Sir..... when I submit data in RNA Composer (i.e) results of RNA secondary structure obtained from UNAfold web server, it shows task description excepted and sequence limitations. even though I have submitted 130 residues. how to overcome this problem, sir.
RNAComposer allows to work on one RNA molecule of interest at a time; its use is limited upto 500 residues. The input must be in prescribed format, example bellow: >example1 GCUCCUAGAAAGGCGCGGGCCGAGGUACCAAGGCAGCGUGUGGAGC (((((.......((((..(((..........))).))))..))))) Here 'example1' is the task description which begins with the greater-than symbol '>'. Next line is the RNA sequence and third line is the bracket-notations (obtained from the UNAfold web server).
RNA structure prediction algorithms are recursive and high resource-consuming. So, all RNA structure prediction tools have query sequence limitations. You can split your RNA sequence according to the limitations. There are no other options.
thanku sir for this information but i have one question can we pridict the 3d structure of any gene which is not submitted yet on ncbi also it is partial
RNAComposer is an automated 3D structure modelling tool for RNA sequence. So, it is only depend on machine learning algorithm and the available dataset in the RNAComposer server. It does not depend on NCBI database.
@@AKBIT thank you, Sir. I want to ask again something, can u suggest to me what tools or server for docking small molecule bioactive compound with RNA? Because i'm already use autodock vina in PyRx but the process always error
How do I deal with two RNA chains which are complementary in some part? For example a target RNA sequence and a guide RNA that attracts a nuclease? Thanks for the video btw
Thx for the video its useful and explanatory !!!
You are welcome!
thank you for the video, it helps me a lot
Happy to hear. Thanks for your feedback ☺️
Thakyouu sir🙏🏻
Sir..... when I submit data in RNA Composer (i.e) results of RNA secondary structure obtained from UNAfold web server, it shows task description excepted and sequence limitations. even though I have submitted 130 residues. how to overcome this problem, sir.
RNAComposer allows to work on one RNA molecule of interest at a time; its use is limited upto 500 residues. The input must be in prescribed format, example bellow:
>example1
GCUCCUAGAAAGGCGCGGGCCGAGGUACCAAGGCAGCGUGUGGAGC
(((((.......((((..(((..........))).))))..)))))
Here 'example1' is the task description which begins with the greater-than symbol '>'. Next line is the RNA sequence and third line is the bracket-notations (obtained from the UNAfold web server).
@@AKBIT Thank you sir.
Hello sir, how to deal with the RNA sequences that are greater than 500 nucleotide bases??
RNA structure prediction algorithms are recursive and high resource-consuming. So, all RNA structure prediction tools have query sequence limitations. You can split your RNA sequence according to the limitations. There are no other options.
thanku sir for this information but i have one question can we pridict the 3d structure of any gene which is not submitted yet on ncbi also it is partial
RNAComposer is an automated 3D structure modelling tool for RNA sequence. So, it is only depend on machine learning algorithm and the available dataset in the RNAComposer server. It does not depend on NCBI database.
Hello sir, can we get 3D structure from this tools but we use miRNA sequence?
Yes. You can predict 3D structure of a RNA sequence.
@@AKBIT thank you, Sir. I want to ask again something, can u suggest to me what tools or server for docking small molecule bioactive compound with RNA? Because i'm already use autodock vina in PyRx but the process always error
@@victorhose2486 You can try the same AutoDock tool with another approach. Watch this video tutorial ruclips.net/video/TR8vUmAjhz8/видео.html
How do I deal with two RNA chains which are complementary in some part? For example a target RNA sequence and a guide RNA that attracts a nuclease? Thanks for the video btw
Predicting two RNA chains is not possible. Instead, you can concatenate both sequences and try. But, I am not sure about the result which you expect.
@@AKBIT How to concatenate them? I have another question: is there a tool to do template modelling for RNA?
By template modelling I mean homology modelling
@@MK-it7jm For example, seq1 = AUGC and seq2 = UAUA, then the concatenated sequence will be AUGCUAUA
@@MK-it7jm Basically the tool mentioned in this tutorial also do the same. I mean automated homology modelling.