks like they deleted my comment.

    • @bjornfeuerbacher5514
      @bjornfeuerbacher5514 6 месяцев назад +33

      @@shortgamingmovies2685 How could the sunshine be "local"? If the sun if above NY, why can't its light reach Tokyo?

  • @Scinquisitor
    @Scinquisitor 6 месяцев назад +160

    I really recommend the documentary called "behind the curve" about flat-earthers. The funniest moment is when a flat-earth blogger rants about her collegues, who claim she is part of a conspiracy to discredit the flat-earth movement. She talks about how it's unfair when people claim that you are part of conspiracy when you are not, and when they make things up about you. Then for a moment she considers "what if all those scientists I accuse of conspiracy feel the same way"... just then to add "but those guys are in fact conspirators!"

    • @User-yy6xt
      @User-yy6xt 6 месяцев назад +3

      It’s made by people who’s goal is to make you think it’s too stoppid to look at and you fell for it.

    • @johnqpublic7608
      @johnqpublic7608 6 месяцев назад +14

      @@User-yy6xt
      because it's stupid.

    • @mynamemylastname7179
      @mynamemylastname7179 6 месяцев назад +6

      You should watch "the martian" documetry when Nasa sent matt damon to grow potatoes on mars back in 2015. Much better then that Apollo 11 💩 from 1969 😂😂😂😂😂😂😂😂😂😂

    • @User-yy6xt
      @User-yy6xt 6 месяцев назад

      @@johnqpublic7608 Yeah it was. It was totally stupid. It had not one thing that was true about the flat earth or flat earthers in there. It was made up garbage designed to keep you all ignorant to what people who see the flat earth see and where they look to see it. They won’t v show you what we see because then you would see it too.

    • @Matuse
      @Matuse 6 месяцев назад +3

      @@User-yy6xt By all means, dazzle us with how smart you are. Prove anything about flat earth.

  • @RichardNeill01
    @RichardNeill01 6 месяцев назад +245

    I always assumed that the flat-earth movement was a very extended joke, where one of the rules was "you aren't supposed to admit it".

    • @acu01136
      @acu01136 6 месяцев назад +26

      I am pretty certain that this is the case.

    • @herbertshallcross9775
      @herbertshallcross9775 6 месяцев назад +13

      "First Rule of Fight Club" kind of thing.

    • @brianfox771
      @brianfox771 6 месяцев назад +70

      I think it started off this way, but then it became a situation where you should never underestimate the human capacity for stupidity.

    • @noumenon6923
      @noumenon6923 6 месяцев назад +12

      That's what I've always thought as well,... just a really committed dry humour.

    • @815TypeSirius
      @815TypeSirius 6 месяцев назад +12

      First rule of humans: all jokes become real.

  • @richardkalin8184
    @richardkalin8184 5 месяцев назад +29

    There's more here than a simple belief. There's a sense of camaraderie, a sense of us versus the world. So many have so much invested in this that they just can't (won't) go back.

    • @ronpapi9539
      @ronpapi9539 4 месяца назад +2

      Once you go Flat you can't go back.

    • @davidmescher2526
      @davidmescher2526 4 месяца назад +1

      ​@@ronpapi9539Not always. In your case, troll, it's because you can't regrow the brain cells you've killed.
      Smarter people can realize that flat Earth isn't consistent with itself, or observable reality.

    • @hadesunderworld4203
      @hadesunderworld4203 4 месяца назад

      Sad really

    • @hadesunderworld4203
      @hadesunderworld4203 4 месяца назад

      They spend their lives chasing a result that is impossible , as if it matters anyways … and it’s insulting to every scientist , physicist , astrologist … that has ever lived ….
      Man ancestors knew this from looking at stars …
      But flerfs don’t get it ….. so Nuh uh … its not true , its pathetic lmfao 😂

    • @ronpapi9539
      @ronpapi9539 4 месяца назад

      @@hadesunderworld4203 So why is it OK to insult our Creator?

  • @timothytumusiime2903
    @timothytumusiime2903 5 месяцев назад +256

    The asteroid literally flipping the dinosaurs of into space is just bloody funny 🤣🤣

    • @admiralspandy
      @admiralspandy 5 месяцев назад +7

      Yeah, that was hilarious!

    • @JackKnight762
      @JackKnight762 5 месяцев назад +1

      not if you're Jim Morrison

    • @dominiccharvet546
      @dominiccharvet546 5 месяцев назад

      ruclips.net/video/WqBNeCl1J4k/видео.html

    • @borninvincible
      @borninvincible 5 месяцев назад +3

      That one killed me 😂

    • @dominiccharvet546
      @dominiccharvet546 5 месяцев назад

      @@borninvincible King James Bible
      The heaven, even the heavens, are the LORD'S: but the earth hath he given to the children of men.

  • @seanemery6019
    @seanemery6019 6 месяцев назад +461

    I met an actual flat earther in 2018 at, of all places, the Grand Canyon. He didn’t even believe in gravity. It was a completely bizarre experience. I was left completely stupefied by the crazy, to be honest.

    • @subject8332
      @subject8332 6 месяцев назад +17

      You have been Gish Galloped, my friend!

    • @SabineHossenfelder
      @SabineHossenfelder  6 месяцев назад +260

      I once met a creationist who believed the earth is less than 10000 years old. At first I thought he was joking. Similarly bizarre experience!

    • @drgetwrekt869
      @drgetwrekt869 6 месяцев назад +31

      and he was floating at the top of the canyon.

    • @ploppyploppy
      @ploppyploppy 6 месяцев назад

      Let me guess - they used the word 'theory' completely in opposite to its actual meaning? If I hear 'gravity is only a theory' suggesting it doesn't exist I just stop all communication and move away. These people have *nothing* to add to the world.

    • @SoloRenegade
      @SoloRenegade 6 месяцев назад +70

      did you ask him to try jumping across the canyon?

  • @mikotagayuna8494
    @mikotagayuna8494 6 месяцев назад +153

    Flat earth prophets know exactly what they are doing. It's not important whether or not they actually believe what they're preaching but it is very important for them that people continue buying their books, going to their conferences and subscribing to their platforms. When confronted, they will double down and claim conspiracy because attacking their beliefs threatens their livelihood, and thus, their perceived right to live comfortably.

    • @mobilephil244
      @mobilephil244 6 месяцев назад +18

      It goes way deeper than just their living. Psychologically, conspiracy theories come from the same place as religious fanaticism

    • @devthis5135
      @devthis5135 6 месяцев назад +3

      It's so true, and at the same time, so sad...

    • @thstroyur
      @thstroyur 6 месяцев назад +2

      "it is very important for them that people continue buying their books, going to their conferences and subscribing to their platforms" Meaning that, in order to be a Flat-Earther, one is obliged to do all those things?

    • @rclaws3230
      @rclaws3230 6 месяцев назад

      The commies want their perceived right to live comfortably upheld by everyone else's tax dollars; at least these fools are making people laugh while peddling their nonsense.

    • @arycogito
      @arycogito 6 месяцев назад +5

      ​@@thstroyur the more you preach an idea, the more you increase the likelihood of finding someone who accepts it. Not all flat earthers will support the preachers but even if 5% of the supporters do the bare minimum of visiting their dumb seminars, or buying their books for whatever reason, (it most likely stems from a need to socialize and actually interact with someone on their level as most of society is clearly way too intellectually superior compared to them) will make them a fortune

  • @Wesley-eu7rn
    @Wesley-eu7rn 3 месяца назад +5

    We had a school teacher who poured water over a ball representing the earth just like this example to explain why water flows downhill. No I'm not joking.

  • @TylerAult
    @TylerAult 6 месяцев назад +133

    "They're trying to figure out how nature works" (6:27) -- No, they're not. I know this is a segway to the ad but this is the whole problem. Flat Earthers begin with a conclusion and then try to justify it, much like religious people. They aren't interested in observation except to selectively prop up their pre-existing assertion.

    • @MarcPagan
      @MarcPagan 6 месяцев назад

      Leftists, Democratic Party voters in the USA, are on par with Flat Earthers
      ......for their impressive immunity to facts, science, and reality.

    • @michaelsommers2356
      @michaelsommers2356 6 месяцев назад +14

      A segway is a scooter. A segue, pronounced the same way, as two syllables, is a transition.

    • @rahantr1
      @rahantr1 6 месяцев назад +1

      Oh come on, cut them some slack. Every scientific field has some p-hacking issues.

    • @deathsinger1192
      @deathsinger1192 6 месяцев назад +3

      except, religious people don't necessarily ignore proof, you cannot proof that god doesn't exist, that doesn't proof his existence either, but you can disprove flat earth quite easily

    • @xintophotography9848
      @xintophotography9848 6 месяцев назад +7

      @@deathsinger1192religious people believe nonsense proofs and nonsense logic are actually proofs based on actual logic. Also, most atheists have concluded that religions are dumb and/or that gods are incoherent nonsense. It is rare for them to argue that gods are provably nonexistent (and indeed, religious cosmologies are so ill defined that it isn’t clear what is supposed to be disproven).

  • @NastarNordmire
    @NastarNordmire 6 месяцев назад +162

    One thing that I've seen flat earthers do is find every reason to ignore the findings of their own experiments when they prove that the earth is a globe.

    • @NathanDyer-w1l
      @NathanDyer-w1l 6 месяцев назад +30

      “You know, the very powerful and the very stupid have one thing in common. They don’t alter their views to fit the facts. They alter the facts to fit their views.” - The Face of Evil: Part Four (1977)

    • @shadowshatto
      @shadowshatto 6 месяцев назад

      I feel like flat earthers are fearful, I think they are scared of the universe and what it means and just how vast and unknowable it can be. My mom is an antivaxxer and yet she was a nurse and a pretty smart lady, but when you let your fear run away you become irrational and I think scientists laughing off and not taking it seriously will only lead to More of this that will be harder to weed out and fix

    • @bob_the_bomb4508
      @bob_the_bomb4508 6 месяцев назад +8

      “Interesting…”

    • @davidhollenshead4892
      @davidhollenshead4892 6 месяцев назад

      One killed himself with one of his own experiments, if he was actually being honest about being a flat earther...

    • @ronpapi9539
      @ronpapi9539 6 месяцев назад

      @@NathanDyer-w1l is. Donald Trump!

  • @terrancat
    @terrancat 6 месяцев назад +123

    The one flat earther I talked to believed every planet was spherical EXCEPT Earth. I was done. I can't even.

    • @saldownik
      @saldownik 6 месяцев назад +3

      It seems like the lady has jus started to discover the truth.

    • @ThomasKundera
      @ThomasKundera 6 месяцев назад +11

      @@saldownik : That flerfs are dumb?

    • @spiderprime
      @spiderprime 6 месяцев назад +8

      Some don't even believe there is space and other planets and that we're the only thing to exist.

    • @ronpapi9539
      @ronpapi9539 6 месяцев назад +1

      @@spiderprime That's me.

