The Plans to Assassinate Hitler

Поделиться
HTML-код
  • Опубликовано: 21 дек 2024

Комментарии • 3,1 тыс.

  • @fern-tv
    @fern-tv  5 месяцев назад +8400

    The timing of this video might seem a bit weird. Naturally, it is entirely coincidental; we worked on this for months. Enjoy!

    • @大
      @大 5 месяцев назад +277

      daddy

    • @JohnCena-rq4bp
      @JohnCena-rq4bp 5 месяцев назад +113

      i'm watching this in the bath 👍

    • @vermillion-sz7vy
      @vermillion-sz7vy 5 месяцев назад +94

      props to your animation team on your other works, I assume this will be great

    • @actuallyalyan
      @actuallyalyan 5 месяцев назад +1

      Its ok, trump is no worse than hi!ler

    • @pyeitme508
      @pyeitme508 5 месяцев назад +29

      Bruh

  • @astral6749
    @astral6749 5 месяцев назад +12112

    Resistance: * fails to kill HItler *
    Hitler: Fine, I'll do it myself.

    • @Krachbumm-Ente
      @Krachbumm-Ente 5 месяцев назад

      Imagine believing post war propaganda

    • @creely123
      @creely123 5 месяцев назад +101

      Argentina actually.

    • @edvardb.2751
      @edvardb.2751 5 месяцев назад +41

      He had the last card.
      The death card.

    • @BGwxlf
      @BGwxlf 5 месяцев назад +73

      ​@@creely123no he didnt escape dna tests were done on his bones if im not mistaken

    • @BGwxlf
      @BGwxlf 5 месяцев назад +11

      Underrated commemt

  • @Emil-y3z
    @Emil-y3z 5 месяцев назад +3000

    Don`t also forget he was saved from drowning by a priest when he was young and a British solder refused to shoot him in ww1. Mann, he was very lucky.

    • @SynthiaVan
      @SynthiaVan 5 месяцев назад +139

      The 2024 version is "he was protected by god."

    • @MaddAddam93
      @MaddAddam93 5 месяцев назад +102

      This just affirms that life is chaos and good does not intrinsically succeed more than evil

    • @martialhero9544
      @martialhero9544 5 месяцев назад +57

      @@SynthiaVanor by the devil

    • @MoAbuAkb
      @MoAbuAkb 5 месяцев назад

      No by god ​@@martialhero9544

    • @TruffoYT
      @TruffoYT 5 месяцев назад +9

      Dawg that story isn’t true

  • @4GENS
    @4GENS 5 месяцев назад +14564

    This is the plots that would make you quit watching a show because it's too "unrealistic"

    • @kaydens6964
      @kaydens6964 5 месяцев назад +600

      If you think about it, what happened to Trump is pretty a Mr Bean movie.

    • @kayaphus4303
      @kayaphus4303 5 месяцев назад +14

      Lessons for Trump

    • @Notell.
      @Notell. 5 месяцев назад +10

      ​@@BringOutTheLobster.Don't be so jealous. He planned it out and flew a drone 😂 your daddy isn't protected

    • @markeverhart-xu7hh
      @markeverhart-xu7hh 5 месяцев назад +3

      @@BringOutTheLobster.that’s what you think .

    • @matteframe
      @matteframe 5 месяцев назад +11

      when I saw the guy wearing a racoon hat and bull horns in the Senate chambers, I knew the show had jumped the shark

  • @alvin3698
    @alvin3698 5 месяцев назад +6025

    Every assassination attempt had a chain of time travelers trying to stop each other from killing or saving Hitler

    • @mao-tse-tung-games
      @mao-tse-tung-games 5 месяцев назад +460

      True man. Butterfly effect: if hitler died, maybe someone more competent might have assumed his place, and the world wouldnt be the same.

    • @ExtantPerson
      @ExtantPerson 5 месяцев назад +294

      @@mao-tse-tung-gamesYep. That’s exactly why the Allies eventually stopped trying to kill him. They realized he was more detrimental to the enemy than beneficial

    • @EEEEEEEE
      @EEEEEEEE 5 месяцев назад +8

      E‎ ‎

    • @derederekat9051
      @derederekat9051 5 месяцев назад

      @@ExtantPerson yup, now they can move uninterrupted destroying Europe thanks to the holocaust blame! Genius move!

    • @aaronmurray7308
      @aaronmurray7308 5 месяцев назад +32

      That would be a great movie idea

  • @catcatcatcatcatcatcatcatcatca
    @catcatcatcatcatcatcatcatcatca 4 месяца назад +251

    The style of animations is stroke of genius. The little balls tie the keyframes together, as well as look good with low poly details. It really ties the story together, and allows very strong storytelling with the contrasting colors.

  • @SIMULATAN
    @SIMULATAN 5 месяцев назад +3100

    held a presentation about the stauffenberg attempt in school, its insane how miniature things like a person moving a briefcase by a few centimeters prevented attacks from succeeding and history changing forever

    • @BouXIII
      @BouXIII 5 месяцев назад

      also not forgetting that stauffenberg was no saint. he planned to stop the nazi regime, but wanted to impolement aristocracy again and stop all democratic ideas

    • @dingsda0412
      @dingsda0412 5 месяцев назад +51

      butterflyeffect

    • @EEEEEEEE
      @EEEEEEEE 5 месяцев назад +1

      E‎ ‎

    • @CantTellYou
      @CantTellYou 5 месяцев назад +25

      And, not so miniature but, the allies bomb causing their fancy new costume ceremony to be canceled. I wonder, what would’ve it been like if Stauffenberg and crew had succeeded? Would it eventually just became another, slightly less genocidal dictatorship? idk much about the guy lol

