Friday the 13th makes NO SENSE

Поделиться
HTML-код
  • Опубликовано: 17 окт 2024
  • Sorry about the auto focus, I don't know why it did that.
    None of these movies make any dang sense.
    Theme music generously donated by Intellectual Dark Wave:
    / @intellectualdarkwave

Комментарии • 642

  • @z-beeblebrox
    @z-beeblebrox 4 года назад +252

    Not gonna lie, Jason murdering Santa and then inadvertently becoming Santa a la "The Santa Clause" would be a movie a legitimately want to see

    • @jesusramirezromo2037
      @jesusramirezromo2037 4 года назад +6

      There is a fan-movie about that
      Santa murders santa, and becomes the new one

    • @fisheyenomiko
      @fisheyenomiko 3 года назад +12

      This Christmas, get ready for Ho Ho Homicide!

    • @kevincrady2831
      @kevincrady2831 2 года назад +3

      Weird Al already sang the theme song.

    • @TheWarrrenator
      @TheWarrrenator 2 года назад

      Murders naughty teens.

  • @Kutulhu
    @Kutulhu 4 года назад +405

    Jason is left home when his parents go on vacation to Europe. He ends up wrecking his dad's Jaguar and the only job he can get to make money for the repairs is... a camp councilor.

    • @morganalabeille5004
      @morganalabeille5004 4 года назад +7

      Holy shit

    • @LucianCorrvinus
      @LucianCorrvinus 3 года назад

      Never work, id never believe Jason could bag Rabecca Mornay....

    • @spacecadet9663
      @spacecadet9663 3 года назад +2

      God why does that sound like a south park joke? Like in my head I immediately heard "starring Rob Schneider" when I finished reading your comment.

    • @Jane-oz7pp
      @Jane-oz7pp 3 года назад

      @@spacecadet9663 "First he was The Animal, then he was The Hot Chick, now Rob Schneider is... The Stapler!" plays in my head at least once a day.

    • @Heathen-vy9em
      @Heathen-vy9em 3 года назад

      @@Jane-oz7pp "Rated Pee Gee Thirteen!"

  • @hannabelphaege3774
    @hannabelphaege3774 4 года назад +482

    Jason VS Muppets: Manhattan is a solid gold pitch.

    • @KevlarNinja
      @KevlarNinja 4 года назад +20

      Yeah, just have Jason be the only character not played by a Muppet. It'd be great. XD

    • @aarondelmer8581
      @aarondelmer8581 4 года назад +32

      @@KevlarNinja Or have Jason be the only muppet and all the Muppets are horrific cats style cgi monstrosities
      now that's a spook

    • @Aconitum_napellus
      @Aconitum_napellus 4 года назад +10

      @@aarondelmer8581 Genuinely disturbing.

    • @justincoleman3805
      @justincoleman3805 4 года назад +2

      I want at least a trailer cut from the two movies.

    • @koomori
      @koomori 4 года назад +4

      It needs a scene with Muppet Jason, and I don't care if it's just a throw away dream sequence.

  • @walbado
    @walbado 4 года назад +239

    See, that's why Jason is the perfect character. You can dump him in any situation and it would still make something entertaining. Exemple: Friday the 13th: Jason Goes to Ikea

    • @Napoleon.Blown.Aparte
      @Napoleon.Blown.Aparte 3 года назад +9

      🤣 whahahaah YES please!!
      tagline would be: "Jason goes shopping!"

    • @kevincrady2831
      @kevincrady2831 2 года назад +16

      As Jason lurches toward the teenagers with bloody knife in hand, they struggle to assemble a bookcase to block his path. "No, Tommy! Screw _2-A_ goes into hole C-1!"
      In the end, it turns out the Final Girl is really handy with a hex-wrench.

    • @bepisthescienceman4202
      @bepisthescienceman4202 2 года назад +9

      Friday the 29th: Jason goes to therapy

    • @Misora7303
      @Misora7303 2 года назад +4

      Jason Faboulous BEACH vacation

    • @Eamonshort1
      @Eamonshort1 2 года назад +5

      Oh my god, let's just remake all of the "Ernest goes too..." Films with Jason Voorhees

  • @luddlowvertakaclydecowley5905
    @luddlowvertakaclydecowley5905 4 года назад +408

    Don't worry everyone, the free market will always ensure that only the highest quality films will be produced.

    • @jesusramirezromo2037
      @jesusramirezromo2037 4 года назад +9

      To be fair, From unmade scripts; these movies turned out waaaay better than what they originally planned

    • @devforfun5618
      @devforfun5618 3 года назад +8

      @@jesusramirezromo2037 all moveis start as a bad script

    • @NeverBeenOnMaury
      @NeverBeenOnMaury 3 года назад +3

      You mean cocaine

    • @one_with_kevrything9825
      @one_with_kevrything9825 3 года назад +3

      Michael Bay makes sure of that.