    • @GiveMeSpaceTravel-bg8td
      @GiveMeSpaceTravel-bg8td 6 месяцев назад +2

      Yes there seems to be one flat earth theory per flat earther. At least all us globeheads accept more or less the same rubbish.

  • @Angarsk100
    @Angarsk100 5 месяцев назад +86

    There's 2 kinds of Flatearthers: 1- The ones with a larger shoe size than IQ, and 2- The ones who know it's all nonsense, but make a lot of money out of it.

    • @Matuse
      @Matuse 5 месяцев назад +1

      None of them make a lot of money out of it. There's very little money to be had from the people who fall for the flat earth hoax - your intelligence needs to be so low that even minimum wage jobs are a serious challenge, and people like that rarely have much in the way of disposable income. Plus, there aren't very many of them and RUclips ad revenue is VERY low.

    • @marksprague1280
      @marksprague1280 5 месяцев назад +2

      The Flat Earth and the Lunar Landing Denial Cults are each composed of 95% idiots and 5% con men.

    • @KateyWatson
      @KateyWatson 5 месяцев назад +5

      My sister has become a conspiracy follower. My son tried to reason with her saying "an eighteen year old wrote that and he thinks it's hilarious that you believe it".
      Older people often trust what they read online, we're used to journalistic integrity.
      We don't always appreciate the way younger people who've grown up with social media treat it.

    • @ronpapi9539
      @ronpapi9539 5 месяцев назад

      @@KateyWatson Thanks for confirming FE.

    • @Mrorlgloth
      @Mrorlgloth 4 месяца назад +1

      Which one that because religion said so ?

  • @mikekilpatrick5686
    @mikekilpatrick5686 6 месяцев назад +115

    Like the saying goes, arguing with a flat earther is like playing chess with a pigeon. it knocks the pieces over, craps on the board, and flies back to its flock to claim victory

    • @scotttaylor9133
      @scotttaylor9133 6 месяцев назад

      Ahh, the unwashed masses, they are so disgusting, aren't they?

    • @teacherella1338
      @teacherella1338 6 месяцев назад +8

      Sounds like playing chess with Trump 😂

    • @User-yy6xt
      @User-yy6xt 6 месяцев назад

      We don’t argue with people like you.

    • @ThatBonsaipanda
      @ThatBonsaipanda 6 месяцев назад +4

      One variation that I like goes ".. and strut around like they won the game."

    • @User-yy6xt
      @User-yy6xt 6 месяцев назад

      @@ThatBonsaipanda you people are worthless

  • @Muritaipet
    @Muritaipet 6 месяцев назад +219

    Bob the Science Guy summarised it - "There are two types of Flat Earthers. The ones who believe, and the ones selling them T-shirts"

    • @MyName-tb9oz
      @MyName-tb9oz 6 месяцев назад +4

      No, there are also the trolls doing it for the, "lols."
      Years ago when I was on Fecesbook there was a girl on my friends list who I later discovered was a flat-earther. I saw people commenting on her page and I swear some of them were just egging her on to be nasty. I really felt bad for her. It was quite sad and cruel.

    • @richardalvarez2390
      @richardalvarez2390 6 месяцев назад +1

      There are also those that were always attacking flat earthers with our NASA facts and as we saw through the many lies, we became flat earthers.

    • @AnirudhTammireddy
      @AnirudhTammireddy 6 месяцев назад +1

      @@MyName-tb9oz I'm confused who are the 3rd type of flat earthers? the girl in your story? But she wasn't a troll in your story?

    • @Muritaipet
      @Muritaipet 6 месяцев назад +4

      @@MyName-tb9oz LOL @ "fecesbook."
      I agree there's likely a lot of trolls, pretending to be flat earthers.

    • @Muritaipet
      @Muritaipet 6 месяцев назад +15

      @@richardalvarez2390 Oh absolutely. I live in New Zealand, and we all have to pretend about Antarctica, and take turns guarding the ice wall.

  • @demidron.
    @demidron. 6 месяцев назад +221

    Every time I asked them why I, in the southern hemisphere, see the stars revolve clockwise around a point in the sky directly south of me, whereas they, in the northern hemisphere, see them revolve anticlockwise around a point in the sky directly north of them, they disappear.

    • @hodgeyhodge8414
      @hodgeyhodge8414 6 месяцев назад +10

      Have you actually stared at the sky long enough to independently verify that that's what they do? The sky moves very slowly. I have watched the moon crawl across the sky, but never the sun or the stars. In any case, I think you'd be hard-pressed to find a flat-earther who has travelled to both hemispheres of the earth...

    • @dynamicflashy
      @dynamicflashy 6 месяцев назад +85

      @@hodgeyhodge8414 Turn on a camera to record the sky, and then watch it back sped up.

    • @noway905
      @noway905 6 месяцев назад +24

      I live in the northern hemisphere and have watched the stars at night for over 60 years and can attest that they rotate clockwise around a fixed point called the north star. The big dipper proves the stars do not "disappear."

    • @w01dnick
      @w01dnick 6 месяцев назад +26

      ​​@@hodgeyhodge8414it's not that slow, actually Moon, Sun and stars rotate at almost the same speed, because it's mostly Earth rotation. As for seeing that, you don't even need a telescope. Just remember where stars are at midnight and check hour later. They'll move for about 15°, or 30 Moon's diameter, that is pretty noticeable. With telescope that rotation is a PITA, because you have constantly adjust direction to see planets, stars.
      P.S. 30 diameters - that is near sky equator, closer to the Polar star lesser is difference, but it's still noticeable a lot.

    • @Polit_Burro
      @Polit_Burro 6 месяцев назад +5

      There is no "southern hemisphere".

  • @JeremyHickson
    @JeremyHickson Месяц назад +1

    Asked a flat earther if they believed in magnifying glasses. They said yes. I said come over tonight and I will show you with my telescope that planets are spherical. Silence from them.

  • @SinclairA
    @SinclairA 6 месяцев назад +78

    "They are more confident than the average person ..." that's Dunning-Kruger for you there.

    • @catcatcatcatcatcatcatcatcatca
      @catcatcatcatcatcatcatcatcatca 6 месяцев назад +13

      It’s not Dunning-Kruger. The effect is often misrepresented.
      In the study, the people with little knowledge still correctly identified they had less knowledge then the experts, they just wastly underestimated the information gap, as they weren’t even aware of much of the knowledge the experts knew.
      The experts in turn overestimated the knowledge the average people had. It’s not that they doubted themselves or weren’t aware of their position as an expert.
      Flat earthers aren’t just more confident in their knowledge, they flat out think the experts are wrong or lying. They aren’t just unaware of the knowledge gap, but believe its just filled with lies and deception.

    • @HolyMith
      @HolyMith 6 месяцев назад +2

      ​@@catcatcatcatcatcatcatcatcatcathank you for clarifying that for me, I wasn't aware that was the study that was actually done.

    • @DarkShroom
      @DarkShroom 6 месяцев назад

      @@catcatcatcatcatcatcatcatcatca "The experts in turn overestimated the knowledge the average people had"
      -i don't think you have any evidence of that claim otherwie you would have probabally said it, in my experience they are confident in their own reasoning and think the experts are duped, if this is because they are unable to grasp basic science, as most of us judge, then it's technically the Dunning-Kruger effect just i guess i'm tired of people using it when arguing with one another, which is maybe why Sabine didn't mention it

    • @faithismespeaks6848
      @faithismespeaks6848 5 месяцев назад

      @SinclairA, I was wondering when one of you liberal thinkers was going to use the Dunning Kruger thing. I could use the cognitive dissonance thing on you but you probably wouldn't grasp that either. The DK statement became almost as popular as your cat rolling all the things off the edge of the Earth. The problem with most BAAL worshipers is you are incapable of being honest, so you resort to smearing people instead of actually looking at the real evidence. I bet you have never even looked at any evidence, or considered why science would create a lie so big nobody could imagine it. I can say honestly I don't know the exact model, I can only state it is NOT what they say it is. Yes everything else is moving but we aren't, it appears to be like a clock, a divine construct. I don't think they will ever really go to some distant planet, besides what would be the point if the exact same group of mask holes were in charge. I do believe the only thing they really sent to so called "space" were people's imaginations. Which easily explains all the science fiction programming in movies, and all this "alien" BS.

  • @nosferatu5500
    @nosferatu5500 6 месяцев назад +137

    i think logic classes should be mandatory in school. Its fundamental for all subjects, mathematical formalism and later in life.

    • @drgetwrekt869
      @drgetwrekt869 6 месяцев назад +5

      school and all is mandatory since 200 years or so (even more). its not about schools. the problem is society as a whole.

    • @SoloRenegade
      @SoloRenegade 6 месяцев назад +10

      Philosophy classes. The basis of all science and the rules of debate are taught in Philosophy. There is a reason PhD is the most widely know Doctoral degree (PhD = Doctorate of Philosophy).

    • @edene.4870
      @edene.4870 6 месяцев назад

      It *is* mandatory. Logic and critical thinking are an essential part of classes like maths, physics, chemistry, history, and most importantly literature analysis. And these classes are all pretty much core classes in most civilised countries.
      If you take a look, most flat earthers are either US Americans or people who are from another country but have had little education and a lot of exposure to US centric media and social media.
      And an even closer look will reveal that these US Americans are from states where education has been whittled down and outright butchered.
      This is not a coincidence.

    • @juimymary9951
      @juimymary9951 6 месяцев назад

      Absolutely

    • @joansparky4439
      @joansparky4439 6 месяцев назад

      not even basic economics is based on logic.. which is why flat earthers have become a phenomenon in the first place.

  • @bitphr3ak
    @bitphr3ak 6 месяцев назад +272

    The first rule of The Dunning-Kruger Club:
    You don't know you're in The Dunning-Kruger Club!

    • @Azariy0
      @Azariy0 6 месяцев назад +9

      At this point anyone trying to find the truth should assume by default they're in the club, even if all evidence points to otherwise.

    • @bitphr3ak
      @bitphr3ak 6 месяцев назад +2

      @Hudoi-1 humm, you might want to read up on the Dunning-Kruger effect...because it's not as helpful as you might think, as a truth finding flex.

    • @t16205
      @t16205 6 месяцев назад +2

      @@Azariy0 LOL

    • @Rdlprmpf12
      @Rdlprmpf12 6 месяцев назад +4

      If you don't know whether you're in The Dunning-Kruger Club, you're not in The Dunning-Kruger Club.

    • @mormatus
      @mormatus 6 месяцев назад

      This is hilarious 🤣

  • @BobDiaz123
    @BobDiaz123 3 месяца назад +10

    In a funny way, I have to thank the Flat Earth People, because they challenged me to prove the Earth is not flat. So I thought up an experiment to prove whether it's flat or not. It was fun to go through the steps to prove that the results proved the Earth is NOT flat.

