Next video will be a return to Besiege, but I figured I'd check this game out after a while. I might try a campaign challenge in this game, but it's so easy it's almost difficult to make it difficult.
Reid captain I love your videos and would love for you to try the game trail makers you can make a variety of vehicles like cars,planes and with the new space update spaceships would love for you to make a video about it and keep up the good work 😎
If I had the guess, the problem with the first engine design is that the game didnt recognize the propellers being attached to a "real" rotation source. It's a lot easier for the game to calculate thrust based on how much it thinks the propellers *should* rotate instead of doing real time wind physics with them. Once you attached a gear, the game recognized the propellers being attached to a "real" rotation source. That being said, I know nothing about this game and this is entirely based on my programming knowledge.
That, and he probably put some of them backwards without realizing it, the physics in the game are rather simple, so if anything is being used in any unintended way the results are unpredictable
Seriously, watching this was frustrating as hell. He had absolutely no horizontal or yaw control for the entire aircraft essentially. If you dont have yaw or horizontal control youre not gonna fly, since you cannot pitch the nose correctly.
I remember once trying to channel spirit of the Reid to build an engine powered car in IOD but i kept running into issues with forcing the pistons to move at precise angles and engine kept spinning in either left or right or stopping completely. Glad to see you trying it out. I will try to do it again with your build!
I think your problem was that some engines went in reverse, cause I kept seeing engines stall out and I think they might have been going in reverse which explains why when you start its fine but then suddenly you just lose all thrust
At the start of the video: "I wanna make a vehicle that can beat every level" At the end of the video: "Okay so that didn't work, but check out this dope bomber!"
Hi Reid captain I love your videos and would love for you to try the game trail makers you can make a variety of vehicles like cars,planes and with the new space update spaceships would love for you to make a video about it and keep up the good work 😎
Flex connectors have no collision There's also anchor blocks (that isn't what they are called. I just forgot their name) that can anchor you to the ground.
The mistake that most youtubers make when building a plane in any game is that they forget the rear wheels are a pivot during takeoff. They need to be just behind the CoG not right at the back of the plane, otherwise you cannot "rotate".
Counterintuitively the centre of lift also wants to be just behind the CoG, meaning the tail needs to be producing a downwards force to counter it. This is more stable in flight compared with having the tail add lift
So to summarise, CoG just slightly ahead of wings and wheels. Rear wheels under the wings, and tail trimmed so that it adds downward force in level flight. If you put the wheels under the wings and it falls nose up, you need to add weight at the front, or reduce weight at the back. Remember though a long tail adds leverage to the rear control surfaces and stability and will make it easier to pitch up during takeoff.
I’d like to see an updated version of this. Obviously there could be improvements once we better understand how wings work and how weight works. Plus a better way to turn would be good.
I think next time You should make a Helicopter or something akin to drone. In IOD these types of vechicles are way more controllable and just work as expected. Planes need a bit of work from the developer before we can make larger planes. Whilst now only helicopters are easier to scale up!
Okay this game is the pinnacle of making engines I love it, but the big problem I saw was you have awful balance, so you need to balance the forces, the inline 2 you made worked well enough given you had a slow engine but an inline 4 has perfect primary forces and is just 2 inline 2s I love your vids
I would really reccomend a game called Main Assembly. It's a great sandbox game that allows you to make pretty much anything you want because of it's building system that allows you to shape the materials you build with.
it kinda looked like your engines were cutting out, probably because of the rotation sensors were picking up the rotation of the plane and not just the engine crank, or maybe not, I don't know.
When they are straight up and down, they don't track correctly, and the more I pitch the more likely the engines are to misfire, it wasn't a greatttt system but it did the trick
![Crazy Sand Worm, Massive Mechs, and More! [Instruments of Destruction]](http://i.ytimg.com/vi/W342kvFKKgQ/mqdefault.jpg)
Next video will be a return to Besiege, but I figured I'd check this game out after a while. I might try a campaign challenge in this game, but it's so easy it's almost difficult to make it difficult.
You should make a besiege video of you just building different missiles and whatnot, I think most people would really enjoy it
Very solid idea
@@ReidCaptainplane that launches another plane, possibly the 2nd plane launching a small missile. I think itd be a pretty good challenge, idk
@@ReidCaptainmake a fully functional European dragon
Reid captain I love your videos and would love for you to try the game trail makers you can make a variety of vehicles like cars,planes and with the new space update spaceships would love for you to make a video about it and keep up the good work 😎
I’m convinced this man can create any war machine in any game
All hail the axe
Today I created a tank in tetris.