  • @kweightthree
    @kweightthree 4 года назад +474

    Prequel to Friday the 13th is Thursday the 12th. Just saying.

    • @mattm.775
      @mattm.775 4 года назад +39

      They actually made a movie called Saturday the 14th. Wouldn't that technically be a sequel?

    • @sevatarlives185
      @sevatarlives185 4 года назад +33

      Friday the 6th pitch: Anthology film. Several otherwise unconnected people briefly mention that the following Friday will be the thirteenth of the month in different contexts. One says it's unlucky, one says something about astrology, one invites some friends over for a mini-Halloween spooky movie party. Everyone goes and has a nice time. Fin.

    • @aswiftshift5229
      @aswiftshift5229 3 года назад +4

      Its a character study of a young jason the day before he drowns and it explores the effects of childhood bullying and overbearing parents that are so obsessive it borders abuse

    • @unusualvideos8269
      @unusualvideos8269 2 года назад

      The trailer for it could be Wednesday the 11th

  • @FreeCatCheese
    @FreeCatCheese 4 года назад +148

    I've always entertained the notion that Jason is a Tulpa created by his mother's rage as she dies at the end of Part 1, which is why he's full grown by Part 2. Of course absolutely no one gave that a moment's thought, but it's a fun notion.

    • @CeeJayThe13th
      @CeeJayThe13th 3 года назад +9

      I like that idea.
      I stumbled on another theory that he's given his abilities by some mystical power of the lake and is doing its bidding.

    • @CeeJayThe13th
      @CeeJayThe13th 3 года назад +5

      @Creature Crosby a lot of that makes sense but the Tulpa idea that William brought up would explain it just as well as "ghost" and makes up for the discrepancy of a young Jason at the end of 1 and a grown Jason at the beginning of 2. The Tulpa just wasn't finished "forming" (or whatever) yet when it jumped out of the water.
      I think young Jason is a hallucination brought on by the stress of the events of the first film and adult Jason is where he somehow survived and was being hidden away by his mother because she's coocoo bananas. He doesn't become overtly supernatural really until part 6 anyway.

    • @scatman786
      @scatman786 2 года назад +7

      I’m personally more a fan of the urban legend/campfire story theory. Jason and the events of the movies are just stories being told and the inconsistencies/quirks are just reinterpretations by different storytellers.

    • @TheWarrrenator
      @TheWarrrenator 2 года назад

      Plausible. Or an agragore.

  • @jeremyewing7180
    @jeremyewing7180 4 года назад +288

    I have 0 interest in every seeing any Friday the 13th movies ever again and yet I would legitimately buy a opening day movie ticket for any of your Jason sequel pitches.

    • @makaveli4205
      @makaveli4205 4 года назад +4

      Joe Bob Briggs disagrees

    • @CeeJayThe13th
      @CeeJayThe13th 3 года назад +2

      Good news! Several of those ideas already exist.
      The found footage and the snow ones were fan films entitled Never Hike Alone and Never Hike In The Snow respectively.
      The one where Jason tries to train his son to be a murderer is a comedy skit and is available free on RUclips like the fan films mentioned above.
      The prequel where his dad is a murderer is the plot of a series of comic books.
      Probably a few more I missed.
      Also, check out Behind The Mask: The Rise Of Leslie Vernon and I Think I'm The Killer for some Jason Voorhees like horror comedy.

    • @FrancisR420
      @FrancisR420 Год назад +1

      @@CeeJayThe13th Mildred didn't pitch found footage or snow theme
      They pitched Jason needing to get laid before the end of summer or becoming Santa Claus

    • @CeeJayThe13th
      @CeeJayThe13th Год назад

      @@FrancisR420 bro idek what this was about. But I'm excited about Never Hike Alone and Never Hike In The Snow still lol

  • @GorgonautAnimation
    @GorgonautAnimation 4 года назад +266

    I've always liked the explanation given around the campfire (and again at the bar) in Part II that his mom thought he died, and that the stinger was a dream (they say as much in the hospital in Part I), but he actually washed up elsewhere and spent the next 2 decades as a feral child living in the woods surrounding Crystal Lake. I kinda love the idea of him learning to stalk animals to survive, learning how to navigate the woods in seemingly impossible ways, and then, after finally seeing his mom again after all those years (shadowing her from the woods, seemingly), and she starts killing people when they reopen the camp, and so, in his primal grief, he follows her lead and turns to killing people to keep them out of his 'territory/hunting grounds.'

    • @Brawnald
      @Brawnald 4 года назад +29

      THAT sounds like a solid movie.