    • @aezurefx
      @aezurefx 5 месяцев назад

      @@dingsda0412 was about to say that

  • @fbiagentmiyakohoshino8223
    @fbiagentmiyakohoshino8223 5 месяцев назад +4779

    40 assassination attempts, and he just kills him self in the end

    • @psychrubus4503
      @psychrubus4503 5 месяцев назад +96

      lol Fidel Castro had major plot armor too

    • @bigpapaplantman5126
      @bigpapaplantman5126 5 месяцев назад +1

      I don't believe he killed himself personally. I think he went to Argentina with the rest of his regime. Still to this day, Argentina has villages in the mountains where people speak German, and there have been 1,000's of high ranking nazi medals found in some of the homes. I think the IDF located him and assassinated him some time in the 60's. Just a theory but totally plausible

    • @memorimusic420
      @memorimusic420 5 месяцев назад +198

      Hitler was like: "if yall cant do it imma do it myself" 😭

    • @バカ-l9o
      @バカ-l9o 5 месяцев назад +5

      MYAA NEE

    • @gb06_06
      @gb06_06 5 месяцев назад +17

      we dont know that

  • @MonkeDiesTwice
    @MonkeDiesTwice 2 месяца назад +270

    10:55 What has RUclips come to. Having to censor words like "Suicide" so that the video does not get demonetized... What a dystopian nightmare.

    • @SDub5050
      @SDub5050 Месяц назад

      Liberals want a soft world

    • @josephsandifur
      @josephsandifur Месяц назад +9

      literally 1984

    • @lesbianrichietozier
      @lesbianrichietozier Месяц назад +4

      it doesnt seem dystopian for advertisers to not want to support channels with references to suicide. just not the best thing to be associated with

    • @MonkeDiesTwice
      @MonkeDiesTwice Месяц назад +27

      @lesbianrichietozier it's history. It's not "being associated with suicide".

    • @lesbianrichietozier
      @lesbianrichietozier Месяц назад +1

      @ dawg hoyoverse and squarespace are not going to advertise on a video openly mentioning suicide lets use our thinking skills please 😭

  • @armansinghbhati8446
    @armansinghbhati8446 5 месяцев назад +4064

    Two assassination attempt videos in 2 weeks is MAPPA levels of crazy

    • @moshymosh
      @moshymosh 5 месяцев назад +110

      Weird reference but ok

    • @Adnan-qf2rz
      @Adnan-qf2rz 5 месяцев назад +28

      hes being held captive in some1s basement or sum

    • @Paradoxical124
      @Paradoxical124 5 месяцев назад +15

      No it isn’t, you’re just young.

    • @lennywhere
      @lennywhere 5 месяцев назад +80

      @@moshymosh weird because the employees of MAPPA are literal slaves or weird because it's an anime prod. company xdxdxd

    • @Hello-There.-General-Kenobi
      @Hello-There.-General-Kenobi 5 месяцев назад +7

      Could you or anybody else explain to me to what op was is referring to please? I know MAPPA but what does it have to do with assassination attemps?

  • @lyndestructible
    @lyndestructible 5 месяцев назад +611

    The animations just keep getting better with every video! This looks incredible, keep up the good and informative work.

  • @Zero_Zero_0_0
    @Zero_Zero_0_0 5 месяцев назад +559

    You forgot to add 2 crucial parts in which the meeting was supposed to take place in secured underground concrete bunker but was changed at the last minute due to the extreme heat, and not to mention that initially Staufenburg places the briefcase as close to Hitler, but was unintentionally moved further away by Col. Brandt, thus contributing to another factor as to why he survived the explosion.

    • @InterlacedStudios1
      @InterlacedStudios1 5 месяцев назад +9

      Noticed that too because I had to learn all about this stuff last year on school

    • @KingK2205
      @KingK2205 5 месяцев назад +1

      Did Col Brandt survive?

    • @tom12-128
      @tom12-128 5 месяцев назад +4

      No you are wrong: „It is often falsely claimed that the meeting should actually have taken place in one of the underground bunkers of the Wolf's Lair.“

    • @bronnquist
      @bronnquist 4 месяца назад +4

      Yes agree, pretty big thing to mention that the bomb was moved.

    • @Rare_Spore_Fan
      @Rare_Spore_Fan 4 месяца назад

      Imagine if col was a time traveller

  • @ScarySkele
    @ScarySkele 5 месяцев назад +1207

    Just a reminder to people: This video took months to make as do all of them, the previous one not to be mentioned was simplistic in comparison to this so obviously it was pumped out quicker. Don’t judge him on the basis of coincidence, judge him on the basis of journalism, effort, research, and knowledge sharing.
    fern-tv has my upmost respect.

    • @tmsupreme7763
      @tmsupreme7763 5 месяцев назад +22

      They released a video about Trump's assasination before this one, I mean I don't mind but still..

    • @ScarySkele
      @ScarySkele 5 месяцев назад +36

      @@tmsupreme7763
      I get that, though if you were working on a project for months then got a simpler project done while doing the big one, I think you would empathize with Fern at that point. It isn’t a matter of Trump first, Hitler second. It is a matter of upload main project second, side project first.

    • @s-ata-n
      @s-ata-n 5 месяцев назад +3

      THERE IS NO PROOF JEFFREY EPSTEIN KILLED HIMSELF

    •  5 месяцев назад +76

      It is not a coincidence. Bruh has no one here had history classes? 😭 It was the 80th anniversary of this assassination attempt on hitler!

    • @Eisbaer_2912
      @Eisbaer_2912 5 месяцев назад

      ​@@s-ata-n maybe not for that, but for other videos

  • @augustus4832
    @augustus4832 5 месяцев назад +1868

    "Hitler commited ' ' in his bunker"
    God, I hate RUclips's censorship of certain words for historical videos.

