How Donkey Kong made Melee history

Поделиться
HTML-код
  • Опубликовано: 3 фев 2025

Комментарии • 281

  • @turndownforwalt
    @turndownforwalt  5 месяцев назад +57

    Thank you INTO THE AM for these Elevated Everyday Graphic Tees! Get yours now and get 10% off site-wide when you click the link below: intotheam.com/WALT

    • @RobSomeone
      @RobSomeone 5 месяцев назад +1

      3:50 How have you not broken 100k yet? I don't even play Melee, I just love these stories you tell.

    • @billwoods7578
      @billwoods7578 5 месяцев назад

      Please never let Jorge commentate again.

  • @arJunebugSmash
    @arJunebugSmash 5 месяцев назад +798

    bit at the end was v sweet walt

    • @4sfield527
      @4sfield527 5 месяцев назад +22

      I've been watching you since like 2014 at Xanadu's in PM, and it's wild to see you go from PM God, to being a melee commentator mostly, to being a melee champion, and standing on a podium with the best players in the world.
      Good shit, man!

    • @DarkAuraLord
      @DarkAuraLord 5 месяцев назад +5

      @@4sfield527 same here dude. Now we just need Sethlon to show out with Roy. Watching him play PM Roy was my favorite thing, dude was an absolute menace.

    • @fendour_
      @fendour_ 5 месяцев назад +2

      Junebug twitch stream possibility?

    • @kevinmartin9674
      @kevinmartin9674 5 месяцев назад +8

      player of the year

    • @SwordMaster3000
      @SwordMaster3000 5 месяцев назад +3

      I so badly want to see a dk major tournament win it is unreal but at least you got 3rd place and there is always the next one

  • @ellachino4799
    @ellachino4799 5 месяцев назад +810

    rapp snitches with a dk sound fount goes unbelievably hard

    • @BrayDONee0
      @BrayDONee0 5 месяцев назад +7

      For real. Need that released asap!

    • @Sweetpeeb02
      @Sweetpeeb02 5 месяцев назад

      @@BrayDONee0just search up rapp snitch knishes donkey Kong and it’ll pop up by fxsnowy

    • @ellachino4799
      @ellachino4799 5 месяцев назад +33

      @@BrayDONee0 i just put "rapp snitches with a dk sound fount" into youtube and it popped up

    • @Timberwolfee
      @Timberwolfee 5 месяцев назад +2

      Sure does!

    • @robertgonzalez7562
      @robertgonzalez7562 5 месяцев назад +1

      Glad someone else noticed. 🔥

  • @Darksilver740
    @Darksilver740 5 месяцев назад +250

    The ending to Cody 3-0 over June was just unreal.
    Cody, the WINNER, walks off stage after the game yet Junebug, the LOSER(still 3rd place) has the whole crowd on his back as he basks in the glory of the Bronze medal.
    I have never seen an interaction like this before

    • @DarkAuraLord
      @DarkAuraLord 5 месяцев назад +14

      Melee is sick.

    • @plutigvid
      @plutigvid 5 месяцев назад +33

      Cody was pissed about it too. There's a clip of him looking at the camera looking all mad and saying something right after Junebug gets the medal

    • @Extracredittttt
      @Extracredittttt 5 месяцев назад +3

      Reminded me a lot of Abate beating S2J and then getting wiped by Mango. I love Junebug!

    • @HawaiiPart
      @HawaiiPart 5 месяцев назад

      @@plutigvidCan you send me a link? Idk where to find it

    • @friesfromsc
      @friesfromsc 5 месяцев назад +7

      @@plutigvidhe extremely obviously mouthed that he was going to the restroom, probably to the staff on stage

  • @ALloydRH
    @ALloydRH 5 месяцев назад +300

    Worth acknowledging Junebug actually took a game off Mang0 with that DK.

    • @ericwolf9664
      @ericwolf9664 5 месяцев назад +37

      From what I saw on the replays, he easily could have taken it to 5 if he didn't have the self kills.

    • @KyokujiFGC
      @KyokujiFGC 5 месяцев назад +54

      @@ericwolf9664 Yeah, the SDs really shook his confidence, I think. He wasn't moving the same way afterwards. I think he was also feeling some fatigue at that point in the tournament. He was doing a lot of desperation grab out of shield that kept getting jumped punished.