    • @z-beeblebrox
      @z-beeblebrox 4 года назад +14

      That's kinda sorta how they played it in the remake, right?

    • @GorgonautAnimation
      @GorgonautAnimation 4 года назад +31

      @@z-beeblebrox Yeah, pretty much - it's kind of the only way to reconcile the two iconic story elements of the series ('mom's revenge for drowned kid' and 'hulking adult monster-man').

    • @pedrosaraiva
      @pedrosaraiva 4 года назад +1

      Ron Anderson x Fdd e ctgf rycorg

    • @d.m.collins1501
      @d.m.collins1501 4 года назад +18

      Can I hire you to write my resume? I need someone to explain why I was a QA Engineer for 12 years, then unemployed for the entire COVID-19 thing even though I could easily have worked from home, but now I'm the perfect candidate to be editor of a flashy pop culture magazine.

  • @catcatcatcatcatcatcatcatcatca
    @catcatcatcatcatcatcatcatcatca 4 года назад +212

    Don't you get it? Jason is merely an allegory for justifications media makes to fight imperialist wars.

    • @geoffreysorkin5774
      @geoffreysorkin5774 3 года назад +9

      This is Scaredy Cats. That’s the explanation for the Thought Slime video on this series.

  • @pushon10
    @pushon10 4 года назад +199

    If you really squint, ScaredyMatt looks a bit like Thought Slime hahaha original joke, go me woo!

    • @Marsyas01
      @Marsyas01 4 года назад +17

      What? No he doesn't! ThoughtSlime looks totally different! I can tell because I have seen many pixels in my time.

    • @joshhorley2116
      @joshhorley2116 4 года назад +14

      @@Marsyas01 you're right, Scardy matt doesn't look anything like thought slime. He does, however, closely resemble.our RUclips friend MindMuck

    • @Marsyas01
      @Marsyas01 4 года назад +7

      @@joshhorley2116
      I suppose. A little. Mostly around the eyes.

    • @travismcgrath6917
      @travismcgrath6917 4 года назад +7

      If you squint he's almost in focus

    • @bassman9261995
      @bassman9261995 4 года назад +5

      Thought Slime has more eyeballs

  • @RadicalReviewer
    @RadicalReviewer 4 года назад +60

    I noticed you didn't bring up his height changes but i find those funny. He goes from being an old lady to being like a 7ft. beast.

  • @sebbychou
    @sebbychou 4 года назад +132

    A Friday the 13th musical using Friday as the main song.

    • @occams_blazer
      @occams_blazer 4 года назад +14

      oh you sadist

    • @QuikVidGuy
      @QuikVidGuy 4 года назад +7

      @@mezzb at one point in the middle of the action, the victims sing "hunted down on Friday," and the Final Girl moment is "Standing up on Friday"

    • @justincoleman3805
      @justincoleman3805 4 года назад +6

      Starring actual cannibal Shia LeBeouf.

    • @anthonyweber1759
      @anthonyweber1759 4 года назад +5

      Camp Crystal Lake reopens as a music camp. With Rebecca Black as one of the camp counselors.

    • @LucianCorrvinus
      @LucianCorrvinus 3 года назад +1

      If I wanted to watch a massacre with bad effects...I'd Netflix Cats....

  • @sterlingdragon123
    @sterlingdragon123 4 года назад +18

    January 7th: "I have some kind of stomach cold or chest flu"
    .............

  • @saltyjustice4444
    @saltyjustice4444 4 года назад +64

    Ah my favourite channel, Blurry Cats, hosted by Blurry Matt!

    • @Backlashed
      @Backlashed 3 года назад +4

      he's not blurry, he just has a cold.

  • @michaelcoutts9470
    @michaelcoutts9470 4 года назад +68

    I'd like to see you breakdown the hellraiser franchise like this

  • @shytendeakatamanoir9740
    @shytendeakatamanoir9740 4 года назад +38

    Well, tomberries are just little dude with knives, and they are really scary.
    So, my point is that they should have Jason as an optional boss battle in the FF7 Remake.

    • @Dragonatrix
      @Dragonatrix 4 года назад +7

      ...Jason is already a party member in FF7

    • @Devilot109
      @Devilot109 4 года назад +1

      @@Dragonatrix Oh my god that's actually basically true.

  • @railguncat7751
    @railguncat7751 4 года назад +14

    You left out the part where Jason is secretly related to the Evil Dead Franchise.
    This was a very good video, thank you.

  • @BlindArcher
    @BlindArcher 4 года назад +48

    They make no sense, most of them are objectively terrible as films, and most of the people making them had obvious contempt for them during production, BUT.... I still love almost all of them.