He's definitely the kinda guy who sits down to play solitaire but ends up learning to throw the cards like ninja stars.
Today I created a light machine gun in pong
Be thankful he doesn't have a massive 3d printer.
you should try making a radial engine. its a good way to teach yourself timing and firing positions. also it is fun to make and watch.
I think I made one a really long time ago in a scrap mechanic video, could be interesting to bring back
@@ReidCaptain you did, ive seen it
If I had the guess, the problem with the first engine design is that the game didnt recognize the propellers being attached to a "real" rotation source. It's a lot easier for the game to calculate thrust based on how much it thinks the propellers *should* rotate instead of doing real time wind physics with them. Once you attached a gear, the game recognized the propellers being attached to a "real" rotation source.
That being said, I know nothing about this game and this is entirely based on my programming knowledge.
You can change the Material Override setting for any part to "No Collide Parts"
I like the new UI but it is taking some time to get used to.
Also aren't there like invisible floating structure? I saw them in a ScrapMan video
@@Cake_soup Yeah you can use the linkage setting to attach parts with invisible connections.
@@Pyroteknikid yeah I think it's better than just things going through each other
@@Cake_soup Yes the benefits are both aesthetic and mechanical, as a lot of machines will inevitably have collision between parts.
Makes tail heavy aircraft, blames game.
I think your problem was the tail. The orientation of the flaps might have been causing some issue.
That, and he probably put some of them backwards without realizing it, the physics in the game are rather simple, so if anything is being used in any unintended way the results are unpredictable
Also it might be because the tail and wings have unequal amounts of lift so the front is having a easy time lifting but the tail isn’t
Seriously, watching this was frustrating as hell. He had absolutely no horizontal or yaw control for the entire aircraft essentially. If you dont have yaw or horizontal control youre not gonna fly, since you cannot pitch the nose correctly.
You are the NileRed of engineering games. I love it. I've looked forward to every video since 2021. Keep at it!
he is nilered
@@pow33.But instead of chemistry, his Phd is engineering things that look like they came from the mind of a drunk German.
I remember once trying to channel spirit of the Reid to build an engine powered car in IOD but i kept running into issues with forcing the pistons to move at precise angles and engine kept spinning in either left or right or stopping completely. Glad to see you trying it out. I will try to do it again
with your build!
This channel went on for more then 2 years, that's amazing!
I think your problem was that some engines went in reverse, cause I kept seeing engines stall out and I think they might have been going in reverse which explains why when you start its fine but then suddenly you just lose all thrust
you've been spoiled by how good besiege's aerodynamics are
At the start of the video: "I wanna make a vehicle that can beat every level"
At the end of the video: "Okay so that didn't work, but check out this dope bomber!"
When I see that Reid captain posted a video.... I know I am in for a complicated mind pending video
I think your b is upside down
Even youtube sees this as discount Besiege.
It would be cool if you try to make a Dyson sphere in KSP or KSP two
fr
I love how you prove servo motors would work perfect and still choose the engine respect the dedication to engines
Next video:
"Making a War Machine of Destruction in Penguin Paradise"
yeah, this game has gotten insane. some of the builds are impressively terrifying
My brain: BESIEGE?!
no besiege :(
BESIEGE KNOCKOFF?!
Hi Reid captain I love your videos and would love for you to try the game trail makers you can make a variety of vehicles like cars,planes and with the new space update spaceships would love for you to make a video about it and keep up the good work 😎
Flex connectors have no collision
There's also anchor blocks (that isn't what they are called. I just forgot their name) that can anchor you to the ground.
13:30 i would’ve tried putting the wings at an angle.
but it was prb just glitchy xd
The mistake that most youtubers make when building a plane in any game is that they forget the rear wheels are a pivot during takeoff. They need to be just behind the CoG not right at the back of the plane, otherwise you cannot "rotate".
Counterintuitively the centre of lift also wants to be just behind the CoG, meaning the tail needs to be producing a downwards force to counter it. This is more stable in flight compared with having the tail add lift
So to summarise, CoG just slightly ahead of wings and wheels. Rear wheels under the wings, and tail trimmed so that it adds downward force in level flight.
If you put the wheels under the wings and it falls nose up, you need to add weight at the front, or reduce weight at the back. Remember though a long tail adds leverage to the rear control surfaces and stability and will make it easier to pitch up during takeoff.
i cant wait for this guy to make a A-10 warthog in this game
I’d like to see an updated version of this. Obviously there could be improvements once we better understand how wings work and how weight works. Plus a better way to turn would be good.