    • @Willy_Tepes
      @Willy_Tepes 5 месяцев назад +90

      It is political censorship, but often it affects historical videos.

    • @SizzleCorndog
      @SizzleCorndog 5 месяцев назад +165

      @@Willy_Tepesit’s not even political, they’re just trying to avoid language that would put at risk people on edge

    • @Willy_Tepes
      @Willy_Tepes 5 месяцев назад +43

      @@SizzleCorndog No, it is definitely political. I have been probing and tracking this since 2007. There is a logical reason why you can't see this. You hold no opinions that go against the media narrative.
      If people knew what was really going on, I am sure some would be very angry..

    • @SizzleCorndog
      @SizzleCorndog 5 месяцев назад

      @@Willy_Tepes Thats total bs, in 2007 youtube barely existed and was more interested in showcasing what videos were being actively watched. This was the peak of CoD where people were calling each other slurs or telling them to kill themselves for no reason. Nobody gave a shit back then.
      The reason they're actually doing this is because there are people who exist that are fighting with whether they should be alive or not and mentioning topics like suicide or self harm might be enough to either send them over the edge or relive some past experiences. This isn't anything new either, people don't like talking about it to the point where back in the day people would say someone "died of grief" or "died of melancholia" instead of just saying they took their own life.
      The reason you're here moaning and groaning about this is probably because you saw Hitler in the title and thought "finally, more content for me and my Ai Hitler pfp" and then were surprised when they approached the topic with a crumb of sensitivity. But no, its all a narrative created to stop you specifically and keep the rest of us sheeple in line rather than, you know, be respectful of other peoples feelings and experiences.

    • @cuboidmelon
      @cuboidmelon 5 месяцев назад +171

      ​@@Willy_Tepes no its not, it's most likely simply the fact that companies don't want to be associated with negative/controversial topics. If youtube didn't censor stuff they wouldn't get money from running ads. Most corporate decisions are made for monetary reasons and not political.

  • @ailsakatona2415
    @ailsakatona2415 5 месяцев назад +34

    I love how every single object is made of tiny circles it’s so well done and a really interesting video!

  • @friend
    @friend 5 месяцев назад +41

    The rate at which these videos are being pushed out is insane considering how good the production quality is, earned a new sub 👍

    • @Kalidor99
      @Kalidor99 4 месяца назад

      That's easy, their main channel which has now 400 videos is in German, "Simplicissimus", they just have to translate the old videos to English.

  • @DomsYouTube
    @DomsYouTube 5 месяцев назад +420

    I really like this dot projection style animation

    • @EEEEEEEE
      @EEEEEEEE 5 месяцев назад +2

      E‎ ‎

    • @lordbeetrot
      @lordbeetrot 5 месяцев назад +4

      Agree

    • @EdvinLu
      @EdvinLu 5 месяцев назад +1

      Is that the actual name of this animation style?

    • @d.6786
      @d.6786 5 месяцев назад +5

      @@EdvinLuprojection dot style

    • @amanprasad139
      @amanprasad139 5 месяцев назад +7

      I hate it
      More of a pain in eyes, too much going on
      I like it smooth and clean
      And if there's some textures that will be great as well

  • @benengel-k7u
    @benengel-k7u 5 месяцев назад +10

    Ist halt schon krass wie stark ihr die Reichweite erhöhen konntet und halt die Qualität massiv verbessert, keep doing

  • @FreeBoy.
    @FreeBoy. 5 месяцев назад +564

    You know its an awesome day, week, and a month overall, when fern uploads.

    • @xTombou
      @xTombou 5 месяцев назад +9

      so every week and therefore every day is awesome? nice

    • @Oliver-ll6pn
      @Oliver-ll6pn 5 месяцев назад +2

      I’d agree

    • @mrgrumble_roblox
      @mrgrumble_roblox 5 месяцев назад

      hop out of the comments nerd

    • @mac_attack_zach
      @mac_attack_zach 5 месяцев назад +2

      stop glazing

    • @Mewhenthewhenthe-x7j
      @Mewhenthewhenthe-x7j 5 месяцев назад

      He uploads like every week. You can’t even make a comment you stole funny🤦

  • @AlexW-
    @AlexW- 5 месяцев назад +169

    Hitlers secret: A video camera always running in his pocket ... the camera operator never dies

    • @reprovedcandy
      @reprovedcandy 5 месяцев назад +1

      video cameras didnt even exist back then silly

    • @AlexW-
      @AlexW- 5 месяцев назад +25

      @@reprovedcandy don't know if meta joke or not
      But yes they did. Just a bit bigger

    • @gergelyhalasz9754
      @gergelyhalasz9754 5 месяцев назад +8

      ​@@reprovedcandy Not true! The very first video camera was created in 1888, 55-57 years prior than these events.

  • @hans7856
    @hans7856 5 месяцев назад +27

    You failed to mention that Stauffenberg's briefcase was also moved, and a thick table leg protected Hitler from the blast.

  • @marcop.3423
    @marcop.3423 5 месяцев назад +4989

    Posting this after the Trump video is insane

    • @juleha2693
      @juleha2693 5 месяцев назад +177

      Why?

    • @universaltoons
      @universaltoons 5 месяцев назад +24

      😂

    • @nathandebusschere7259
      @nathandebusschere7259 5 месяцев назад +614

      Bro dropped the prequel 😭

    • @HerrŽikaPavlović
      @HerrŽikaPavlović 5 месяцев назад +562

      Yesterday was the 80th anniversary of the most well known assassination attempts on him in history, that's probably why.