    • @UnwrittenSpade
      @UnwrittenSpade 3 года назад +1

      Hell yeah I love them too! Freddy v Jason and Jason x are a blast

    • @brandonspain12345
      @brandonspain12345 2 года назад +1

      Except Jason Goes to Hell.

  • @thefollowingisatest4579
    @thefollowingisatest4579 4 года назад +15

    Literally every movie you pitch at the end is solid gold and I would buy the VHS.

  • @golgarisoul
    @golgarisoul 4 года назад +10

    7:12 im setting this bookmark so that whenever i get the notification that someone gave this post a thumbs up, i can laugh my ass off to that explanation for the Friday the 13 the tv series. Thanks, slime, for giving me a rare ray of joy in these dark times.

  • @cousinted
    @cousinted 4 года назад +9

    Tommy's plan in the fourth movie is obvious and makes perfect sense: He disguised himself as young Jason to trick Jason into thinking either he had time-traveled back to when he was still a boy or that his younger self had time-traveled to the future. Either way, it worked because Jason knew that if he killed his past self it would cause a time paradox that would cause him to fade away like Marty McFly in Back to the Future (Which everyone knows is Jason's favorite movie). See, simple and totally intuitive!

  • @xdissonance8
    @xdissonance8 4 года назад +41

    I really want to see Santa jason

    • @13gallowslane10
      @13gallowslane10 4 года назад

      Visit our Instagram then lol @13GallowsLane

  • @PhilipReadArt
    @PhilipReadArt 4 года назад +29

    This is legit the best channel covering this kind of content, by a mile!

  • @joearnold6881
    @joearnold6881 4 года назад +21

    Jason Voorhees’ Day Off

  • @spacecadet9663
    @spacecadet9663 3 года назад +6

    At 3:05 you mentioned a scene from Friday the 13th part 3 where a prop comic tried to scare someone while wearing a hockey mask, and I wanted to add some context for why the people who wrote the script probably put that scene in there. If I remember correctly back during the eighties in New York City there was a string of vigilante murders in the subway system by a guy who was wearing a hockey mask. They eventually caught the guy but that's kinda why certain characters from eighties pop culture would wear one to be intimidating. It's honestly the same reason why Casey Jones wears one in the old live action Teenage mutant ninja turtles movies from around the same time, they even joke in the first TMNT movie that Raphael might be the Subway Vigilante at one point.

  • @niteowl9491
    @niteowl9491 4 года назад +9

    Bride of Jason: The Musical, on Ice!

  • @dronesaur4328
    @dronesaur4328 4 года назад +11

    I actually like the later Ft13 movies more. The first several were kinda just standard, middling slasher films. In later sequels, the just embrace the campiness.

  • @timcirulis5273
    @timcirulis5273 4 года назад +11

    The way to look at the "Friday the 13th" film series is like this. One is a standalone film, then you have three overlapping trilogies.
    1. Live stalker Jason trilogy 2-4
    2. Tommy Jarvis trilogy 4-6
    3. Undead/unstoppable Jason trilogy 6-8
    I would argue nothing after 8 is Friday the 13th canon.

    • @scatman786
      @scatman786 2 года назад

      9 & Jason vs Freddy are a shared continuity and Jason X is probably semi canon taking place after 9 and JVF since the military killed Jason at the start of 9 and later capture him X.

    • @timcirulis5273
      @timcirulis5273 2 года назад

      @@scatman786 Don't get me wrong, they are Jason films but they are not Friday the 13th films. After JTM (8) there is no longer an attempt to connect the films. Even 5 left the fate of Jason some what ambiguous, the mayor says he was cremated but the sheriff cast doubt on this making the events of Jason's zombification in 6 plausible, in this universe. JGTH (9) just brings Jason back to Crystal Lake with no explanation visa vie not connection outside of Jason himself to the other films. After 8 they are Jason films but they are no longer Friday the 13th films thus not cannon to Friday. That got longer then I meant it too lol.

    • @scatman786
      @scatman786 2 года назад

      @@timcirulis5273 I wasn’t saying that they’re canon to the main series but that 9,JVF & arguably X were in a shared continuity.

    • @brandonspain12345
      @brandonspain12345 2 года назад +2

      Even Adam Marcus said when making JGTH, that they wanted to ignore bits of Part 3 - Part 8 since the last movie underperform at the box office. Confirming the New Line films are in their own timeline.

  • @rhyderrek6155
    @rhyderrek6155 4 года назад +31

    I would unironically watch Friday the 13th: the Musical.

    • @eterlinblue99
      @eterlinblue99 4 года назад

      Combine both of the first two ideas: A Camp Crystal Lake Jason in Camelot, The Musical
      (Connecticut Yankee in King Arthur's Court meets the Camelot musical, all mushed together- because at this point why the hell not?!)