    • @krusher181
      @krusher181 5 месяцев назад +21

      @@KyokujiFGCyeah he was playing for so long he prob isn’t used to it. Mango is very used to playing deep into super majors with a big crowd.
      One game was impressive imo. Way mango is playing recently… most players can’t win a game against him let alone a set

    • @nickrulez809765
      @nickrulez809765 5 месяцев назад

      I think there is a reasonable chance he would have won if he hadn't had that SD.

    • @kupaxykalee4454
      @kupaxykalee4454 5 месяцев назад +1

      (on fd)

  • @orange567_
    @orange567_ 5 месяцев назад +95

    The year is 20DK. Donkey Kong is now officially the best character in Melee. Every Fox mains have dropped Fox in favor for DK. The DKs have maximized their punish game, and matches are decided by who can get the first grab. Jmook is the only non-DK player left.

    • @jackwilliams1468
      @jackwilliams1468 5 месяцев назад +5

      The year is 20DK Donkey Kong is now officially the best character in Melee. Every Fox mains have dropped Fox in favor for DK The DKs have maximized their punish game, and matches are decided by who can get the first grab Jmook is the only non-DK player left.

    • @riboiman4005
      @riboiman4005 5 месяцев назад +4

      .tfel reyalp KD-non ylno eht si koomJ .barg tsrif eht teg nac ohw yb dediced era sehctam dna ,emag hsinup rieht dezimixam evah sKD ehT .KD rof rovaf ni xoF deppord evah sniam xoF yrevE .eeleM ni retcarahc tseb eht yllaiciffo won si gnoK yeknoD .KD02 si raey ehT

  • @WeAreRisenzUPS
    @WeAreRisenzUPS 5 месяцев назад +326

    THE KONGQUEST CONTINUES!!! WE MID TIERS WILL KONGQUER THIS GAME BIT BY BIT!

    • @anitabath8315
      @anitabath8315 5 месяцев назад +19

      The rise kongmunism

    • @lilzpotato846
      @lilzpotato846 5 месяцев назад

      @A_Person_64i was i a north jersey tourney last weekend and I was beating this guys fox, he picked zelda and fucking SMOKED me 😂

    • @fractal_aura
      @fractal_aura 5 месяцев назад

      Eggdog invitational was so wild. Junebug played out of his mind

  • @MNTNPG
    @MNTNPG 5 месяцев назад +77

    By the way, the “Junebug-Quang inversion effect” isn’t exclusive to this moment and is an observable phenomenon that Cody once talked about on stream before. He said that, whenever he plays Amsa in bracket, he doesn’t practice with other Yoshis because he actually does worse against Amsa every time he’s done so, for some inexplicable reason. Weird stuff for sure

    • @nahometesfay1112
      @nahometesfay1112 5 месяцев назад +13

      Probably because they play so differently

  • @TheXell
    @TheXell 5 месяцев назад +190

    The Dong expands further.

  • @louiederpman7113
    @louiederpman7113 5 месяцев назад +50

    As mang0 himself has said and been repeated many times: "There is still so much melee left to be played". That last little section really reminded me of that

  • @snipermoose2580
    @snipermoose2580 5 месяцев назад +61

    You love watching a player like Junebug succeed. All the effort he put into a lower tier character is paying off. Especially how happy he was to put on a good performance in front of family and friends in his home town. Junebug is the GOAT, and amazing video Walt

  • @Fattyb00batty
    @Fattyb00batty 5 месяцев назад +53

    Joshmans reaction to getting socked is priceless

    • @DarkAuraLord
      @DarkAuraLord 5 месяцев назад +10

      seriously, I rewound that part like 3 times 😂bro was FLABBERGASTED 💀

  • @herobrineharry7698
    @herobrineharry7698 5 месяцев назад +31

    He IS the leader of the bunch. You DO know him well. And he’s FINALLY back, to kick some tail.

  • @netmonmatt
    @netmonmatt 5 месяцев назад +56

    It sucks that they were forced to rebrand, but i gotta admit, SuperNova is an absolutely sick name

    • @freddiesimmons1394
      @freddiesimmons1394 5 месяцев назад +2

      Why were they forced

    • @Blustorm1
      @Blustorm1 5 месяцев назад +15

      ​@@freddiesimmons1394 Likely rules Nintendo set when they had tournament register with them. Smash factor became S factor recently too.

  • @HasXXXInCrocs
    @HasXXXInCrocs 5 месяцев назад +8

    This was the first ever major tournament I've attended and holy shit this was the most insane sporting event ever. The crowd was more electric than even when I saw the Caps in the play offs the year the won the cup. Even my fiance popped off when June punched Josh for the win!
    So glad I got to experience that once in a life time event and I'll be going back every single year from now on.