    • @MsCaleb79
      @MsCaleb79 3 месяца назад

      How were you able to prove? Did you go to the moon too? You can buy a ticket from me If you like, its discount now, only 2000000$

    • @ronpapi9539
      @ronpapi9539 3 месяца назад

      @@BobDiaz123 Waiting............

    • @BobDiaz123
      @BobDiaz123 3 месяца назад +6

      @@MsCaleb79 Are you a flat Earth believer? Because your comment is 100% stupid. I said NOTHING about going to the moon, so why suggest I said it?

    • @BobDiaz123
      @BobDiaz123 3 месяца назад +3

      @@ronpapi9539 Waiting for what?

    • @ronpapi9539
      @ronpapi9539 3 месяца назад

      @@BobDiaz123 All talk ,no walk.No Proof!

  • @itchyomalley
    @itchyomalley 6 месяцев назад +19

    You can't reason someone out of something they didn't reason themselves into. My brother's a flat earther (among other things) He's been dismissed by his family and friends for so long, he seeks out like minded individuals and lives among them now.

    • @mkx9095
      @mkx9095 6 месяцев назад

      ruclips.net/video/qEaHjPF47_E/видео.htmlsi=CkC3Hh1CvfdJm9z1

    • @chetb2593
      @chetb2593 2 месяца назад

      Yeah, people like that...and I'm sorry for your family...seek out echo chambers rather than face cognitive dissonance.

  • @SomeMorganSomewhere
    @SomeMorganSomewhere 6 месяцев назад +79

    The irony is that I've some vague recollection that Flat Earth Society was originally created by people who weren't ACTUALLY flat-earthers, it was more like the Society for Creative Anachronism, little did they know they'd get overtaken by the actual flat-earthers...

    • @worsethanhitlerpt.2539
      @worsethanhitlerpt.2539 6 месяцев назад

      People who just like to argue for no reason like teenagers and Woke college students

    • @jal051
      @jal051 6 месяцев назад +4

      Yeah. The first video Sabine made was about that. She, in fact, defended the cynical aspect of the original flat Earth movement.

    • @Justwantahover
      @Justwantahover 6 месяцев назад

      There are a fair few poes, who just pose as flerths, for money and "fame". If any flerth who shows any hint of intelligence, most probably aren't flat earthers. And the dummies (who are genuine flerths) just follow. The poes might write a book called "Flat Earth for Dunmies". 😅

    • @User-yy6xt
      @User-yy6xt 6 месяцев назад

      Other way around DA

    • @johnkean6852
      @johnkean6852 6 месяцев назад +2

      The flat earth society is unrepresentative of modern flat earth theory

  • @magilviamax8346
    @magilviamax8346 6 месяцев назад +1016

    I was under the impression that flat earthers were just a bunch of people in search of attention, cause none should be that incompetent. But if Sabine feels the need to talk about it, it really must be worrisome. My faith in humanity is dwindling.

    • @SabineHossenfelder
      @SabineHossenfelder  6 месяцев назад +205

      I guess you are right that search for attention is part of it for the people who you see on social media. But there's a larger group of quiet people behind them, the ones who share, lurk, and like. It's also really hard to make headlines with flat earth theories. I think that the attention-seekers are more of the sort who come up with a proof of the Riemann hypothesis or a theory of everything etc, something that plausibly would be front page news.

    • @marcinnawrocki1437
      @marcinnawrocki1437 6 месяцев назад +22

      Nah arguing about silly stuff on FE forums is amusment.

    • @sababaratashvili8629
      @sababaratashvili8629 6 месяцев назад +39

      @@SabineHossenfelder You underestimate amount of attention seekers. It is combination of attention seekers, stupid people and people who just do it for fun.
      I worry much more about politics and activism in science, which only feeds such "sceptics".

    • @pablov.viteri9345
      @pablov.viteri9345 6 месяцев назад +20

      @@SabineHossenfelder Follow the money who founded

    • @donm5354
      @donm5354 6 месяцев назад +14

      Sometimes I go on Flat Earth Society forums just to mess with heads of people literally angry that people CLAIM the Earth is FLAT.

  • @ddgyt50
    @ddgyt50 Месяц назад

    I would love to hear a flat earther explain how a pendulum works

  • @rocketscience4516
    @rocketscience4516 6 месяцев назад +204

    Funny how they trust in science when they go out to buy a mobile phone, or pay for internet access. Or buy a TV. Or... (list goes on and on).

    • @Thomas-gk42
      @Thomas-gk42 6 месяцев назад +10

      Absolutely right!

    • @daniellove162
      @daniellove162 6 месяцев назад +12

      Sometimes people will cry “TRUST IN SCIENCE” in lieu of saying “DON’T QUESTION OUR NARRATIVE”. Scientists throughout history have questioned currently held science to refine science.
      Also, for years people thought Newtonian physics was the final destination and the some dared to do science and discovered it was merely the surface.

    • @juimymary9951
      @juimymary9951 6 месяцев назад

      I think it's mostly that they ignore that all branches of science are interconnected to some extent
      To them the shape of the planet and the function of an electronic device aren't related and therefore to them there is not even the cognitive dissonance.

    • @Bill_Bo
      @Bill_Bo 6 месяцев назад

      What they do is separate science from technology and pretend they have nothing to do with each other in order to avoid the inevitable cognitive dissonance.

    • @drgetwrekt869
      @drgetwrekt869 6 месяцев назад +11

      its because they dont understand how these things work (well like 99.99% of people actually).

  • @MrDominex
    @MrDominex 6 месяцев назад +336

    Flat Earthers don't really care what shape the Earth is, they just want to play a game of one-upmanship by adopting an absurd opinion and then defending it against all reason like a passive-aggressive jackass.

    • @rivershen8199
      @rivershen8199 6 месяцев назад +20

      Flat Earthers are the type of people who won debating competitions in school no matter how ridiculous the position they had to defend.

    • @miloszforman6270
      @miloszforman6270 6 месяцев назад +3

      @MrDominex
      Most probably you're right, but what on Earth drives Hossenfelder to seriously engage with such hoaxes?

    • @uNiels_Heart
      @uNiels_Heart 6 месяцев назад

      @@miloszforman6270 Because flat earthers have an impact on society, especially if their number is on the rise

    • @TesterAnimal1
      @TesterAnimal1 6 месяцев назад +9

      Some. Not all.
      Many vehemently believe it.

    • @mikeguilmette776
      @mikeguilmette776 6 месяцев назад

      @@miloszforman6270 Right now, many schools are teaching that boys can be girls, so it's not much of a stretch to think that flat earth "science" could end up in the curriculum soon . . .

  • @nikl.astrophoto
    @nikl.astrophoto 6 месяцев назад +58

    As someone into astrophotography, even we get accused of lying for simply posting images of our hobby. I've been called a CIA asset by some guys on TikTok. Flat earth is like a collective paranoid schizophrenia.

    • @johnkean6852
      @johnkean6852 6 месяцев назад

      ASTROPHOTOGRAPHY:
      Connecting to Nasa CGI images of space and convincing yourself they're REAL. Keep taking the pills.

    • @whichgodofthousandsmeansno5306
      @whichgodofthousandsmeansno5306 6 месяцев назад

      I am in the satellite radio technologies industry. According to flat earthers I am in on the vast conspiracy to hide the shape literally 99.9999% of people don't care about, or I am also a sheeple being fooled.

    • @whichgodofthousandsmeansno5306
      @whichgodofthousandsmeansno5306 6 месяцев назад +1

    • @lobban2
      @lobban2 6 месяцев назад +8

      What I want to know is why they believe what they believe. What is the point of lying about the shape of the earth?

    • @mkx9095
      @mkx9095 6 месяцев назад

      ruclips.net/video/qEaHjPF47_E/видео.htmlsi=CkC3Hh1CvfdJm9z1

  • @celiacresswell6909
    @celiacresswell6909 27 дней назад

    Observing a phenomenon like flat earth theory and thinking about what’s really going on shows a properly curious mind. Love it

    • @Glasschin2.0
      @Glasschin2.0 27 дней назад +1

      Flat earth isn’t a theory , they don’t have a working modern.

  • @eighteenin78
    @eighteenin78 6 месяцев назад +26

    Never could I ever get an FEer to explain how the stars rotate in a clockwise direction around the South Celestial Pole.

    • @Globeisahoax
      @Globeisahoax 6 месяцев назад

      Is south celestial pole located at the bottom of the globe?

    • @eighteenin78
      @eighteenin78 6 месяцев назад +2

      @@Globeisahoax No it is not.

    • @seanmchugh2709
      @seanmchugh2709 6 месяцев назад +5

      Depends on what you arbitrarily call 'up'. In any case, your question is a red herring. The opposite rotation, with respect to the observer, cannot occur with a space pizza and star dome, regardless of observer location.

    • @mleise8292
      @mleise8292 6 месяцев назад +3

      @@Globeisahoax How does the sun rise to the South of Perth, Australia in December if it cannot go beyond the tropics?
      Now you may think, "ha ha, as if it was so easy to debunk flat earth", but it is. Grifters like David Weiss or Witsit Gets It and all the others would just withhold such knowledge from you so they can continuously bank on your support.

    • @kevin7410
      @kevin7410 6 месяцев назад +2

      Easy, the stars are just little holes poked through the firmament!!!1!

  • @baarni
    @baarni 6 месяцев назад +232

    The big misconception is that flat earthers are honestly trying to figure out whether the earth is flat or not. They are not and will dismiss any evidence that shows anything that contradicts their beliefs…

    • @yad-thaddag
      @yad-thaddag 6 месяцев назад +33

      Not very different from creationists.

    • @2bfrank657
      @2bfrank657 6 месяцев назад +14

      This. She pointed out the lack of scientific education, but flat earthers can be explained even more simply than that - confirmation bias.

    • @Raphael4722
      @Raphael4722 6 месяцев назад

      Honestly who cares? By the law of large numbers, you are never going get 100% people to accept something. It's not a lack of education, it's a matter of parts of science being counterintuitive and many people have a limit on how much they are willing to oppose their intuition.
      Flat Earth is the most extreme case of this. Evolution deniers exist because it's hard to have intuition for something that takes millions of years. Vaccine deniers exist because of the intuition that injecting an unknown substance into your body is dangerous. Viewers of this channel will ridicule all of these.
      However let's not forget that there is no scientific evidence for free will, while there is plenty evidence for determinism, yet there are most likely people in this comment section who consider themselves "scientifically minded" but cannot go against their intuition when it comes to free will.