    • @Matthew_Raymond
      @Matthew_Raymond 4 года назад +6

      🎵Put that machete back where it came from or so help me...🎵

    • @TheMogul23
      @TheMogul23 3 года назад +2

      As long as the main theme is Alice Cooper's The Man Behind The Mask then I'm 100% there.

  • @stm7810
    @stm7810 4 года назад +8

    The Friday the 13th cinematic multiverse.

  • @kevincrady2831
    @kevincrady2831 4 года назад +25

    So maybe they're all...uh...taking place in parallel universes, so they're not happening in sequence, but side-by-side? I dunno, the only place the movies make sense is in the studio's bank account. :)

    • @scatman786
      @scatman786 2 года назад +1

      There’s a theory that each of the movies are actually just campfire stories/urban legends being told by different eras and groups of people.

    • @morganalabeille5004
      @morganalabeille5004 2 года назад

      These movies take place in the same continuity as the James Bond films

    • @morganalabeille5004
      @morganalabeille5004 2 года назад +1

      “Wow this reminds me of the time I went to space back when I was the same guy”
      - James Bond and also Jason Voorhees

    • @kevincrady2831
      @kevincrady2831 2 года назад

      @@morganalabeille5004 James Bond! Jason Vorhees! FIGHT!

  • @chrisbcpack
    @chrisbcpack 4 года назад +12

    the first movie i ever saw of the jason franchise was jason x & i remember being so confused but lowkey loving it for how off the chain and nonsensical it was

  • @cBe9999
    @cBe9999 3 года назад +2

    Other ideas:
    Jason vs Jason Segel
    Jason is going back to Manhattan - he has a car ride with Meg Ryan and they hate each other (for now). They meet again 5 years later and sparks begin to fly...
    Now a media mogul, old Jason dies alone in his huge mansion. A lone servant overhears his final words 'Crystal Lake'. The race is on to find out the truth behind the man the world knows as "Charles Foster Voorhees" - the entire FT13 series is his backstory, leading to his rise to power.

  • @user-vn7ce5ig1z
    @user-vn7ce5ig1z 4 года назад +7

    6:28 - You skipped over _why/how_ Jason comes back. Tina misses her abusive father, so she uses her telekinetic powers to try to bring him back from the lake (and ostensibly also resurrect him), but brings Jason out instead.
    7:30 - _F13 The Series_ was still entertaining. (The _Nightmare on Elm St_ show was an anthology show hosted by Freddy.)
    7:48 - I still don't understand how the boat got from a _lake_ to NYC. 😕
    8:00 - The tall chef in the diner that Jason throws was played by Ken Kirzinger who later played Jason in _Freddy vs. Jason._
    11:16 - You need _Nightmare 6_ and _F13 9_ for the supernatural worms that made them both unstoppable killing machines.
    12:53 - I once read an early draft for _F vs. J_ that was actually pretty good. I waited several years until it finally came out, and was massively disappointed. The old treatment I read connected them in the past, included back-story of Jason's parents and something about Freddy doing something to Jason when he was a kid. The epic fight at the mall was interesting though and I really wanted to see them implement that. :-|
    • The _Friday the 13th_ movies are kind of absurd and inconsistent, sure, but they do follow a fairly linear timeline. It's like the _Evil Dead_ movies, in that they keep changing things, but still follow a straight line for the most part.

  • @Tartra511
    @Tartra511 2 года назад +2

    I totally didn't realize how many Friday the 13th/Jason movies there were. I was halfway thinking that maybe Jason in Space was some type of fever dream I had because it makes no sense.

  • @askewman37
    @askewman37 4 года назад +24

    Not gonna lie, I would probably enjoy the hell out of all those ideas at the end.
    On an actual serious note, I’d be interested in a video with your thoughts on Halloween 2018. You seemed to have some opinions waiting to be voiced on that one

  • @Dragonatrix
    @Dragonatrix 4 года назад +9

    okay but jason going back in time to fight the knights of the round table is such a cool idea????????

  • @nateblack8669
    @nateblack8669 4 года назад +5

    I'll always love 2, 3, 4 and 7 but that doesn't mean I don't acknowledge how genuinely terrible they are.

  • @MiSTSYL
    @MiSTSYL 4 года назад +14

    My favourite two are 5 & 6.
    I like 5 because it's blatantly trying to ground itself and is also mean as fuck. Shame the studio decided to nix the Tommy is the new killer angle because audiences apparently wanted Jason.
    I unabashedly love 6. Yes it makes no sense in the context of previous films and has a ridiculous set up...but it knows it's ridiculous; there's a lot of meta humour in there and it's a great precursor to the likes of New Nightmare and Scream.