I’d suggest more videos of this game, it’s very interesting and cool to watch! Have a nice day
I was not expecting that ending at all
Yes, this game again!
I think next time You should make a Helicopter or something akin to drone. In IOD these types of vechicles are way more controllable and just work as expected. Planes need a bit of work from the developer before we can make larger planes. Whilst now only helicopters are easier to scale up!
8:35 wright flyer moment
War crimes back at it
We do a little warring
A bit of Ryanair landing there
Okay this game is the pinnacle of making engines I love it, but the big problem I saw was you have awful balance, so you need to balance the forces, the inline 2 you made worked well enough given you had a slow engine but an inline 4 has perfect primary forces and is just 2 inline 2s I love your vids
P O T A T O ?
YES
PATATA
@@slurpyboi3965 CORRECT!!!
Potato
@@danejoyce5964 Potato
Hi Reid you are by far my favourite content creator of all and you have inspired me to take on the dream of becoming a mechanical engineer.
The fact that he hit two towers in the end
Do a video about Flyout. It released yesterday.
When you don't realized that the plane Is too long in the back
I would really reccomend a game called Main Assembly. It's a great sandbox game that allows you to make pretty much anything you want because of it's building system that allows you to shape the materials you build with.
felt to me like the propellas were spinning different directions some of them.
perfect bomber for top tier warthunder
16:14 Twin tower?
next up:
making a fully automatic AR-15 in Kerbal space program with working red-dots and Laser sight
The engine man.
Before one hour!
Conform with the mass of people who do this and join the simulation!
I liked my comment and my comments comment
Gj
Your wings are to far back
And to small of a tail
Hehe ground go boom
Very boom
@@ReidCaptainwait you actually replied 😊 btw love your content you should play warthunder
Beautiful video!
Whoa, super early on this one :)
how tf did you comment on the vid before it was even posted
@@fosterdowning4008he got early access
Okay, when it comes to getting first, that's just cheating bro.
how is it saying 3 days ago on ur comment
You should play flyout
At first I was not expecting for a holl plain cus I was not looking the title
He’s the Nile red of gaming
5:42 so are you just making your own engine for the challenge?
There is a setting to remove the collision from selected part.
ICNM in instuments of destruction
it kinda looked like your engines were cutting out, probably because of the rotation sensors were picking up the rotation of the plane and not just the engine crank, or maybe not, I don't know.
When they are straight up and down, they don't track correctly, and the more I pitch the more likely the engines are to misfire, it wasn't a greatttt system but it did the trick
Make a tactical bomber in minecraft.
You should build a spidertron from factorio! I would love to see how you would make the legs move
Have you heard of terratech? My roommate told me about it and it seems right up your alley, and apparently theres a sequel coming out
16:16 😳
Is it not due to the rotation of the blades on the tail of the plane?
make a civilian aeroplane in besiege
Make a flak gun
It’s basically an artillery gun used as an anti-air
sounds like nilered if he does gaming
Making Vietnam in Instruments of destruction:
next challenge: give the underbelly functional bay doors
You should try out brick rigs
It has a good editor and is 100% sandbox game
I know why it didn't want to take off you need the back part of the wings to rotate to help it fly.
not Besiege but I'm still interested
I think you should try building a war machine in peoples playground
Good video now im going to see it
So, its besiege with a coat of paint...
Nah, just primer
It's a little different, hard to explain but the components are just a little easier to use
This was epic!
video idea: AC-130 in besige (or instruments of destruction you choose)
Maybe your tail wings were in the wrong direction, thats why it didn't fly straight
try making a smaller plane that way its not so heavy and might be able to turn better and fly better
There is really no use making planes in this game for now because they have not been focusing on planes at all
u shout use the flex connecters they are like the braces from besiege
I think you need to try Stormoworks: Build and Rescue.
Video game NileRed lol
Very
Raid Capitain overthinking everything
3 stage ballistic missile
GOATED UAGAGAGAGAGAGAGAGAGA
Make a real bomber next
13:37
thrust to weight
1:1
build something with an ejector seat
Have you tried to play Terratech
Why are there two towers at the end and why do you crashed in 🤨
Is this a Besiege 2?
P L A N E !
honestly you should try out people playground, i know you could create some crazy stuff there
Center of mass vs center of lift was bad
yep! more of this
Next make an anti material rifle
Good god.
Omg this is besiege
A nuke
Well, I don't see anything wrong with building this.
Please build a Gundum robot in besiege
create a ww2 fighter plane pls