    • @Ben-pd2bx
      @Ben-pd2bx 6 месяцев назад +28

      Right. It's not remotely about what's true. This stuff meets a psychological need. Whether it's flat earth, QAnon, creationism, Scientology, or gender ideology, arriving at the facts is not the point. Such belief systems are not information that "out there" that these people have considered, perceived and understood - they are ideologies that they have adopted and *identified with*, and that's a big difference. The truth doesn't confer an identity. Ideology does. These kinds of beliefs give people membership in a core group of believers who know the Ordained Truth, while everyone outside that group is thought a fool, a sinner, a bigot, an infidel, a sheeple, etcetera. It's tribal and evolutionary. The people I know who go for this stuff are always insecure, and often have very deep traumatic wounds from early life. They want to belong. They want to be special. They want to feel empowered. The want to feel they have an enemy to oppose. They want to define themselves in relation to all these things. To present them with evidence that their claims are false is not to dissuade them. It is to further radicalise them. The reason is two fold: 1. All criticism of their ideas is perceived as an attack on their identity and personhood. 2. All criticism of their ideas is evidence their ideas are correct, because the "sheeple" or whoever, are trying to defeat the truth. The reason to confront these people and their ideas is not to dissuade them, unless you're able to actually involve them in long term deprogramming. The reason to confront these ideas is so that others who are yet to be indoctrinated and may be watching may be spared the same fate. Meanwhile, if you really do want to help someone who has fallen prey to these kinds of ideologies, the only thing that will do it isn't to confront them with facts, but to engage them in relationship. Rarely, this will work. Remember, it's all about identification. If they start identifying with people who believe things that are true, they are likely to change their beliefs. People believe what their tribe believes more often than not.

    • @jtjames79
      @jtjames79 6 месяцев назад +7

      Flat Earth debunkers will never admit it's just a big troll.
      Sufficiently advanced incompetence is indistinguishable from malice.
      It's ridiculous how many people will accept incompetence as an excuse just because it makes them feel smarter for themselves.

  • @whichgodofthousandsmeansno5306
    @whichgodofthousandsmeansno5306 6 месяцев назад +126

    There is a VERY wide line between healthy skepticism and reality denial. Flat earthers don't see any line at all.

    • @ronpapi9539
      @ronpapi9539 6 месяцев назад +6

      Only Flat Lines!ha ha

    • @eindbaaz3815
      @eindbaaz3815 6 месяцев назад

      @@ronpapi9539 I wish they flatlined

    • @PartlyXenon
      @PartlyXenon 6 месяцев назад

      They see a 3D line!

    • @alkaholic4848
      @alkaholic4848 6 месяцев назад

      They see the line, but don't believe it's really a line. It's nasa pretending there is a line.

    • @ronpapi9539
      @ronpapi9539 6 месяцев назад

      @@PartlyXenon No Curved line noted as usual.

  • @georgelewis3047
    @georgelewis3047 5 месяцев назад +2

    The problem is not lack of intelligence or knowledge Sabine. It drives scientists and universities mad, but they misunderstand this is a socio-political problem, not an education problem.

  • @sieglindedeutersbotter1251
    @sieglindedeutersbotter1251 6 месяцев назад +68

    I'm sorry, but the flat Earth being hit a meteor, tilting and thus tossing the dinosaurs into space was just hilarious! 🤣

    • @gamingcreatesworlddd2425
      @gamingcreatesworlddd2425 6 месяцев назад +3

      😂😂😂😂😂

    • @whichgodofthousandsmeansno5306
      @whichgodofthousandsmeansno5306 6 месяцев назад +2

      I thought flat earthers don't believe in space even though that's all we see for pretty much infinity.

    • @lettersquash
      @lettersquash 6 месяцев назад +3

      That's why they evolved into birds.

    • @StormsparkPegasus
      @StormsparkPegasus 6 месяцев назад +1

      That was actually from a parody video making fun of flat earthers. But yeah.

    • @Fondushkie
      @Fondushkie 23 дня назад

      It is now renamed the "flat trampoline" theory.

  • @juliavixen176
    @juliavixen176 6 месяцев назад +48

    You can't reason someone out of a belief that they weren't reasoned into. If their beliefs are not based on evidence, then evidence isn't going to change their beliefs. There is an emotional/psychological need that these beliefs fulfill. It's something inside of the person, not in the external world. You need to address the psychological needs to change a person's beliefs or behavior.
    (This is how it works in general, not just for conspiracy theorists.)

    • @higztv1166
      @higztv1166 6 месяцев назад +2

      exactly

    • @johnjeffreys6440
      @johnjeffreys6440 6 месяцев назад

      Ask a flat-earther to call the earth a disc instead of flat. Most won't because the earth is flat from the surface, but not from space.

    • @heteroerectus
      @heteroerectus 6 месяцев назад

      Yes you can, this is one of those cute little sayings that people just accept, like, fight fire with fire. You absolutely should not attempt to fight fire with more fire, it will definitely get worse. And similarly, it’s much easier to convince someone that a completely unreasonable idea that they never thought through is unreasonable than one where someone actually spent time reasoning, but got it wrong somehow. A wrong idea born of flawed reasoning or bad data is by far much harder to reason out of.

    • @mikewood8695
      @mikewood8695 6 месяцев назад

      and that's religion for you - and let's face it, apart from the folk at the top of religious organizations that know full well it's a scam to have power of people - and accumulate vast amounts of wealth, everyone else is believing a whole load of stuff with zero evidence - by all means have an open mind about possibilities, but to attend church or some other building with others and do what a bloke - and it is usually a bloke, tells you what to do - just another human with often very few qualifications or sign of real intelligence - is quite remarkable, but it usually involved your time and money and being subservient. All the while the hypocrisy of those at the top of those religious institutions IS just laughable - hoarding vast amounts of wealth, whilst telling us the meek will inherit the Earth - wakey wakey folk!!!

    • @WojciechowskaAnna
      @WojciechowskaAnna 6 месяцев назад +2

      Galileo was prosecuted for heliocentrism, nothing changed much since those times - majority of people, regardless of education, would build their world-view on belief, not on evidence or critical thinking. Simply because actual thinking and providing proofs to oneself requires quite an effort and curiosity. Many scientist are also rather followers than sceptics.

  • @scollyb
    @scollyb 6 месяцев назад +46

    The thing that really amazes me is that the rise in cheap drones hasn't killed flat earth. You literally have a machine where you can move the horizon back and forth at will

    • @osmosisjones4912
      @osmosisjones4912 6 месяцев назад +2

      You can test curvature of the ground why towers get shorter before They get smaller Tower . Traffic lights behind other traffic lights are visible

    • @M_SC
      @M_SC 6 месяцев назад +13

      You don’t understand psychology, which I don’t mean as an insult. It’s not about physical facts. It’s about emotions

    • @Llortnerof
      @Llortnerof 6 месяцев назад +7

      These people will literally refuse to accept reality if it doesn't fit their preconceived notions.
      Not that reality gives a damn either way.

    • @thorwaldjohanson2526
      @thorwaldjohanson2526 6 месяцев назад +2

      It's usually people who believe in other conspiracies, have distrust of the government and anything they don't understand. Being part of a group and having an external reason why things are bad can be comforting to people.

    • @matthewedwards9423
      @matthewedwards9423 6 месяцев назад +6

      Drones are in on it.

  • @flightsimdev9021
    @flightsimdev9021 5 месяцев назад +9

    You know, being in a country that doesn't exist is very hard on me, I live in space according to Flat Earthers, So, does this make Australians the first people to live in space?

    • @ronpapi9539
      @ronpapi9539 5 месяцев назад

      Wrong again.FE' ers know that space is non- existant.

  • @BoBoZoBo
    @BoBoZoBo 6 месяцев назад +74

    I have a private pilot and space enthusiast and my father-in-law in Iowa talk about aviation and space all the time for the first 10 years of our relationship.
    One day he got a new smartphone and I introduced him to RUclips. Told him I had really good videos on space flight and aviation.
    6 months later he became a complete flat earther. True fucking story.
    One day I had asked him if he had seen the SpaceX launch and then he told me it was bulshit it took me a good full hour to realize that he wasn't joking around with me and that he had seriously changed his mind about everything.
    Thank you internet.

    • @raypeery6317
      @raypeery6317 6 месяцев назад

      Cool story bro. Variation 11,075 on the same story.
      Globetards have no imagination, just parrots and sheep.

    • @ronpapi9539
      @ronpapi9539 6 месяцев назад +3

      All retired Pilots come forward with FE Truth, so as not to lose their retirement benefits by exposing the Lie of a Globe

    • @parody_bear_mike
      @parody_bear_mike 6 месяцев назад +3

      Bruce McCandless made history performing a spacewalk during STS-41B with no lifelines Bruce's rotation 1,000 mph
      Bruce's orbit around the sun 66,600 mph
      Sun's orbit around the galaxy 514,000 mph
      Galaxy traveing thru space 3,600,000 mph
      not felling any of it Priceless? or MindLess!!

    • @grahvis
      @grahvis 6 месяцев назад +22

      @@parody_bear_mike .
      The human body has no mechanism for detecting constant, steady movement, only a change in speed or direction over a certain amount.

    • @distortionhead37
      @distortionhead37 6 месяцев назад

      Much ouff!

  • @Deltarious
    @Deltarious 6 месяцев назад +26

    When you made that initial video Sabine I already had the understanding that you are now coming to, and it's been a real brewing problem for *much* longer than I have understood it to be one too.What you really missed the first time around was how the actual belief system and structure works. For *most* of them, the ones who really believe, it's not a simple issue of just doubting science, it's a fundamental philosophical shift away from believing in truth and reason, from scientific concepts. This is why you see flat earthers nearly universally become wider conspiracy theorists too as it is basically an entirely different worldview. There have been some great videos about it that I am not doing justice to, but what fundamentally tends to underpin their beliefs is that there is some special plan for them in particular and that they are the 'in' group, and that necessarily there is an 'out' group that is the majority and who are controlled by others plotting against them. For most of them, especially in the US, it is directly tied to religion too, and the system of beliefs itself *is* a religion, independent of anything else.
    It's frankly very scary and is hard to do anything about. This is the very same set of fundamental beliefs and mentalities that 'power' the other conspiracy stuff such as "q anon" and anti-vax disinformation, it's just that flat earth is one of the most extreme examples where to beleive it you really have to have fully 'bought in' already

    • @creedsixteen891
      @creedsixteen891 6 месяцев назад +4

      Wow.

    • @alchobum
      @alchobum 6 месяцев назад

      A fertile group is those that believe all things come from 'Odd. Only the 'Odd one has real knowledge because all knowledge comes from the 'Odd one. All else is necessarily false. An odd conundrum and oddly circular.

    • @unbreakablefootage
      @unbreakablefootage 6 месяцев назад

      anti-vax is not a conspiracy. this was now shown in germany with corona vaccines

    • @GlazeonthewickeR
      @GlazeonthewickeR 6 месяцев назад +4

      This comment should be pinned.

    • @ETM2024
      @ETM2024 6 месяцев назад

      It's a cult but some people don't want to admit that. Aside from meeting many recognised criteria you can actually see direct parallels in their anti authoritarian dogma with the likes of Jim Jones and Manson, especially the former with his sermons filled with a blend of religious fanaticism and anti government rhetoric.