    • @VasManHorrorLivesMatter
      @VasManHorrorLivesMatter 4 года назад +7

      Jason Lives for the win👍

    • @thedestroyer2alltrolls411
      @thedestroyer2alltrolls411 2 года назад

      Part 5 was absolute garbage! Stupid Roy impersonating Jason was the dumbest thing ever. Part 6 and 7 should be your favorites, especially 6.

  • @maxmfpayne
    @maxmfpayne 11 месяцев назад

    I'm sick today too. I find whenever I'm sick or feeling shitty, like today, i always come back to watch a bunch of these videos. It's like comfort food to me, hearing you talk about cheesy horror movies i personally probably wouldn't enjoy as much as you do is just nice. Your passion for the genre and especially wet puppets is so genuine, and generally it's just a good vibe. This is the chicken noodle soup of RUclips content to me.

  • @camazettz
    @camazettz 4 года назад +3

    If you look closely in part 2, you can see Jason is swinging his machete backwards

  • @liamshanley4920
    @liamshanley4920 4 года назад +15

    4:10 Hannibal Buress: Why are you ME? I’m ME!

  • @ironiconion
    @ironiconion 4 года назад +3

    you didnt mention the ridiculous timeline where part 3 happens immediately after the events of part 2 and part 4 happens immediately after the events of part 3, but jasons killing spree somehow become folkloric legend.
    the way each film seems to be both be made up out of whole cloth while also paying lipservice to strict continuity is actually big reason i love the series. i love that its completely contradictory but doesnt even try to explain it. i love that by part 4 the film makers seem to be making sequel to the idea of friday the 13th in popular culture more than any previous film. i love that part 7 is just carrie vs jason and also that jason's body has tons of marks of continuity, including all the scars hes gotten from his past deaths and major injuries. while my ability to watch the films wanes after part 7, i love how wild the conclusion to part 8 is

  • @davidbollen2182
    @davidbollen2182 4 года назад +2

    I love your opening sentence! The rhyme always makes me chuckle. Hope you get well soon! :)

  • @linasayshush
    @linasayshush 3 года назад +1

    I like that you say they "threatened" to make a shitload of Friday the 13th movies

  • @CormacMor
    @CormacMor 8 месяцев назад +2

    Bride of Jason?
    No, my friend.
    Briday the 13th.

  • @themoviebaker
    @themoviebaker 2 года назад +1

    I thought the auto-focus was intentional because it doesn't have much continuity just like the F13 movies.
    Great video, btw.

  • @ediapaff8858
    @ediapaff8858 4 года назад +2

    I know all of these pitches in the end are jokes, BUT they all sound amazing

  • @CandyPawz
    @CandyPawz 4 года назад +3

    I didn't recognize this channel in my recommended so I was curious and was delighted to see it was you^^ Def subscribing :3

  • @stinkiesttwink
    @stinkiesttwink 4 года назад +4

    friday the 13th: jason learns to cook
    friday the 13th: jason goes to europe
    friday the 13th: jason runs for president
    friday the 13th: jason becomes a rockstar

    • @LucianCorrvinus
      @LucianCorrvinus 3 года назад

      Friday the 13th: Jason, Behind the Music...or Cribs can't decide...

  • @BrowncoatFairy
    @BrowncoatFairy 3 года назад +1

    "Tommy's not a Jason anymore, he's chill again. and he DIGS UP JASON'S BODY FOR SOME REASON" you know, like chill people do.

  • @chrissmith6097
    @chrissmith6097 Год назад

    I love all your ideas for Jason movies. Now I have to do some soul searching because I might be a legitimately terrible person for wanting to see Jason vs the muppets vs knights of the round table.

  • @robinjunior7331
    @robinjunior7331 3 года назад

    You're subtle sarcasm is awesome, great video bro, 10/10 for info and details

  • @wyndgrove9452
    @wyndgrove9452 4 года назад +1

    Boy, Jason really is a multiverse knife guy.

  • @WhatRobodoom
    @WhatRobodoom 4 года назад

    i genuinely unironically love all the pitches you threw at the end here. firday the 13th: the musical sounds like total honest gold

  • @morganalabeille5004
    @morganalabeille5004 4 года назад +1

    My image of Jason is entirely shaped by Worthikids' "Jason and Friends." I just see him as a responsible dad who speaks in sign language and takes his kids on roadtrips and refuses to buy alcohol for his son Freddy Kruger but will buy a muffin for his daughter Samara from The Ring.

    • @morganalabeille5004
      @morganalabeille5004 2 года назад

      Samara is his daughter because he’s married to Sadako, who adopted her.

  • @illi-the-wolf
    @illi-the-wolf 4 года назад

    This seriously had me cackling with all your descriptions. What a fun video!