    • @nickxplore4265
      @nickxplore4265 5 месяцев назад +138

      It's gonna make sense in 10 years 🤣

  • @nursepls4110
    @nursepls4110 5 месяцев назад +365

    PLEASE put actual captions on your videos. The auto generated ones are impossible to use, and your videos are too damn good to miss

    • @MrBaumGeo
      @MrBaumGeo 5 месяцев назад +27

      yeah i agree, its kinda hard for deaf people to view otherwise aswell

    • @MrBaumGeo
      @MrBaumGeo 5 месяцев назад +3

      and i dont mean insane assylum in an offensive way but just so you can imagine because back then it was totally different from a Psychiatric hospitals. they treated people exremely poor

    • @poorsvids4738
      @poorsvids4738 5 месяцев назад +26

      @@MrBaumGeo what

    • @whoever_81
      @whoever_81 5 месяцев назад +3

      Auto generated ones seem pretty good to me!

    • @MrBaumGeo
      @MrBaumGeo 5 месяцев назад +31

      ​@@poorsvids4738 bro my other comment against nzis was deleted so therefore the context was too. wtf youtube...

  • @NickHammer99
    @NickHammer99 5 месяцев назад +12

    You guys have such a good channel. The production value is insane and every episode is captivating. Great job

    • @benitogarcia5069
      @benitogarcia5069 4 месяца назад

      Personally this dudes voice isn’t really intriguing like the other lol

  • @Max-ln1du
    @Max-ln1du 5 месяцев назад +14

    Can't tell you how thankful i am for this channel that you 3 created. I came from simpli and moved also a few years prior to the netherlands. This is such a great channel aswell as arte, displaying what the connection of two countrys can do. ❤

  • @deziaczek1309
    @deziaczek1309 5 месяцев назад +19

    10:18 I actually went to the place where it happened. It is also worth noting that the briefcase wasn't in the place that it was placed first. Someone had moved the briefcase behind the wooden leg of the table because it was in the way. This caused the explosion to be less impactfull to Hitler as he was further away from the bomb and the wooden leg took some impact on itself.

  • @Brandonlandis
    @Brandonlandis 5 месяцев назад +95

    the worst dude in history has the most luck and i cant even win $10 on a scratch off lottery ticket

    • @Dr.W.Krueger
      @Dr.W.Krueger 4 месяца назад +5

      There were far greater butchers throughout history

    • @Nippleless_Cage
      @Nippleless_Cage 4 месяца назад +1

      Not with Hitler's level of sophistication and premeditation. ​@@Dr.W.Krueger

    • @blank4ever
      @blank4ever 3 месяца назад

      i cant even win 1!!!

  • @samtg7507
    @samtg7507 5 месяцев назад +20

    The peak Documentary that you won't find in Netflix and it's for free hats off.

  • @Ismail-es2ld
    @Ismail-es2ld 5 месяцев назад +11

    It makes so much sense now how you compiled your last video so fast! Having this video in the works came in clutch

  • @eternalslumber2k6
    @eternalslumber2k6 5 месяцев назад +9

    Keep this video quality up and keep covering such interesting subjects and you will become one of the most popular channels on this platform for sure.

  • @1oxin
    @1oxin 5 месяцев назад +140

    6:07 just to think if the allies didnt bomb, the war wouldve been over a lot quicker 💀

  • @HistoryOnPaper
    @HistoryOnPaper 5 месяцев назад +46

    1:41 subtitle: “Tesco’s turning point”
    I think that’s the funniest subtitle ever

    • @will2056
      @will2056 5 месяцев назад +8

      This moment led to the 2013 invasion of Denmark.

    • @vijay-jw8gq
      @vijay-jw8gq 4 месяца назад +4

      No more meal deals😢

  • @Colmath
    @Colmath 5 месяцев назад +51

    There is an argument to be made that him being alive actually made the war shorter. His involvement in military command from 1941 was so disastrous, so incompetent that it made huge Allied advances possible. Had he been assassinated and the German military been left to "do its job", they might have been able to hold out for longer. So in a weird way, the most evil dictator not dieing soon enough might have actually lead to fewer deaths than him becoming a martyr and even worse people coming to power.

    • @MacenW
      @MacenW 4 месяца назад +2

      Weird take

    • @cheesegizzler14
      @cheesegizzler14 4 месяца назад +11

      @@MacenWweird but definitely reasonable

    • @shidditiddis
      @shidditiddis 4 месяца назад

      Everything happened as it was supposed to

    • @Brent-jj6qi
      @Brent-jj6qi 25 дней назад

      This is entirely untrue, and is based off the memoirs of his generals, who were happy to throw him under the bus after the war. Was he too hands on? Yes. Was he truly that bad at his job? No, and he was right as often as he was wrong. He especially was pretty average compared to the people he was surrounded with. The war definitely could’ve been shorter if someone more delusional like goebbels tried to dump more resources into stupid wunderwaffe
      Plus, none of this takes into account the idea that he could’ve been replaced by someone willing to negotiate a surrender, especially later on into the war, which would’ve made it even shorter

    • @fish5671
      @fish5671 24 дня назад

      No way, many times hitler made choices that were more tactically sound than his generals not to mention killing hitler would have started a power-struggle so it could have only been a good thing to assassinate him

  • @busterrex7588
    @busterrex7588 5 месяцев назад +9

    Fern, your videos are too amazing. From when I first clicked on the Whittinoom video I have been hooked on this channel you guys somehow are able to produce such great quality videos whist still uploading consistency and often! Just wanted to say I appreciate the effort that goes into these videos. Cheers

    • @aggravated_assault
      @aggravated_assault 5 месяцев назад

      Because they were backed by the german public broadcasting

    • @anderson._.._.8801
      @anderson._.._.8801 4 месяца назад +1

      Yup, the simplicissimus guys are great 👍

  • @--AnonymousUser--
    @--AnonymousUser-- 5 месяцев назад +67

    0:10 You made a mistake here. That's the Bunker-Hitler outfit from Spring 1945, not the Chancellor outfit from late 1939.