  • @lemoncakestudios3031
    @lemoncakestudios3031 5 месяцев назад +5

    It was great to work with you Walt! Glad to see my footage put to good use. Let's go Junebug, congrats on the bronze! So cool to watch you dominate Melee in person and can't wait to see where you go from here :)

  • @netglitch_
    @netglitch_ 5 месяцев назад +8

    Joshman's reaction at 1:53 to getting raw punched is amazing

  • @catcatcatcatcatcatcatcatcatca
    @catcatcatcatcatcatcatcatcatca 5 месяцев назад +5

    As a viewer, DK has skyrocketed my interest in Melee. As someone who hasn’t played the game since early childhood, I really love the breakdowns of the advanced match-ups, tactics and mechanics. This lets me appriciate the complexity of the game even if I have no time nor spare effort to learn any of them myself.
    The fact a new character can reach drastically higher results so many years after the games release is a testament to the complexity of the game and more importantly the effort, skill and dedication of the players dedicated to it.

  • @WyattHoldW
    @WyattHoldW 5 месяцев назад +2

    I’m not even done with the video yet and have to stop and say you did an awesome job with this man. Good shit and thank you

  • @nscott64
    @nscott64 5 месяцев назад +3

    To think that I used to watch Junebug play PM like 10 years ago, not knowing he was going to become one of the most beloved Smash players. We're all here for 20DK!

  • @paulcochran7007
    @paulcochran7007 5 месяцев назад +6

    Being a part of that crowd was incredible. Definitely one for the books

  • @harlevans8498
    @harlevans8498 5 месяцев назад +8

    5:37 WOAHHH DK WHAT ARE YOU DOING!!!!

  • @justinclary7760
    @justinclary7760 5 месяцев назад +2

    Walt, we met briefly after supernova and I mentioned to you that I’ve been playing 10 years with my friends and that they are essentially family at this point in life and moments like this have reinvigorated our passions for this game and community.
    You’re goddamn right we aren’t stopping anytime soon.

  • @ItsMeChair1
    @ItsMeChair1 5 месяцев назад +26

    First instance of AsumSaus footage for todays video: 0:20

  • @SuburbanWitcher
    @SuburbanWitcher 5 месяцев назад +2

    I used to play/watch a lot of PM in the 3.02-3.5 era with Junebug and man this is such a throwback to see him again

  • @HeckYep
    @HeckYep 5 месяцев назад +38

    As a dumbass kid who mained DK after falling in love with the Ding Dong kill confirm, I'm so happy with the current state of Smash. It's so validating to my stubborn loyalty to the character. That back air is pure dopamine. I plan to finally try out Slippi just to go ham with DK.
    Edit: The 9-Wind is so baller, June is a legend to DKs everywhere.

  • @Aaron-mn2ro
    @Aaron-mn2ro 5 месяцев назад +8

    need a ganon resurgence BADLY

    • @DarkAuraLord
      @DarkAuraLord 5 месяцев назад +3

      Kage, my beloved

    • @Aaron-mn2ro
      @Aaron-mn2ro 5 месяцев назад +3

      @@DarkAuraLord B I Z Z A R R O F L A M E

    • @DarkAuraLord
      @DarkAuraLord 5 месяцев назад +4

      @@Aaron-mn2ro EEEEEEEEEEEEEEEZZZZZZZZZZZZZZZZZZZZZZZ MONEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEY

  • @twanheijkoop6753
    @twanheijkoop6753 5 месяцев назад +2

    Watching his run from home was already incredibly hype, can't imagine being in the crowd live.

  • @MrGetownedLP
    @MrGetownedLP 5 месяцев назад +1

    14:59 FeelsStrongMan June is for the people HOLYY

  • @faithinseabass
    @faithinseabass 5 месяцев назад

    Sick video as Usual, Walt! Keep pumping these out, it's easy to see how much care goes into making them.

  • @TimeEnthusiast
    @TimeEnthusiast 5 месяцев назад +4

    He was a strong presence in PM too..