  • @milodemoray
    @milodemoray 6 месяцев назад +17

    I was born on the coast of South Africa. I watched ships of all sizes come and go from Cape Town and witnessed first hand what my school's teachers were saying about the earth being round.
    When I was 16 I went on my first airline flight with a window seat, and we were high enough up at 10 kilometres to see the curvature, which just confirmed what my teachers had been saying all along.
    Furthermore, I didn't even have to have all those experiences to show me this as I was fortunate enough to also learn that there had been so called experiments to prove that the earth was indeed flat but none of those theories stood up to any real scrutiny.
    Besides, world governments can't agree on the smallest fact or details so how would a conspiracy the size of this one even get off the ground?

    • @gowdsake7103
      @gowdsake7103 6 месяцев назад +1

      NOPE at 10 Km up no way can you see the curve you need to be at 60

    • @UnsoberIdiot
      @UnsoberIdiot 6 месяцев назад

      "Besides, world governments can't agree on the smallest fact or details"
      lol
      LMAO even.

    • @enadegheeghaghe6369
      @enadegheeghaghe6369 6 месяцев назад +2

      Obviously your eyes, the ocean, the ships and your airplane window seat were all part of the conspiracy. LOL

    • @FriedEgg101
      @FriedEgg101 6 месяцев назад +1

      @@gowdsake7103 I've flown at 38000ft (11.5km) and thought I could just about make out the curvature if I pushed my nose to the window and looked from left to right. You'd probably tell me it was distortion from the plane window, to which I would say; maybe. But I've flown a lot at 32000ft (9.7km), and the same effect is harder to make out at that height.

  • @vikramanand2052
    @vikramanand2052 5 месяцев назад +9

    I saw the total solar eclipse on April 8, 2024. I challenge Flat Earthers to come up with a
    model that does all of the following:
    -Explains why solar eclipses occur
    -Explains why eclipses don't happen at every new moon
    -Explains why we can also get annular solar eclipses where the Moon doesn't fully cover the sun and leaves a "ring of fire" around the edges
    If you can't come up with a self-consistent flat earth model that explains all of the above (which I know you can't), then that means that all the Flat Earthers are wrong.
    However, the globe earth explains all of these perfectly:
    - The Moon orbits the Earth and the Earth orbits the Sun. The Moon's orbit occasionally takes it directly between the Earth and the Sun, briefly casting a shadow on a portion of Earth's surface.
    -Solar eclipses do not happen at every new moon because the Moon's orbit is tilted about 5 degrees relative to the plane of Earth's orbit around the Sun. This means that the Moon often does not pass directly between the Earth and the Sun at the new moon; solar eclipses only happen when a new moon occurs near one of the points where the Moon's orbit intersects the plane of Earth's orbit.
    -The Moon's orbit isn't quite a perfect circle; therefore the Moon's distance from Earth is not constant. When the Moon is near perigee (the point when it is closest to Earth), its angular size in the sky is larger than when it is at apogee (when it is farthest from Earth). When the Moon is near perigee, its angular size as seen from Earth is slightly larger than that of the Sun; we can therefore get a total eclipse. However, if an eclipse occurs near apogee, the Moon's angular size isn't quite large enough to cover the entire Sun, and the best that we can get is an annular solar eclipse, where the Moon appears directly in front of the Sun but leaves a ring visible around the edges.

    • @ThomasKundera
      @ThomasKundera 5 месяцев назад +7

      Flerfs can't even explain a sunset, so an eclipse... Well, LOL.
      Basically they can't explain anything as nothing works on FE.

    • @hadesunderworld4203
      @hadesunderworld4203 4 месяца назад +2

      Oh that was a beautiful site , I was in the 💯 eclipse area . South eastern Ontario . Got to watch it in my backyard , craziest thing I’ve seen …
      And they can’t answer any of your statements lol
      Wish they had a factory reset button or something … save them from themselves

    • @wendigo53
      @wendigo53 4 месяца назад +2

      I'm holding on to my eclipse glasses, as we're having a lunar eclipse in September, and I don't want to be damaged by lunar rays.

    • @ronpapi9539
      @ronpapi9539 4 месяца назад

      @@vikramanand2052 Wrong , t h e Sun and Moon are very small and the same size.They are located some 3000 miles above Earth in the Upper atmosphere.

    • @ronpapi9539
      @ronpapi9539 4 месяца назад

      @@ThomasKundera The Sun never sets on our beautiful Flat Realm.The Sun just travels beyond the Human vision.Bang!

  • @eunomiac
    @eunomiac 6 месяцев назад +151

    The scariest part of this video is the graph showing how much of an impact RUclips's "algorithm" has on how our civilization thinks.

    • @getsideways7257
      @getsideways7257 6 месяцев назад +16

      And if that wasn't scary enough, you need to also remember that the favor is shifting towards TikTok these days...

    • @ASlickNamedPimpback
      @ASlickNamedPimpback 6 месяцев назад +1

      its just google graphs

    • @volkerengels5298
      @volkerengels5298 6 месяцев назад +2

      The algorithm is aligned with: "'needs' of modern society" It doesn't cause those 'needs'

    • @mementomori29231
      @mementomori29231 6 месяцев назад +1

      The movie Idiocracy is becoming real

    • @zyeborm
      @zyeborm 6 месяцев назад

      ​@@volkerengels5298nah it's aligned with making Google more money, they changed it because they realised they can make more money in the long term if they allow a long term to exist and don't bring about a new dark age.

  • @UnMoored_
    @UnMoored_ 6 месяцев назад +66

    These people are not essentially crazy, but they were left behind during the critical mental development during childhood which left their ability to reason and conceptionally represent reality with sufficient fidelity as to participate constructively within society. This creates a profound sense of incompetency and compromised social identity which motivates them to join groups which are susceptible to harmful conspiracy theories.

    • @duanecarroll8255
      @duanecarroll8255 6 месяцев назад +4

      Otherwise known as HOME SCHOOLED!

    • @Nefville
      @Nefville 6 месяцев назад +1

      While I assume I would agree with the intent of what you are attempting to say, I'll take ranch on my word salad.

    • @juimymary9951
      @juimymary9951 6 месяцев назад +3

      @@duanecarroll8255 Well...considering what the public school system is like in places such as the US...

    • @eh1702
      @eh1702 6 месяцев назад

      There is some research to show that people who believe a lot of conspiracy theories are more fearful than general. And also not generally of high educational attainment. The feeling of being bewildered by a fast changing world, by social and technological change, being clobbered by scary phenomena that seem to come out of nowhere (like economic recession) - all of this resolves once you are “in” on the secret of the lizard people or whatever.
      It is a more inchoate, ad hoc way of dealing with Big-Scary-Hard-To-Get-A-Grip Reality than the more conscious religious injunction to accept the will of God whether or not you understand it. It has the comforting advantage of feeling like you do understand it. Plus it gives you the fantastic feeling of at last being smart- smarter than the smart kids you went to high-school with.

    • @jflaplaylistchannelunoffic3951
      @jflaplaylistchannelunoffic3951 6 месяцев назад +6

      @@duanecarroll8255 I would argue that home schoolers are less prone to become flat earthers, since during home schooling one has far more opportunity to think things through.

  • @taWay21
    @taWay21 6 месяцев назад +26

    The scariest thing is there seems to be a growing reality gulf between folks with common sense and critical thinking skills, and folks who just consume everything they see on their phone screen.

    • @YellowKing1986
      @YellowKing1986 6 месяцев назад +4

      The population of flat earthers is utterly insignificant. It's like a certain group of people who think they are not who they've been born as. Its a tiny fraction of people and yet we are expected to accomodate it and have the one correct opinion on it. Personally I don't think they matter that much. Let people be wrong. The only reason you know they exist is because it's a click inducing topic. So dumb you just cant help but be fascinated by it. In reality its just a drop in a bucket.

    • @declandougan7243
      @declandougan7243 6 месяцев назад +3

      @@YellowKing1986We are not expected to accomodate flat earthers. They are flat out wrong. We should be expected to accommodate transgender individuals, because that’s not about belief it’s about survival and wellbeing.

    • @GusOfTheDorks
      @GusOfTheDorks 6 месяцев назад +4

      You know, maybe saying this would mean something if we didnt just spend multiple years of scientists and the public regurgitating whatever their phones and TV screens said about covid.

    • @YellowKing1986
      @YellowKing1986 6 месяцев назад +2

      @@declandougan7243 But we are expected to accomodate other cultist believers, like transhumanist ideas. It's interesting about why is that the case with some, and not with others. Why is it that so many people who aren't part of their weird niche community are thinking about, talking about and making videos and consuming videos about it? It's a curiosity. It's weird adn bizzare thing you notice because it stands out. It doesn't tell you anything interesting about people as whole. Other than that some people are just into some weirdness. And it has no impact on your life, if you don't let it happen.

    • @YellowKing1986
      @YellowKing1986 6 месяцев назад +2

      @@GusOfTheDorks Exactly, the term "conspiracy theory" or "misinformation" lacks any substance. It's not saying anything about the quality or validity of information.

  • @adamrussell658
    @adamrussell658 2 месяца назад +4

    When its sunset in England and the sun is half under the horizon, its noon in California and the sun is straight up overhead. There is no flat earth theory that can explain that.

  • @Funbot15th
    @Funbot15th 6 месяцев назад +17

    I like Dan Olson's explanation. Flat earth is not about finding the truth. Rather, it is about finding some comfortable explanation for chaotic nature of reality and having some power in it.

    • @mithrae4525
      @mithrae4525 6 месяцев назад +1

      As with all conspiracy theories the feeling of being special, "in the know" is one of if not the main attractions; especially so for flat-earthers where other common components (eg. eliminating cognitive dissonance as with climate science deniers/Biblicist young-earthers, or narrative framing as with contrails/FEMA death camps/anti-vaxxers) don't really seem to apply.

    • @citoante
      @citoante 6 месяцев назад

      @@mithrae4525 And, so what? Who cares? All I see is a superiority complex over something stupid.

    • @scotttaylor9133
      @scotttaylor9133 6 месяцев назад

      @@mithrae4525 Well, I'm certainly glad you know that you're not one that needs to feel you're in the know when others aren't.

    • @scotttaylor9133
      @scotttaylor9133 6 месяцев назад +1

      I think this is a VERY universal and human thing you're talking about here, and I think it will continue to rear its head in all sorts of ways, areas, people and ideologies as we become increasingly specialized with our ever increasing body of human knowledge. It's not about smart or dumb, or even being right or wrong. It's about how we cope with a world far, far too large and a body of knowledge way too broad and deep for anyone to even really conceptualize. Standing and looking at that, it's very difficult to understand how we fit in or how to even approach or deal with it in my opinion. We've all just found different coping mechanisms, some more sanctioned and normalized than others.