  • @kevinr7216
    @kevinr7216 4 месяца назад +6

    Freakin LOVE the animation on these vids good lord. Such high production quality great vid

  • @5upl1an
    @5upl1an 5 месяцев назад +161

    Its easy, someone wrote his name in a Death Note with the date 30. April 1945 which made him pratically immortal until that day.

    • @goblincomic4522
      @goblincomic4522 5 месяцев назад +5

      I though maximum day for death note is 23 days ?

    • @looniemoonie5955
      @looniemoonie5955 5 месяцев назад +9

      @@goblincomic4522 yes. It's just a joke. I don't remember if it's 23 days, I thought it was around 28

    • @obnoxious_moron
      @obnoxious_moron 5 месяцев назад

      you can't extend someone's life with the death note

  • @_WyngX
    @_WyngX 5 месяцев назад +17

    Wow fern.. your animation just gets better and better every video.. I'm jealous! :D

    • @rulers8969
      @rulers8969 5 месяцев назад

      I'm the first person to comment on you channel.

    • @_WyngX
      @_WyngX 5 месяцев назад

      @@rulers8969 HEy mate! :D

    • @rulers8969
      @rulers8969 5 месяцев назад

      @@_WyngX hi brother

    • @rulers8969
      @rulers8969 5 месяцев назад

      @@_WyngX I sub to you.

  • @saacde
    @saacde 5 месяцев назад +5

    Fern keeps on dropping banger after banger this whole month?! Thank you for all the content

  • @rjbeatz
    @rjbeatz 5 месяцев назад +293

    The irony is that he ended up killing himself after all the attempts 💀

    • @mrbilter83
      @mrbilter83 5 месяцев назад +55

      "Fine i'll do it myself" - funny mustache man, 1945 -

    • @the_mastermage
      @the_mastermage 5 месяцев назад +4

      He be like fine I'll do it myself

    • @grandcanyon-d4d
      @grandcanyon-d4d 5 месяцев назад +14

      He ran to South America

    • @mariopasta
      @mariopasta 5 месяцев назад +5

      Or maybe not

    • @shashwatgrover1
      @shashwatgrover1 5 месяцев назад +2

      Maybe they would have said that Trump also did it himself 🤷🏻‍♂️

  • @thePaloo
    @thePaloo 5 месяцев назад +7

    Your storytelling is incredible and documentary-level. Many thanks for this video!

  • @BT10e
    @BT10e 2 месяца назад +1

    Of all the great things done in this video, i think the pronunciation of german words stood out to me the most. Its so crisp and clear.

  • @rahmi.digital
    @rahmi.digital 5 месяцев назад +6

    Unglaubliches Timing und unfassbar gut umgesetzt. Hut ab vor dem gesamten Team!

  • @LG23-ho3zk
    @LG23-ho3zk 5 месяцев назад +502

    Hitler is the real life stupid comically evil villain that the franchise keeps on reviving
    Edit: dawg this pfp is satire, I ain’t actually ancap

    • @Neverlose001
      @Neverlose001 5 месяцев назад +6

      O.J. Simpson

    • @dikipprasad
      @dikipprasad 5 месяцев назад +5

      Look who's saying that 😂

    • @unnameduser-1
      @unnameduser-1 5 месяцев назад +13

      sus profile pic

    • @Snp2024
      @Snp2024 5 месяцев назад +2

      ​@@unnameduser-1why

    • @unnameduser-1
      @unnameduser-1 5 месяцев назад +2

      @@Snp2024 dont get it? look at the colors 🟨⬛

  • @tobiwan001
    @tobiwan001 5 месяцев назад +8

    10:33 it’s the Bendlerblock (not Blenderblock). It was a city block in Bendlerstrasse. Now the street is called Stauffenbergstrasse - obviously.

  • @Clock_Man_2763
    @Clock_Man_2763 5 месяцев назад +4

    Two assassination videos in less than a week is crazy, Fern really cooks well 🔥🔥

  • @Housewarmin
    @Housewarmin 5 месяцев назад +5

    It is music to my ears to hear you say these names properly. I love your accent

  • @thetr1x3r76
    @thetr1x3r76 Месяц назад

    Hey, I came from Simplicissimus (watch 2 Bored Guys as well) . I really enjoy your german videos especially because my native language is german as well. English doesn't bother me, but there are topics you discuss on fern that would be interesting on Simplicissimus as well. Especially topics like this, to get a wider target group and also the peoples that don't understand english very well. But maybe I did get something wrong and there are reasons you don't do this.
    But however great Video and thank you for this high quality researches, a ray of hope in a time were it is not self-evident that people really take there time to carefully work up such topics and to present them as neutral/objective as possible.
    Really thank you, and I hope you both keep sticking along a very long time and produce such high quality content. ☺
    (I'm sorry for my written english)

  • @DiplexHeated
    @DiplexHeated 5 месяцев назад +33

    The people who think it’s crazy dropping this after the Trump video are the ones associating Trump with Hitler, not the channel.