  • @emriesq3096
    @emriesq3096 3 года назад

    You mentioned you were sick with a mysterious cold or something...... checks date. The Rona! Glad you're ok and still making cool videos

  • @dormagio
    @dormagio 3 года назад

    I want to watch every single one of those Friday XIII movies you pitched.

  • @lord_lilith
    @lord_lilith 4 года назад +9

    Thank you for giving me the spark notes for a movie franchise I have managed to avoid seeing all of my life and will continue to avoid seeing. I am willing to reconsider changing this mindset in return for free tickets to Freddy vs. Jason vs. Tomie: Going Hawaiian in IMAX.

    • @aswiftshift5229
      @aswiftshift5229 4 года назад +2

      Why do you refuse to watch any of the films?

    • @lord_lilith
      @lord_lilith 4 года назад +2

      @@aswiftshift5229 Movie slashers killed my uncle

    • @jesusramirezromo2037
      @jesusramirezromo2037 4 года назад

      @@lord_lilith How?

    • @lord_lilith
      @lord_lilith 4 года назад +1

      @@jesusramirezromo2037 big knife

    • @thedestroyer2alltrolls411
      @thedestroyer2alltrolls411 2 года назад +1

      @@lord_lilith 🤦‍♂️ Aw! You rightfully hate them, but for the wrong reason.

  • @jettisoncargo
    @jettisoncargo 4 года назад +3

    I'm here for "Jason Takes Christmas"

  • @Sims_E
    @Sims_E 4 года назад

    Haha, I love your ideas for the future F13th movies! :)) (And I am afraid some just might be made someday)

  • @johnnydsnarkangel
    @johnnydsnarkangel 4 года назад +1

    Every single one of those alternative pitches would be better than just another Jason movie.

  • @laurenwasinger9436
    @laurenwasinger9436 3 года назад

    I would watch every single idea you pitched. Every. Single. One.

  • @mattblissett1966
    @mattblissett1966 3 года назад

    I have been watching your videos. They are great, warm, engaging and in this one, the phrase 'for some reason' is delivered with the same withering contempt as this series deserves.

  • @miketate3445
    @miketate3445 3 года назад

    I need to see all of your hypothetical Friday sequels. Now.

  • @ntfilmsllc6277
    @ntfilmsllc6277 4 года назад +29

    If you click on a new video so fast that the page says "no views" when you get there, does that mean you win the lottery?

  • @bronxbl0gr
    @bronxbl0gr 4 года назад +2

    Why did Cronenberg not direct "Jason X"? Can you imagine?!

  • @spider-manunknown9193
    @spider-manunknown9193 2 года назад +3

    All the Friday the 13th movies are canon in the end from part 1 to Jason X and even all 6 nightmare movies are canon despite the continuity’s it’s all canon.

  • @maxmfpayne
    @maxmfpayne 3 года назад

    For the record, I would absolutely watch every single one of your suggestions. Gold, pure fucking gold. Honestly, if I ever for whatever reason one day become a film maker, can I please have permission to use all of your ideas in a reboot series? I would have so much fun making this absolute garbage.

  • @daved2352
    @daved2352 4 года назад

    I unironically want all of your Jason movie pitches to be made.

  • @Xalimata
    @Xalimata 4 года назад +4

    This almost makes me want to watch the series.

  • @escher10000
    @escher10000 4 года назад +2

    Jason Saves Christmas needs to happen.

  • @thejamjarastronaut
    @thejamjarastronaut 4 года назад

    Matt is now in charge of the extended Jason cinematic multiverse

  • @Idonotsa49
    @Idonotsa49 4 года назад

    Every one of your sequel ideas would legitimately be amazing

  • @chriscze6153
    @chriscze6153 4 года назад +2

    the image of jason fighting miss piggy for manhattan i live

  • @kingmj87
    @kingmj87 2 года назад +2

    Camp Crystal Lake (also known as Camp Blood) is located on Crystal Lake, which the Native Americans who once resided in that area knew as "the Blood Lake," a sort of watery Pet Sematery wherein one could resurrect the dead, but only with enough fresh human sacrifices. Pamela Voorhees was murdering counselors in an attempt to resurrect her son, Jason, but in the end, the last sacrifice was herself. The film ends with a mystical vision of the zombie child rising from the lake. In Part 2, Jason has Pamela's head and sweater on an altar because he is now trying to do the same: to resurrect his mother through human sacrifices (there are various animal sacrifices strung up around the cabin, showing that these attempts failed). As is typically the case with human sacrifices, VIRGIN sacrifices are the most powerful, which is why the final girls are usually the most virginal members of the group, and the last thing that Jason needs to finally resurrect his mother. In Part 7, the chick with magic Carrie powers is drawn to Crystal Lake because of its ancient demonic energy, and at the end, the number of sacrifices committed to the lake actually resurrects her own father, who (spoilers) drags Jason down to a watery grave. Also, this is why Roy was murdering random kids after his mentally challenged son died: he was trying to resurrect him in the mystical evil waters of Crystal Lake.
    Literally all of this is headcanon. Sorry. But at least it makes sense. You're welcome.