  • @Bones_
    @Bones_ 5 месяцев назад

    Watching top 8 your commentary was really great! Like I was watching an Olympic sport level of quality. Just the right mix of well measured pace, in depth stats, and clear and concise speaking even when the energy picks up

  • @ME-ec6wi
    @ME-ec6wi 5 месяцев назад +4

    That minute where he glazed himself was kinda weird lol, great video tho Junebug is soo good at DK

  • @camhenning27
    @camhenning27 5 месяцев назад +5

    Watching his run live was insane

  • @jmendozas197
    @jmendozas197 5 месяцев назад

    Once again, you killed it with another banger of a video! It was crazy watching this live.

  • @anakaleflax
    @anakaleflax 5 месяцев назад

    Wow you work quick, Supernova was crazy and it's awesome to see Junebug & DK get more love :D

  • @heyitsmort7744
    @heyitsmort7744 5 месяцев назад

    “Anything could happen” is such a legendary line before June’s punch 😂

  • @DualSaga184
    @DualSaga184 5 месяцев назад

    After having watched your previous DK video and then hearing that Junebug made it into the top 8 of this tournament I decided to watch the top 8 and was quite happy with the hype plays Junebug was able to pull out.

  • @hockeyfreak896890
    @hockeyfreak896890 5 месяцев назад

    Beautiful storytelling man. Idk why but that ending sequence started to make me tear up haha. Great job as always.

  • @StepBaum
    @StepBaum 5 месяцев назад

    Really well made :) watched a couple vids now and you earned a sub. Great analysis!

  • @MoeSzyslak-nu3zd
    @MoeSzyslak-nu3zd 5 месяцев назад

    Just found your channel, dude you are amazing. I’ve been on a binge watching all your videos.

  • @RiskierGoose340
    @RiskierGoose340 5 месяцев назад +1

    I think I just realized that the DK-Pika matchup is just Guilty Gear Strive’s Potemkin-Chipp matchup: a slow character who struggles in neutral but can survive a lot of hits and can deal a lot of damage, vs a fast character that is amazing in neutral but doesn’t deal a lot of damage and dies super easily.

  • @vilegoblin
    @vilegoblin 5 месяцев назад

    the mario clip at 4:16 of him walking in engine lip synced to what Walt is saying lives rent free in my head

  • @danielk7245
    @danielk7245 5 месяцев назад

    Being in the crowd for this was truly an experience unlike any other

  • @drewholmes7356
    @drewholmes7356 5 месяцев назад

    Melee is just flat out science at this point. I don't even play melee, much less play competitive, yet this is so captivating to watch.

  • @necromax13
    @necromax13 5 месяцев назад +1

    20DK is real.
    Thanks Junebug, Quang, Ringler, and Akir.

  • @OkOk-ht6gr
    @OkOk-ht6gr 5 месяцев назад +3

    Is crazy how I just finished your pikachu video and then not even a minute later there’s a new one

  • @Alx1116
    @Alx1116 5 месяцев назад +1

    This is for the guys that used to play the game so much you’d main everyone for a while and saw potential in dk. I love melee

  • @Gabriel64468
    @Gabriel64468 5 месяцев назад +1

    Sick run by June, but almost is doing a lot of lifting in that title ^^‘

  • @jaspervermeer659
    @jaspervermeer659 5 месяцев назад

    I just love how much Junebug is enjoying it

  • @fatalbert135
    @fatalbert135 5 месяцев назад

    Awww yeah. This is what I was waiting for this week

  • @Stinkbug_Ab
    @Stinkbug_Ab 5 месяцев назад

    Im soooo happy Junebug is sticking with it

  • @spadorade
    @spadorade 5 месяцев назад +1

    Axe shoulda went yink

  • @raphaelmacasaet1081
    @raphaelmacasaet1081 5 месяцев назад +6

    POV: Me proving my friends that low tiers are good.

  • @cowboyclip
    @cowboyclip 5 месяцев назад

    Subbed, 100k coming soon!

  • @LAST1GGK
    @LAST1GGK 5 месяцев назад

    June bug is legit the reason I even can comprehend PM shout out to bro fr

  • @chw14556
    @chw14556 5 месяцев назад

    Honestly DK is super fun to watch so it’s sweet seeing him represented more.

  • @TheAlolanRaichu
    @TheAlolanRaichu 5 месяцев назад +1

    hope everyone attending supernova enjoyed their stay in nova! we got lots of roads, lots of grass, lots of suburbs, and lots of breweries :D

  • @MarMaxGaming
    @MarMaxGaming 5 месяцев назад

    I saw Dk actually won neutral sometimes against Pika with those swift disjointed back airs

  • @KincaidCS2
    @KincaidCS2 5 месяцев назад

    23 years later, melee is still fucking sick

  • @jeremyrosenberg2357
    @jeremyrosenberg2357 5 месяцев назад

    Subbed to you my man. Great content.