    • @mao-tse-tung-games
      @mao-tse-tung-games 5 месяцев назад +2

      It wasn't planned, but when it happened, they grabbed the opportunity. Truly a deficit of respect

    • @BlackoutWH
      @BlackoutWH 5 месяцев назад +18

      @@mao-tse-tung-games Or maybe it was the 80th anniversary of the attempt mhhh.... nahh they just grabbed the opportunity

    • @S.1-I-I-1-1
      @S.1-I-I-1-1 5 месяцев назад +15

      @@mao-tse-tung-games Boohoohoo. The orange sociopath is impossible to respect.

    • @johnnyxmusic
      @johnnyxmusic 5 месяцев назад

      @@S.1-I-I-1-1 you know it’s fantastic… Powered by the right AI algorithm… Every disparaging comment about a certain person could probably be collected in one afternoon… And go on a certain persons list… A certain person who is planning on creating concentration camps… And when the people in those concentration camps are emptied out… They’ll be plenty of room for people who don’t go along with the agenda of that certain person. I believe the camps in Germany at least one of them were created As rehabilitation camps. That’s the one that has a certain phrase over the gateway…

    • @micahsarm
      @micahsarm 5 месяцев назад +5

      @@mao-tse-tung-games Respect should be given to those who deserve it, not to those like Trumpie.

  • @Apfelloch
    @Apfelloch 5 месяцев назад +28

    I really like this "point cloud" style animation and the transitions. Probably saves a lot of time in comparison to actual walking animations. However, all these little dots are pretty hefty on RUclipss compression algorithm such that some scenes become blurry. Tom Scott has a great video about this ("Why Snow and Confetti Ruin RUclips Video Quality").

  • @AlexClipsSFM
    @AlexClipsSFM 25 дней назад +2

    When the time traveler keeps trying to kill Hitler, but a second time traveler keeps warning him

  • @christianc8453
    @christianc8453 5 месяцев назад +9

    It’s really wild what you can uncover about history when you teach yourself.
    “History is written by the victors.”

  • @striderwhiston9897
    @striderwhiston9897 5 месяцев назад +8

    This artstyle of yours kinda reminds me of those war flashback cutscenes in call of duty ghosts.

  • @patrikmatousek5450
    @patrikmatousek5450 2 месяца назад

    I remember having a presentation about the Operation Valkyrie a year ago. I couldn't find any information about this nowhere. I'm very surprised how much you guys know about it. Although there's two small things I'd like to mention. Staufenberg intended to take control of Germany and make a "deal" with the united forces. He wanted to end the war with an agreement.
    Later that day, A. H. was having a conversation with somebody and they even laughed at this attempt. Very well made :)

  • @foudie
    @foudie 5 месяцев назад +36

    i mean they could've just put the other unarmed bomb with the armed bomb in the brief case, so when the first bomb explodes the other one would too.

    • @grimnippz7398
      @grimnippz7398 5 месяцев назад +12

      depends on the explosive used, it could have just blown the second bomb apart failing too detonate.

    • @Marcel-yu2fw
      @Marcel-yu2fw 5 месяцев назад +3

      @@grimnippz7398 But it couldn't hurt to put in the other bomb too, right? Just in case it works.

    • @hwfq34fajw9foiffawdiufhuaiwfhw
      @hwfq34fajw9foiffawdiufhuaiwfhw 5 месяцев назад

      not that i have knowledge of bomb making, but that would likely just shatter the other bomb into shrapnel like it was any other object in the blast radius. wouldn't be the same as a second bomb
      exploding (overheated) soda can vs firing a bullet through a soda can

    • @cuboidmelon
      @cuboidmelon 5 месяцев назад +2

      If it was minecraft, then yeah...

    • @grimnippz7398
      @grimnippz7398 5 месяцев назад

      The explosives used required a chemical reaction for the detonation, meaning the pressure of the second bomb would have had almost no chance too undergo detonation. However as a redundancy it couldnt have hurt.

  • @Lt_Koro
    @Lt_Koro 5 месяцев назад +36

    I was gonna comment on how this video after the trump video is weird, but pushing the trump video out as quickly as possibly was just important and yesterday was the 80th anniversary of this event, so it really cant be malicious in any way.

  • @JacksonRockwell
    @JacksonRockwell 5 месяцев назад +2

    This animation is insane! so cool thank you for producing high quality content it is much appreciated!!!!

  • @dhavalshah2612
    @dhavalshah2612 5 месяцев назад +22

    babe wake up, new Fern video dropped.

  • @Vinitys
    @Vinitys 5 месяцев назад +28

    Really underrated channel

    • @swedishplayer97
      @swedishplayer97 5 месяцев назад +12

      Literally has over a million subscribers

    • @POLIZFI
      @POLIZFI 5 месяцев назад +6

      @@swedishplayer97 only a million

    • @hanibalfischkopf6286
      @hanibalfischkopf6286 5 месяцев назад +2

      ​@@swedishplayer97Should be way more.

    • @neusyns
      @neusyns 5 месяцев назад +2

      Underrated? Bad choice of words. It has a German main channel and an English channel (this one)
      But underrated in the fact that these haven't been picked up by an official TV docu-series. Yes
      Whatever goal this channels creator set for itself, it HAS to have accomplished because idk how it gets better than this

    • @aurexify
      @aurexify 5 месяцев назад +2

      Learn what 'underrated' means.

  • @jackfireee
    @jackfireee Месяц назад

    I never knew about this. I'm a huge WW2 history fan and I love and enjoy watching videos like this. Thank you for making this video fern!

  • @timpa2397
    @timpa2397 Месяц назад +5

    not saying this feels pretty relatable rn but it might feel pretty relatable rn

  • @Turkishgameinvader
    @Turkishgameinvader 5 месяцев назад +10

    That bastard survived 43 assasinations dude he has some kind of plot armor

  • @Qba116
    @Qba116 5 месяцев назад +1

    Love that you included (or maybe "excluded") Stauffenberg's missing right hand!