  • @Debg91
    @Debg91 6 месяцев назад +13

    Yes, flat-earthers can be dangerous, but they have good things too. For example, watching videos debunking the Moon landing hoax has taught me a lot about how cameras work. Now I have more solid arguments agains their crazy theories. Flat Earth has unironocally improved my scientific career.

  • @chrisbullard5901
    @chrisbullard5901 6 месяцев назад +106

    I knew a flat earther who tried to explain how complicated the airline pilots had to fly these circuitous routes to “simulate” the Earth being round.
    But why would airlines spend so much more money if they could instead fly their planes in a straight line?

    • @drgetwrekt869
      @drgetwrekt869 6 месяцев назад

      nevermind the stupidity of science-deniers

    • @tarunyadav3567
      @tarunyadav3567 6 месяцев назад

      ​@@Toxicpoolofreekingmascul-lj4ydto sell more globes xd

    • @RickinICT
      @RickinICT 6 месяцев назад +24

      @@Toxicpoolofreekingmascul-lj4yd They'll probably just tell you it's so they can spread the chemtrails further! 😂😂

    • @jaimeduncan6167
      @jaimeduncan6167 6 месяцев назад

      For the same reason they pay a woman that just have a baby even when she is not working: the government forces them (great in the case of the woman). That is why Dr. Hossenfelder's type of argument: see this works, is more powerful.

    • @steve112285
      @steve112285 6 месяцев назад

      Jet fuel costing money is another lie of the global conspiracy. They really use special Tesla tech that's been suppressed for a century, providing free unlimited power. Or something.

  • @adigaw587
    @adigaw587 3 месяца назад +3

    The only thing flat earthers prove is that common sense isn't that common

  • @kevinmcdowell9074
    @kevinmcdowell9074 5 месяцев назад +35

    That graphic of the sun and moon bouncing in and out of the ocean is amazing and the dinosaurs flipping... Im convinced, this flat earth thing sound like fun.

  • @doraemon402
    @doraemon402 6 месяцев назад +57

    The thing that sets flat earthers apart is the fact anyone can prove them wrong, unlike with many other topics that require far more complex experiments.

    • @drgetwrekt869
      @drgetwrekt869 6 месяцев назад +1

      so true. instead, there are some fields where proving some bs wrong is basically impossible or very hard (for many reasons), including one of Sabines lovers: fusion.

    • @catman8770
      @catman8770 6 месяцев назад +1

      At this point I am starting to be convinced flat earthers exist solely as a psyop to make anyone who questions anything look absolutely stupid and insane.

    • @MarcPagan
      @MarcPagan 6 месяцев назад

      Exactly like Dem Party voters
      ...Flat Earthers are fact immune.

    • @KendraAndTheLaw
      @KendraAndTheLaw 6 месяцев назад +3

      Ask them how eclipses work. The answers are most hilarious.

    • @六工業のカービィ
      @六工業のカービィ 6 месяцев назад +1

      Actually, you can't use facts against them or probably even the arguments. Only one will remain eligible at the end: the problem of which model is more absurd.
      I've argued with the russian community back in 2018 end to beginning of 2019. They just come up with some magic always. They'll bring out any magical, absurd hypothesis that can contradict their other assumptions only for the earth to remain flat.

  • @brothergrimm9656
    @brothergrimm9656 6 месяцев назад +74

    The information age has revealed one thing, nothing travels faster than light except ignorance and conspiracy theories on the internet.

    • @tvviewer4500
      @tvviewer4500 6 месяцев назад +3

      How many covid boosters do you have in your arm, slick?

    • @yeroca
      @yeroca 6 месяцев назад +1

      obviously wrong, but also correct for comedic purposes

    • @Rhomes7
      @Rhomes7 6 месяцев назад +1

      Truth. Even the universal speed limit bends the knee for Dunning-Krueger.

    • @Raphael4722
      @Raphael4722 6 месяцев назад

      I'm tired of people complaining about the internet. There were probably even more uneducated people with ridiculous beliefs BEFORE the internet. You just didn't know about it because they would only talk to their friends and family about it.

    • @tvviewer4500
      @tvviewer4500 6 месяцев назад +2

      @@Rhomes7 how many Covid boosters do you have in your arm, smart guy?

  • @Neverforget71324
    @Neverforget71324 4 месяца назад +3

    How do we know the earth is not flat?
    Because over the 10 million+ years that cats have been around, they would have already knocked everything off the edge...

    • @ronpapi9539
      @ronpapi9539 4 месяца назад

      @@Neverforget71324 Low IQ post.

    • @MarkBachelder-ie7hi
      @MarkBachelder-ie7hi 3 месяца назад

      You have fully debunked this conversation finally - thank you.

  • @diedertspijkerboer
    @diedertspijkerboer 6 месяцев назад +51

    I've personally met a flat earther and someone else who thought that making math-inspired drawings was the same as doing maths.
    The problem in both cases was that they believed that they could figure this stuff out on their own.
    The flat earther read stuff online and was simply unable to detect bad physics because he didn't know physics.
    In the process, he was ruining his life by forcing his views on others.
    I think that the reason why people become flat earthers is that, in their own mind, they've become scientists, while previously, they held or failed at jobs with much less social status.

    • @ronpapi9539
      @ronpapi9539 5 месяцев назад

      No they're debunking scientists who are unable to decipher FE Truth and will do anything to protect their social standing with falsehoods .

    • @charlesmiller8107
      @charlesmiller8107 5 месяцев назад +4

      My favorite comment is "do your own research". lol It's always a red flag and the crux of their problem.

    • @ronpapi9539
      @ronpapi9539 5 месяцев назад

      @@charlesmiller8107 Don't they know that Globeheads do not research or take orders.

    • @ronpapi9539
      @ronpapi9539 5 месяцев назад

      @@charlesmiller8107 So researching things that you know Squat about is a Red Flag?FE Prevails!

    • @ronpapi9539
      @ronpapi9539 5 месяцев назад

      The JWST has just proved Physics wrong.Read all about it Globeheads

  • @rastanz
    @rastanz 6 месяцев назад +28

    A flat earther told me when the tide goes out it's because the ocean's water is being recycled. Somewhere on flat earth there is a giant water recycling plant.

    • @PsychoMuffinSDM
      @PsychoMuffinSDM 6 месяцев назад +1

      Tide goes in.
      Tide goes out.
      You can’t explain that!
      /s

    • @jamesmnguyen
      @jamesmnguyen 6 месяцев назад

      As long as my water is clean, I'm ok.....(sarcasm)

    • @Slartyfartblarst
      @Slartyfartblarst 6 месяцев назад

      The land surface also moves, to a much lesser extent. Water is recycled, by the hydrosphere.

    • @partymantis3421
      @partymantis3421 6 месяцев назад

      lol i have yet to hear that one, these flearth models are a riot,
      the one i hear to explain the sea involves the famed ice wall melting in the summer & reforming in the winter,
      also theres ofcourse an armada guarding it that the UN protect (man i WiSH we could work that well together on something like that)

    • @neuvocastezero1838
      @neuvocastezero1838 6 месяцев назад +1

      At least they seem aware of recycling.

  • @radiobabylon
    @radiobabylon 6 месяцев назад +83

    never underestimate human stupidity. i am constantly thinking ive seen its limit, and am constantly surprised how wrong i was.

    • @Llortnerof
      @Llortnerof 6 месяцев назад +10

      Two things are infinite: The universe and human stupidity. And i'm not sure about the former.
      - supposedly Albert Einstein

    • @normangensler7380
      @normangensler7380 6 месяцев назад +1

      Makes you think that Satan himself roams the entire earth messing things up, doesn't it? Now that makes more sense.

    • @szolanek
      @szolanek 6 месяцев назад

      Agree. They tried hard many times to infect a healthy person with a virus and never succeeded. They never isolated one. Still, we live in the age of viruses.
      Also, we went almost extint of low CO2 levels. We managed to pull it back a bit. Still needed more for healthy plant life, but they don't want undeveloped countries to develop, so they lie about climate change. Only the night temperatures riser in cities, as they developed.
      Also, the US has 800 military bases around the world. Russia has one, therefore they want to take over the planet.
      Also, Israel collected all weapons from the kibuces a month before okt 7 around Gaza, shut down the security systems, responded in 7 hours, instead of 15 minutes with chopters, and killed about 1000 of their own, but they were attacked "by surprise" and from self defense they can exploit the gas-and oilfields offshore Gaza. If you criticize them you are antisemitic, while Israelis are European and Palestinians are semitic indeed.
      Yeah, I have to agree with you.

    • @haqvor
      @haqvor 6 месяцев назад +3

      @@normangensler7380 except that introducing such a being into the equation doesn't pass the test of Occams razor. The existence of supernatural beings is neither a necessary nor required condition to explain the observed phenomena, human shortcomings is more than enough. I would instead argue the opposite, the human tendency for religious believes, and with that an accepted lack of critical thinking, is at the center of all conspiracy theories.
      Humans are not much more than a glorified chimpanzee after all.

    • @combatepistemologist8382
      @combatepistemologist8382 6 месяцев назад +4

      "Think of how stupid the average person is, and realize half of them are stupider than that." - George Carlin

  • @chrisobber5604
    @chrisobber5604 4 месяца назад +2

    The funniest thing for me was always the pour-water-on-a-ball nonsense because even there you clearly see the water sticking to the ball = ball getting wet and staying wet. Our oceans compared to the planet's size are also just that...

    • @ronpapi9539
      @ronpapi9539 3 месяца назад

      @@chrisobber5604 But very soon the ball becomes dry.Poor analogy!

  • @wonderpope
    @wonderpope 6 месяцев назад +211

    My main problem with flat earthers is that they give a bad name to skeptical people in general. The push by authorities to censor social media because of "misinformation"/"desinformation"/"malinformation" is getting stronger. This starts silencing anyone who might have good reasons to counter official narratives, because you are put in the same basket as flat earhters.

    • @decafjava8565
      @decafjava8565 6 месяцев назад +14

      Very true.

    • @alchobum
      @alchobum 6 месяцев назад

      The censorus work hard to create that link. Only a flat earther conspiracy theorist would even dare say higher taxes and not being allowed to drive on weekends are bad.

    • @xintophotography9848
      @xintophotography9848 6 месяцев назад +36

      Conspiracy theories in general have so stretched the concept of skepticism that it no longer means anything. Science should invent some new word to represent healthy and informed skepticism.

    • @1238a8
      @1238a8 6 месяцев назад +3

      @@xintophotography9848 As if worldwide bullexcretes is sanely explainable without conspiracy theories.
      However, conspiracy theories could have different quality.

    • @emildavidsen1404
      @emildavidsen1404 6 месяцев назад

      Im gonna second what another has already commented, flerfs are "just" one of the many conspiracy theories which has flurished over the last couple of decades. We humans have some catching up to do regarding our social and cognative abilities if we are to keep pace with our information tech. Using history as a guide, I'd say there is a decent chance/risk that many wars will need to happen before we take this seriusly enough.