  • @jordan11752
    @jordan11752 3 года назад

    I would watch a whole video of Friday the 13th screenplay suggestions

  • @alanamontero4743
    @alanamontero4743 4 года назад +1

    One of my teenage friends and I used to like watching Friday the 13th movies and pointing out all the wrong things and making fun of them. Good times.

  • @hitoshura2800
    @hitoshura2800 4 года назад

    Matt, every single one of your movie pitches is something I would pay money to see...and I am disappointed in myself for it 😔

  • @TimmyGsStuffAndStuff
    @TimmyGsStuffAndStuff 4 года назад

    I can help!!! Continuity is actually fair through the first 5 movies, and most people miss this. But, it's implied through the campfire story and bar discussion in part 2 that Jason escaped the drowning and survived in the woods hunting small animals. Then after witnessing his mothers beheading began hunting campers as revenge. That's not the only narrative that was abandoned beginning with Jason Lives either, because after being dismembered by Tommy in The Final Chapter, the sheriff mentions in The New Beginning that Jason was cremated, yet he's a full corpse when Tommy digs him up in the beginning of Jason Lives lol. Great video my dude!!!

  • @Matt-mq6ws
    @Matt-mq6ws 4 года назад +3

    Ok, but hear me out: Jason was in Mortal Kombat X, Kratos was in Mortal Kombat 9 and Soul Calibur 6. Darth Vader and Yoda are in Soul Calibur 4 and Luke, C-3P0, and R2-D2 were all on the Muppet Show, so Jason vs the Muppets is a canonical possiblity.

  • @42071
    @42071 3 года назад +1

    Jan 7th, 2020. starts with "I'm sick" with some mystery disease. hmmmmm

  • @efkastner
    @efkastner 3 года назад +1

    The prequel should be called, “Thursday, the 12th”

  • @evanholt1752
    @evanholt1752 4 года назад

    7:13 “Did you just Vader me?!” “Have fun chatting shit about me in therapy now!”

  • @joselaplacaamigo6400
    @joselaplacaamigo6400 3 года назад +1

    It was a good video from the start but you killed me at the end 🤣

  • @justicebeske5704
    @justicebeske5704 3 года назад

    Hollywood should really listen to some of your ideas at the end. We Stan medieval Jason

  • @theonlykoh4631
    @theonlykoh4631 11 месяцев назад

    I find myself coming back to watch this video like 3x a month.

  • @Initiallyleo
    @Initiallyleo 2 месяца назад

    Being a real estate agent selling properties near Camp Crystal Lake must be EXHAUSTING

  • @gabrielgray83
    @gabrielgray83 2 года назад +2

    You should examine the ramifications of the theory that Jason and Evil Dead are in the same universe and whether or not that would fix a lot of these inconsistencies.

  • @channelname1019
    @channelname1019 4 года назад

    For my part, I would absolutely watch the shit out of the films you sarcastically suggested at the end.

  • @TheLokiBiz
    @TheLokiBiz 4 года назад +2

    Also - to be fair, Halloween also did the whole "kid that was running from the killer is gonna be the new killer now" gimmick, only to completely forget it by the next sequel too - Really, no great 80s horror movie franchise is without glaring plot holes - I mean, why did Freddy suddenly possess a young man in part 2, and then use him to enter the real world only never to try that again in the next 8 movies?

  • @ZillMob
    @ZillMob 2 года назад +2

    Chest cold in January 2020 nothing to worry about

  • @dl-zf9dj
    @dl-zf9dj 3 года назад

    i would legit watch all of your fri the 13th pitches

  • @consentclub614
    @consentclub614 2 года назад

    I love that the entire premise of this series is "this guy is kinda ugly. THAT'S SCARY"

  • @pedantsunited5368
    @pedantsunited5368 3 года назад +1

    god I'm so glad someone else thought part 1 was boring. I thought I just "didn't get it"

  • @mrpieceofwork
    @mrpieceofwork 3 года назад

    * notices the date as the video starts to play, thinks it's fun to peruse videos made JUST BEFORE everything went to shit... hears Mildread say they were SICK... wonders... *

  • @caucasoidape8838
    @caucasoidape8838 3 года назад +2

    I loved Friday the 13: The series. I wish it had been named something else though.

  • @theomcinturff1213
    @theomcinturff1213 3 года назад +1

    I would actually fucking love a "Son of Jason" movie where Jason is paranoid that his son is gonna drown at Summer Camp.