  • @rostislav.lisovy
    @rostislav.lisovy 5 месяцев назад +52

    Ok... so showing all those explosions, talking about killing someone, showing human figures with grenades in their pockets and explaining they would have also killed themselves is ok... but for some reason you have to "censor" the word "suicide"?

    • @myaccount__7269
      @myaccount__7269 5 месяцев назад +37

      Blame RUclips who de mometizes bad words

    • @jakedee4117
      @jakedee4117 5 месяцев назад +5

      I thought the same thing myself, but it's RUclips rules, and perhaps censored automatically by algorithm not by a human who understands the full subject matter. I recently have heard RUclipsrs saying, "He un-alive himself!"

    • @ergwertgesrthehwehwejwe
      @ergwertgesrthehwehwejwe 5 месяцев назад +2

      At what point do we stop forgiving youtubers for bending the knee to censorship like this? Nobody seems to have a spine anymore

    • @myaccount__7269
      @myaccount__7269 5 месяцев назад +25

      @@ergwertgesrthehwehwejwe it’s either this or they get zero money. Do you work for free? As I said…blame RUclips

    • @keisuketakahasi4584
      @keisuketakahasi4584 5 месяцев назад

      @@myaccount__7269 dont hate the player, hate the game

  • @Cypher791
    @Cypher791 5 месяцев назад +5

    They don’t make tables like that anymore… ✋😆

  • @johannesr8709
    @johannesr8709 5 месяцев назад +1

    The dust visuals and animations are absolutely insane ! Amazing work!

  • @JollyBubuyug
    @JollyBubuyug 5 месяцев назад +5

    The fact he got away from all of those assassinations but not the assassination from himself.

  • @Alex-rn6rr
    @Alex-rn6rr 5 месяцев назад +19

    Cant wait to watch this on Simplicissimus

  • @Jonathan_drg
    @Jonathan_drg 5 месяцев назад +1

    Ihr übertrefft euch mit den Videos mittlerweile selbst! Die Animationen sind 💯💯

  • @just_mdd4
    @just_mdd4 5 месяцев назад +55

    Fern must've planned these videos! 😝

    • @just_mdd4
      @just_mdd4 5 месяцев назад +27

      Disclaimer: Yes, I know the timing was not intentional.

    • @Paradoxical124
      @Paradoxical124 5 месяцев назад +2

      @@just_mdd4why make the comment then 🤦‍♂️

    • @Hyperlaser_Merc
      @Hyperlaser_Merc 5 месяцев назад +3

      Its funny, ​@@Paradoxical124

    • @Paradoxical124
      @Paradoxical124 5 месяцев назад

      @@Hyperlaser_Merc I suppose that’s my issue because I didn’t laugh 😞

    • @ftr98
      @ftr98 5 месяцев назад +3

      Yes because yesterday was the 80'th anniversary of the stauffenberg attentat

  • @lukemontgomery1774
    @lukemontgomery1774 5 месяцев назад +57

    You'd think after 40 attempts he'd take the hint

    • @alphakevin687
      @alphakevin687 5 месяцев назад

      Fascists are not the smartest bunch

    • @antdiamond64
      @antdiamond64 5 месяцев назад +13

      He did

    • @Willy_Tepes
      @Willy_Tepes 5 месяцев назад +1

      That the hand of God was protecting him?

    • @sayorancode
      @sayorancode 5 месяцев назад

      @@Willy_Tepes if god was mean : , no it has to be a coincidence

    • @Willy_Tepes
      @Willy_Tepes 5 месяцев назад +1

      @@sayorancode God takes care of his servants..

  • @Crewmate-i2h
    @Crewmate-i2h 5 месяцев назад

    The quality of your animations has become just insane. Love your work.

  • @timr.2257
    @timr.2257 5 месяцев назад +9

    1: Aren’t there better methods back then than relying on chemicals for a time bomb? 😅
    2: They don’t even pat down new people that gets close to Hitler?

    • @concept5631
      @concept5631 4 месяца назад

      Nazi's aren't known for being smart.

  • @vincent-of7vo
    @vincent-of7vo 5 месяцев назад +17

    Today, we remember Claus schenk Graf von stauffenberg🕊️

  • @shadowdweller-f7q
    @shadowdweller-f7q 2 месяца назад

    I use RUclips Premium so I don't see ads now. So I really want to know how you guys create such 3D scenes so amazingly. They are mesmerizing. Truly amazing. The ads are annoying but they also introduced me to many new websites and other things. I appreciate them for that. But my time saved in those ads is much more valuable than those website in my context. Hence I use RUclips Premium.

  • @marianandnorbert
    @marianandnorbert 5 месяцев назад +20

    HE CAN'T KEEP GETTING AWAY WITH IT

    • @g3nj1
      @g3nj1 5 месяцев назад +1

      The tried to put Adolf in a self defense situation and found out.

  • @Bloidz7
    @Bloidz7 5 месяцев назад +7

    Fern is on his assassination video arc

  • @nelo1453
    @nelo1453 5 месяцев назад +3

    Ungewöhnlich Euch auf Englisch zu gucken wenn man nur Simplicissimus gewohnt ist

  • @Mightydoggo
    @Mightydoggo 5 месяцев назад +5

    Haha! The timing is just glorious, I think the universe wants to tell us something. lol
    And yeah, every halfway sane person knows how long it takes for such a video to make. It´s a coincidence, but a really funny one.

    • @nikoraasu6929
      @nikoraasu6929 5 месяцев назад

      timing on what

    • @mao-tse-tung-games
      @mao-tse-tung-games 5 месяцев назад

      Nah. They had been working for a while, sure, but they get to decide when it uploads. It's not a mere "coincidence". It's their strategy of getting the algorithm on their side. And they got it.