  • @tonykelpie
    @tonykelpie 6 месяцев назад +7

    Conspiracy theories in general are very attractive to many people because they offer simplistic explanations to many things that are difficult to understand, and they particularly avoid the anxiety that many people feel when faced with a world, and a universe, which is really difficult to completely understand

    • @Globeisahoax
      @Globeisahoax 6 месяцев назад

      SYSTEMATIC POISONING BY THE GOVERNMENT TO PREVENT FLAT
      EARTH AWAKENING
      1. CHEMTRAILS/ GEOENGINEERING
      2. VACCINES: HEAVY METALS +
      GRAPHENE
      3.4G + 5G RADIATION
      4. PESTICIDES IN GM FOOD
      truth.to.the.rescue
      5. GRAPHENATED PCR PINS AND MASKS
      6. GRAPHENATED
      PERSONAL CARE PRODUCTS
      1. GRAPHENATED MILK, MEAT, WATER
      8. ELECTRIC CARS WITH SUPER
      EMF
      FIELDS
      9. MARXISM + TOXIC IDENTITY
      CULTURE
      10. ECONOMIC WARFARE
      AGENDA 2030

    • @euphoricbliss6699
      @euphoricbliss6699 6 месяцев назад

      Oh wow I've not heard that old trope before. Man your so original 😂

    • @Coromi1
      @Coromi1 6 месяцев назад

      Most of the time, conspiracy theories are more complex than the official version.
      The official version says that JFK was murdered by a loony. The conspiracy theory says it was the CIA with the involvement of several people and it discusses the motives. Way more complex.
      The official theory says that certain jabs are save and effective. Conspiracy theories discus at least four mechanisms how they increased the rate of cancer and make it grow faster. Way more complex.
      Can you name examples of popular conspiracy theories that are less complex? Flat earth or reptiloid theories are fringe.

  • @MrEW1985
    @MrEW1985 6 месяцев назад +120

    I just had the biggest laugh when the Flat Earth society claimed that it had members all around the globe.

    • @gsmollin2
      @gsmollin2 6 месяцев назад

      Really? Now THAT is irony!

    • @richardalvarez2390
      @richardalvarez2390 6 месяцев назад

      Flat earth Society is controlled opposition. Flat earthers do not take that statement seriously. As being around the world is bogus

    • @richardalvarez2390
      @richardalvarez2390 6 месяцев назад

      Let's not forget, there is a 3 hour testimony of pilots and pilot instructors admitting the earth is flat, on RUclips

    • @wiredforstereo
      @wiredforstereo 6 месяцев назад

      So effing cliche.

    • @technolus5742
      @technolus5742 6 месяцев назад

      ​@@acmhfmggruLmao no, they flat out deny any evidence no matter how direct and accessible no matter if it literally disproves their own proposed experiments.
      There is skepticism, and denialism. They fall on the blatant denialism side.

  • @Rogerkknull
    @Rogerkknull 13 дней назад +1

    Ask any flat earther to explain how meteorites get through their dome.

    • @therealzilch
      @therealzilch 12 дней назад

      I've done so numerous times. The single answer I got was that meteorites are chunks of the firmament that got loose somehow. I'm still not sure if this was serious. But that's a very general problem with the flat Earth, isn't it?

    • @Rogerkknull
      @Rogerkknull 12 дней назад

      @therealzilch Well, it's one gosh darn big dome!

    • @therealzilch
      @therealzilch 12 дней назад

      @@Rogerkknull Can't argue with that.

  • @haynerbass
    @haynerbass 6 месяцев назад +224

    IF the planet was flat cats would have knocked everything off the edge by now.

    • @SuckPuppet-xv1dv
      @SuckPuppet-xv1dv 6 месяцев назад

      One of my favorite 'conspiracy theories" is that cats are aliens in disguise sent to monitor humanity. Don't worry, tho', they are mostly benevolent.

    • @neko_neko9
      @neko_neko9 6 месяцев назад +9

      This should have more likes

    • @Buckdawg
      @Buckdawg 6 месяцев назад +14

      Was funny the first time i heard it. Ten years ago...

    • @scottfw7169
      @scottfw7169 6 месяцев назад +2

      @@Buckdawg And still is, as the cat here on my computer desk has just knocked my pen off and is now working on the placemat in front of this keyboard ...

    • @davidgray5570
      @davidgray5570 6 месяцев назад +4

      You are misinformed...the cats are in on the conspiracy!

  • @groaningmole4338
    @groaningmole4338 6 месяцев назад +45

    They dismiss anything that they can't understand in 10 seconds as being a lie.
    Nothing can be done about this.

    • @johnjeffreys6440
      @johnjeffreys6440 6 месяцев назад +1

      I was often the first person to make a comment on Eric Dubay's channel, but he or any other viewer ever replied to my comment, which leads me to believe that most of them didn't believe it either.
      I would say, if the earth is a disc, then all the bodies of water would be still like a pond, but the oceans are always churning because water can't settle ion a spherical surface.

    • @marksea64
      @marksea64 6 месяцев назад

      @@johnjeffreys6440 Spherical has nothing to do with it. Water could perfectly well settle on a spherical surface if the sun weren't mixing up the oceans and the atmosphere.

    • @johnjeffreys6440
      @johnjeffreys6440 6 месяцев назад

      @@marksea64 the moon has more to do with the tides and the waves of the ocean than the sun.

    • @marksea64
      @marksea64 6 месяцев назад

      @@johnjeffreys6440 I wasn't referring to the tides, but yes, the moon has a stronger effect on tides. The point stands.

    • @getsideways7257
      @getsideways7257 6 месяцев назад

      10 seconds have nothing to do with that, it's basically religious at this point.

  • @bradmiller6507
    @bradmiller6507 6 месяцев назад +10

    I’ve lived in a couple of rural areas in the US. My appreciation for the curvature of the earth 🌍 grew when I learned about something called correction line roads.

    • @jimsmith7212
      @jimsmith7212 6 месяцев назад +1

      There are collections of aerial or satellite photos of correction lines.
      They are common in the U.S. and Canada.

  • @macbrush
    @macbrush 9 дней назад +1

    To many flat earthers, this is now a crusade, nothing more.

  • @armorvil
    @armorvil 6 месяцев назад +51

    I lost it at 0:45 : did that guy really try to prove the earth is flat by spilling water on that ball? What a genius 😂😂🤣🤣

    • @alienrenders
      @alienrenders 6 месяцев назад +2

      That's actually THE primary misunderstanding by ALL flat earthers. They believe that a river that flows North is proof the Earth isn't round. I'm not making that up. They just don't understand gravity. So I think flat earthers aren't all people that don't understand science, but perhaps have limited spatial visualization skills. So they have no choice but to believe in flat earth.
      And you laugh at this example, but there's another example that's just as bad. Trying to explain curvature of space around a gravitational body by using a sheet and a bowling ball on it. What's causing the bowling ball to deform the sheet? The gravity of Earth. It's stupid as all hell and it's exactly the same thing that flat earthers are doing, except it's being done by physics teachers. There's plenty of these videos on youtube by "educated" people.

    • @JohnSmith-ux3tt
      @JohnSmith-ux3tt 6 месяцев назад

      It isnt just him. Many flat earthers have done the same over the last 10 years.
      They have no clue.

    • @ianmccurdy1223
      @ianmccurdy1223 6 месяцев назад +1

      @@alienrenders I don't understand your issue with the bowling ball demonstration. It's just a 2D visualization of a 3D effect, I don't think anyone is suggesting that the effect on the sheet by the bowling ball is literally the same as the warping of spacetime by the Earth

    • @littlefishbigmountain
      @littlefishbigmountain 6 месяцев назад +1

      @@alienrenders
      With the sheet visualization tho isn’t the idea that, although yes the mass of the earth obviously causes a nice convenient gravity well for us to live in, that by spreading the sheet out for our model we are simulating a slice of unwarped spacetime. Then by placing a bowling ball into the center, the model takes advantage of the gravity well the taut sheet is in to place a massive object in the center to create curvature to show how the path of least resistance can be a different kind of straight line than we might imagine.
      It seems like you’re suggesting the sheet demonstration somehow begs the question by using gravity to demonstrate gravity, but I don’t really see how. It just seems like it cleverly takes advantage of local gravity to apply similar warping to the fabric of the sheet. In a zero g environment, couldn’t we hypothetically replicate this experiment with some force that simulates gravity instead of gravity itself and the result would be fundamentally similar? For example, if we were on a ship accelerating upwards relative to the conduction of the experiment at about 9.8m/s^2 give or take, no gravity needed and fundamentally similar results. Theoretically anyway, obviously I haven’t a spaceship to test it.
      That being said, because the gravity well we’re living in is effectively not represented in the model at all (since the sheet is flat, it represents a slice of spacetime with no massive bodies in it) and curvature is only introduced upon a body of mass entering the system. Since the sheet already cancels the curvature of earth’s gravity on the model, utilizing the earth’s gravity well to reintroduce massive bodies is actually really clever because it uses gravity to simulate gravity in a non-circular way, which makes it actually an amazing representation since it literally is the thing it’s trying to help you to visualize.
      Interestingly, in this model setup there is even a preference for direction of orbit, just like we observe in space. Although here I must admit I cannot say for sure that it also related, for all I know it’s caused by the Coriolis Effect and it’s just a coincidence for example. It does make it an even more useful demonstration model and teaching tool, though

    • @C_Becker
      @C_Becker 6 месяцев назад

      @@ianmccurdy1223 What? So the ball is 2D?

  • @Thetimrobertson
    @Thetimrobertson 6 месяцев назад +6

    There’s a massive motivator left out of this in my opinion. I feel like (based on many many interactions with them) a huge reason Flerfers believe what they do is fuelled by a desire to be special. Not interesting or educated? How about figuring out a global conspiracy few have been able to crack? Career not going well and still unmarried? What if you unlock the secrets of the universe? Now all your peers (other flerfers) will think you’re amazing and wow, look how interesting you are. All of this fuelled by social media and its algorithms.

  • @lavieestlenfer
    @lavieestlenfer 6 месяцев назад +77

    Someone has to populate the left tail of the bell curve.

    • @anotherfreediver3639
      @anotherfreediver3639 6 месяцев назад +9

      The problem I suspect is that many would come out as quite intelligent on a Stanford-Binet IQ test. There's something else going on here; people with an IQ of less than say 70 just wouldn't be able to work out what the flat earth debate was about, because it would be too abstract for them.

    • @hanfrånnorr1986
      @hanfrånnorr1986 6 месяцев назад

      ​@@anotherfreediver3639 No butt remember those betwen 70 and 80! Nott officialy handicaped but to stupid for the modern jobb market. I bett your typical flatt earther lies att 75 points.