    • @BlackoutWH
      @BlackoutWH 5 месяцев назад

      ​@@mao-tse-tung-gamessure it's not like the most famous attempt in the video had its anniversary the day before it got released

  • @fasa9plus
    @fasa9plus 5 месяцев назад

    you’re doing such a great job, i love simpli, 2bg and the fusion with fern is super cool. weiter so jungs ❤

  • @0h5ive
    @0h5ive 5 месяцев назад +3

    holy shit he still alive?!

  • @GeorgeNoah-xf9tb
    @GeorgeNoah-xf9tb 5 месяцев назад +144

    Hallelujah 🙌🏻!!!!! The daily jesus devotional has been a huge part of my transformation, God is good 🙌🏻🙌🏻. I was owing a loan of $49,000 to the bank for my son's brain surgery, Now I'm no longer in debt after I invested $11,000 and got my payout of $290,500 every month…God bless Mrs Susan Jane Christy ❤️

    • @PoynterGeesey
      @PoynterGeesey 5 месяцев назад

      Hello!! how do you make such monthly, I’m a born Christian and sometimes I feel so down of myself 😭 because of low finance but I still believe God

    • @NoahOliver-rx3mp
      @NoahOliver-rx3mp 5 месяцев назад

      Thanks to my co-worker (Carson ) who suggested Ms Susan Jane Christy

    • @KleffmanRosenbush
      @KleffmanRosenbush 5 месяцев назад

      She's a licensed broker here in the states🇺🇸 and finance advisor.

    • @KleffmanRosenbush
      @KleffmanRosenbush 5 месяцев назад

      After I raised up to 525k trading with her I bought a new House and a car here in the states🇺🇸🇺🇸 also paid for my son's surgery….Glory to God, shalom.

    • @LouisPeters-fw9cg
      @LouisPeters-fw9cg 5 месяцев назад

      Can I also do it??? My life is facing lots of challenges lately

  • @VeriEnana
    @VeriEnana 4 месяца назад

    your passion for teaching and sharing is clearly visible in every video! ❤️

  • @DoFliesCallUsWalks
    @DoFliesCallUsWalks 5 месяцев назад +4

    fern is on an Assassination streak.

  • @hanibalfischkopf6286
    @hanibalfischkopf6286 5 месяцев назад +8

    Hitler put all his skill points in luck.

  • @arc1419
    @arc1419 Месяц назад

    I think I speak for everyone when I said that we will be more than grafetufl if we got 40 videos of the 40 different assassination attempts on Hitler with this animation, writing and voice acting beyond amazing

  • @muysli.y1855
    @muysli.y1855 4 месяца назад +3

    11:47 smart

  • @NegativeProcess
    @NegativeProcess 5 месяцев назад +3

    If this happened in America we would have some people saying these were acts of god 😂

  • @Nyx1k
    @Nyx1k 4 месяца назад

    Great video and really thorough animations. Deserves a big like:)

  • @ShowCasesGD
    @ShowCasesGD 5 месяцев назад +22

    SHUT UP MOM FERN UPLOADED

  • @TheOGRokma
    @TheOGRokma 5 месяцев назад +3

    Odd coincidence of when this video came out🤔

  • @orfoisus
    @orfoisus 5 месяцев назад +1

    Damn! Brilliant really spent A TON on this recent youtube-wide ad-spree

  • @sleepingmelons8420
    @sleepingmelons8420 5 месяцев назад +2

    Why is RUclips posting Wikipedia articles.

  • @TheCommentor-
    @TheCommentor- 5 месяцев назад +5

    Hitler has so much plot armour, he was the only person that could kill Hitler

  • @realpv_aka_vp
    @realpv_aka_vp 5 месяцев назад +2

    Despite the fact that i know that its a coincidence, this video's timing is the funniest thing I've seen in a while
    even though other people, including the creators, might disagree, this is kinda meaningful as well

  • @virdixxii8341
    @virdixxii8341 Месяц назад +11

    taking notes

    • @CARDAMELO
      @CARDAMELO Месяц назад +1

      Y'all messed up in the head

    • @chicken65tv
      @chicken65tv 28 дней назад +1

      @@CARDAMELO fr

    • @m.r4841
      @m.r4841 10 дней назад

      But this time, do not fail on Trump

  • @samhayzen
    @samhayzen Месяц назад +6

    Hope y'all are taking notes :D

    • @CARDAMELO
      @CARDAMELO Месяц назад

      Ur messed up in the head

    • @amayaslore
      @amayaslore Месяц назад

      if trump somehow gets 😵🪦 then you will get Vance as president. Just saying.

    • @chicken65tv
      @chicken65tv 28 дней назад

      if ur talking about trump, then you’ll probably change your mind soon enough

  • @mystischertelefant8868
    @mystischertelefant8868 5 месяцев назад

    Perhaps also interesting: the actual assassination attempt, which Staufenberg had carried out that day, was postponed again shortly beforehand, to the “Wolf's Lair” away from the actual venue. This also had an enormous influence on the outcome of the situation, as the oak table was able to absorb the pressure of the detonation and the open windows were also able to release the pressure into the surrounding area. The meeting was actually planned in a bunker, where the pressure would have further damaged the room and caused more damage. This was also one of his strategies, canceling or changing locations or times at short notice.

  • @heroofjapan
    @heroofjapan 5 месяцев назад +9

    The timing to post this video is sus

  • @ConsumerOfCringe
    @ConsumerOfCringe 5 месяцев назад +6

    "guys lets not critisize hitler, they nearly assassinated him, we need unity in germany"