    • @Vaeldarg
      @Vaeldarg 6 месяцев назад

      @@anotherfreediver3639 The "something else" is exemplified in when at a failed Qanon event, as people started to leave someone shouted "don't leave! remember when we were alone!" These people just want there to be others (that either already do, or have been tricked by them) to be in the same boat of willful ignorance as them. Reality, much less science, moved beyond their understanding, and they gave up even trying to understand it. They just don't want to be the only one believing in the lies they've made up for themselves to explain how reality should actually be something it isn't.

    • @Alex-js5lg
      @Alex-js5lg 6 месяцев назад

      ​@anotherfreediver3639 narcissism.

    • @jschudel777
      @jschudel777 6 месяцев назад

      😂

  • @dugwtf
    @dugwtf 4 месяца назад +1

    A huge problem is narcissism. People who believe in conspiracy theories tend to be narcissists.

  • @Dooguk
    @Dooguk 6 месяцев назад +22

    The web has given the hard of thinking a voice.

    • @JZsBFF
      @JZsBFF 6 месяцев назад +4

      That voice was around well before the internet, but it surely made that voice louder.

    • @Dooguk
      @Dooguk 6 месяцев назад +1

      @@JZsBFF Maybe from the End of the World people or the Alien/UFO clowns, but not very much before the www became a thing.

    • @JZsBFF
      @JZsBFF 6 месяцев назад +1

      @@Dooguk Flerf is actually a very old concept that got gradually suppressed by testable science, but it got never eradicated.

    • @Dooguk
      @Dooguk 6 месяцев назад +1

      @@JZsBFF Yes. Obviously centuries or millenia ago it might have been difficult for people to understand., but these fools have to dismiss so many different inventions and discoveries it makes no sense at all.

    • @JZsBFF
      @JZsBFF 6 месяцев назад +1

      @@Dooguk Sounds like any nowaday religion to me.

  • @angryoldcanadian3905
    @angryoldcanadian3905 6 месяцев назад +107

    I work with a flat earther and there is no amount of evidence he will accept. My theory is that these people think that they are 'special' because only they and a few others know 'the truth'. This is important because most of them have done nothing special in their lives and this makes them feel good about themselves.

    • @pnichols6500
      @pnichols6500 6 месяцев назад +1

      Just like the protesters right now, grasping at relevance.

    • @ddd7254
      @ddd7254 5 месяцев назад +2

      @@pnichols6500 They're protesting, that's doing something relevant. The Pro-Palestine protesters for example are all over the news and internet gaining more and more sympathy and attention for their cause.

    • @pnichols6500
      @pnichols6500 5 месяцев назад

      @@ddd7254 Yes because supporting a group that would murder them is so brilliant 🙄.

    • @Mike-zs2rc
      @Mike-zs2rc 5 месяцев назад +1

      Do they site Terry Practhets Discworld books as documentaries?

    • @pnichols6500
      @pnichols6500 5 месяцев назад

      @@ddd7254 Protesting for people that won't allow women to work or leave the house without permission, let alone speak their minds just shows you how clueless these protesters are.

  • @edemilsonlima
    @edemilsonlima 5 месяцев назад +19

    I try my best to teach them scientific truth. Some are polite and try to understand what they lack knowledge. But some are a complete waste of time.

    • @tomsanders5584
      @tomsanders5584 5 месяцев назад +2

      I'm with you bro. I was teaching some kids about the man that drives a fiery chariot across the sky every day and some just weren't buying it. Like you said, a complete waste of my freakin' time...😐

    • @destructionman1
      @destructionman1 5 месяцев назад

      But would you try to teach a schizophrenic person the clown isn't actually in their bedroom? Point is, any "debate" with a flat earther will not be productive, and only serve to further alienate them and stigmatize their condition.

  • @howzittoyah
    @howzittoyah 21 день назад +1

    1:50 Considering that you can deduce when people take a dump by tracking their phone's position, it's reasonable to assume you can tell who's going to town with who.
    So that omniscient being is just your average tech company.

  • @Rai_Te
    @Rai_Te 6 месяцев назад +11

    Monty Python seems to have come to the same conclusion ... either before, while or after they wrote
    their piece "Royal Society For Putting Things On Top of Other Things"

  • @Dr.M.VincentCurley
    @Dr.M.VincentCurley 6 месяцев назад +161

    Here I was thinking that "Flat Earthers" didn't experience life in 3 dimensions. I was going to sell them some art work that could double as a short term rental.

    • @Alleged_Mercenary
      @Alleged_Mercenary 6 месяцев назад +1

      I would invest in that business.

    • @grindupBaker
      @grindupBaker 6 месяцев назад +5

      Homer Simpson thought the Universe was a straight line until he fell into the Spooky Theoretical SECOND DIMENSION

    • @danbance5799
      @danbance5799 6 месяцев назад +1

      Edwin Abbott likes this comment. As a 3 dimensional being, I can only perceive the world in 2 dimensions.

    • @moomoodeadcow
      @moomoodeadcow 6 месяцев назад

      Isn't that called NFT?

    • @lemdixon01
      @lemdixon01 6 месяцев назад +1

      The galaxy is flat and the universe might be

  • @juliachristinaheikamp246
    @juliachristinaheikamp246 5 месяцев назад +67

    I had my share of debates with flatearthers, trying to take them seriously.
    I am done with that, counting all the online harassments following every attempt of discussion on eyelevel.
    They become aggressive, act like heavily disturbed psychopaths, troll your accounts, tag you in public posts where they insult you and threaten you, pollute your messenger box with crap video's and silly photoshop memes, until all you can do is report and block them.
    These people have serious issues I am afraid basic education does not fix, only therapy and meds.

    • @Globeisahoax
      @Globeisahoax 5 месяцев назад

      If you support the globe, you support criminal enterprise. You are an enemy.

    • @kitcanyon658
      @kitcanyon658 5 месяцев назад +10

      Yep. They are cowards and liars, all.

    • @C_Becker
      @C_Becker 5 месяцев назад +1

      @@Globeisahoax Just shut up.

    • @nickryan3417
      @nickryan3417 5 месяцев назад

      There are three types of flerf: (a) tragically stupid, (b) terminally gullible and (c) grifters that prey on the former. All flerf fall into one or more of these categories.
      As for how to flerf? It's lie, to themselves and others, twist words, double down on stupid and ignore every fact presented to them.

    • @dominiccharvet546
      @dominiccharvet546 5 месяцев назад

      King James Bible
      The heaven, even the heavens, are the LORD'S: but the earth hath he given to the children of men.

  • @kacpermalina308
    @kacpermalina308 4 месяца назад +1

    Its even worse, there are 3 versions: Riding on giant turtle, disk in space, and dome witch bottom as earth. Lack of consistency.

  • @borysoppenlander4521
    @borysoppenlander4521 6 месяцев назад +27

    One rather important point that wasn't mentioned here is the fact, that a lack of scientific education is not the only reason for people to start believing/ comprehend the world in/ through conspiracy theories. A large number of these people develop a kind of need for recognition as they get older. They want to make themselves heard, to set something in motion in their lives. It often doesn't matter to conspiracy theorists whether they are right or wrong. They often know very well that what they are saying is not true. It's more about finding supporters who give you a feeling of validity, rightness and, above all, importance.

    • @raypeery6317
      @raypeery6317 6 месяцев назад

      " is the fact"
      Followed by a bunch of opinions.
      Tell me you're globetard without telling me you're a globetard.

    • @User-yy6xt
      @User-yy6xt 6 месяцев назад

      So all you can do is insult people not offer and proof

    • @Azuria969
      @Azuria969 6 месяцев назад +1

      So all you can do is insult people not offer a proof evidence, typical flat earther🤣

    • @User-yy6xt
      @User-yy6xt 6 месяцев назад

      @@Azuria969 Wow aint you stupid

    • @getsideways7257
      @getsideways7257 6 месяцев назад

      You know, it's not nice to just put everyone in the same basket. If a person believes in a "Flat Earth", that's one thing, but if they suspect 9/11 was an inside job or that JFK was killed by CIA - that's quite a different story, don't you think?

  • @peterkuchenbrod5696
    @peterkuchenbrod5696 6 месяцев назад +13

    The real problem is that even if you explain in precise, easy to understand terms on how we know that the earth is round, they STILL won't believe it. I've experienced this firsthand and have given up. Quality science education needs to start when they are young.

    • @johndor7793
      @johndor7793 6 месяцев назад

      I dont think it has anything to do with education since its so easily disproved. Imho its most likely different mental disorders.

    • @getsideways7257
      @getsideways7257 6 месяцев назад

      FE is basically an alternative religion. Trying to argue with a religious person is about as futile, although of course religion promises much more than just a pancake Earth.

  • @flyjet787
    @flyjet787 6 месяцев назад +6

    I agree. Scientific illiteracy is a growing problem. I am especially concerned by leaders who make major policy decisions while not understanding even the most basic science.

  • @vivektulja4516
    @vivektulja4516 5 месяцев назад +11

    I am a spacecraft dynamics and control engineer. I spent many decades working on NASA and US DoD programs. I recently came across a suggestion that flat-earthers should be sent to space to see for themselves that the earth is round. Since then, I have promptly converted to flat-eartherism in the hope that I will get a free ticket to space. 😀😀😀

    • @ultrafun2227
      @ultrafun2227 5 месяцев назад

      All flat-earthers just gonna say it's CGI or something. And even if one believes, all others are gonna say people brainwashed the person

  • @yuefenggao7483
    @yuefenggao7483 6 месяцев назад +17

    Just like Isaac Asimov said:'Anti-intellectualism has been a constant thread winding its way through our political and cultural life, nurtured by the false notion that democracy means that 'my ignorance is just as good as your knowledge.''

  • @kabukibear
    @kabukibear 6 месяцев назад +10

    Here's the wild thing, I'm old enough to remember when the flat earth society forums were a SATIRE forum. You didn't break character or you were banned. Whether or not this is the same sites you're referring to, I don't know. But I REMEMBER it was one big JOKE on the internet back when the internet was young. Part of me wonders whether this is one of those things where satire becomes reality when people stop realizing it was a joke.

    • @superstardeejay2468
      @superstardeejay2468 6 месяцев назад

      What really annoys me is that we had the technology to project a perfect form CGI sky all through humanity but we still have RUclips videos at 140fps. As far back as the Mayans, CGI was already developed, it could form a perfect sky where stars and planets would move in perfect sync, but nobody ever told us. I reckon Galileo was about to blow the lid, and that's why he was persecuted.

    • @vaiciciaku
      @vaiciciaku 6 месяцев назад

      Fake it till you make it. They can not believe themselves they did make it.

  • @reneedevry4361
    @reneedevry4361 6 месяцев назад +7

    I honestly believe that most intelligent people badly underestimate how dangerous stupid people are.☹️

  • @ks1u
    @ks1u 4 месяца назад +2

    Apparently, ignoring these people and their ideas has not worked. We should all address these mind-bogglingly stupid ideas whenever we encounter them.