  • @mrmediocre848
    @mrmediocre848 5 месяцев назад +1

    I mean, DK does bring out the inner monkey within all of us.
    I'm pretty sure Supernova would've gone supernova in reality if Junebug won the whole thing

  • @wingzero7678
    @wingzero7678 5 месяцев назад

    Now we just wait another 10 to 20 years for someone to pick up my boy Ganon from the shelf and start winning like DK is now

  • @bfors8498
    @bfors8498 5 месяцев назад +1

    Junebug is a must watch player

  • @maxspecs
    @maxspecs 5 месяцев назад

    The good ol’ “don’t get hit by Giant Punch” challenge. Clearly not impossible but damn hard.

  • @eu4um
    @eu4um 5 месяцев назад +1

    I fucking love June man. He's so cool.

  • @equinox3861
    @equinox3861 5 месяцев назад

    Current mood: Jorge on commentary for a Junebug set at Supernova 2024

  • @MarMaxGaming
    @MarMaxGaming 5 месяцев назад +1

    it's true... writing, voicing, editing... they take forever!

  • @nicodemos4829
    @nicodemos4829 5 месяцев назад +1

    melee is just magic at this point

  • @kevinmartin9674
    @kevinmartin9674 5 месяцев назад

    been waiting alllll week for this video. what an event

  • @raphaelmacasaet1081
    @raphaelmacasaet1081 5 месяцев назад +26

    You know you have good fans when there are pulling this crap 10:01, 10:17, and 13:29

  • @InkedDoesStuff
    @InkedDoesStuff 5 месяцев назад +1

    As much as I'm rooting for the Kong Renaissance, I'm a bit worried this success might be a little short than we expect. I have no doubt that DK is good, but his results may begin to plateu as good players begin to learn the matchup

  • @lasagnahog7695
    @lasagnahog7695 5 месяцев назад +1

    With Junebug not playing his character as long as the top players and being able to see mistakes being made as he wins makes me super excited for him, and melee as a whole, going forward. If all melee was was spacies/marth/shiek I wouldn't even bother watching and Junebug gives me hope that that doesn't come to pass.

    • @Extracredittttt
      @Extracredittttt 5 месяцев назад

      It's crazy that, the longer the game has gone on, the more mid-tiers become viable. 20XX ideology was so wrong and I am very glad it was
      Yoshi and DK both at their peak!

  • @LordFartamor
    @LordFartamor 5 месяцев назад

    Congrats on 100k subs Walt

  • @chw14556
    @chw14556 5 месяцев назад

    20+ years later and the game is still evolving. Incredible. Now the question is, which “mid tier” is next? G&W is a fair bet.

  • @Extracredittttt
    @Extracredittttt 5 месяцев назад

    This was the most hype i have EVER been watching melee. good to day to be from mdva ❤❤❤

  • @K_v_B
    @K_v_B 5 месяцев назад +1

    Thumbnail goes hard.

  • @hatsuneblacktrousers
    @hatsuneblacktrousers 4 месяца назад

    12:17 i'm pretty sure 7-9 wind punch is also stronger in brawl and smash 4, and i think also in ultimate despite the totally different animation that's harder to keep track of

  • @Enochuout
    @Enochuout 5 месяцев назад +1

    I wouldn't mind if your next video is a DK video. Just keep encouraging Junebug to compete in everything he has opportunity for, more DK is better for everyone.

  • @astackzzzz277
    @astackzzzz277 5 месяцев назад +1

    One punch man reference on the thumbnail is epic

  • @FortuneKOF
    @FortuneKOF 5 месяцев назад

    This is exactly why Melee will be forever timeless. Smash will release a new game, kill the previous entry over and over. but Melee will forever remain standing strong.

  • @joolian4763
    @joolian4763 5 месяцев назад +1

    Junebug is likely one of the best smash players of all time, he has been around a long time and has developed the meta across different games. He's a beast.

    • @Wrestleroftheyear
      @Wrestleroftheyear 5 месяцев назад +1

      Mans should enter the smash iron man or whatever they call playing all the games

  • @visionposing
    @visionposing 5 месяцев назад

    Beautiful video once again Walt 🙏

  • @fraggnum__9660
    @fraggnum__9660 5 месяцев назад

    Im so happy. I love melee dk and I’ve had a strong feeling for multiple years that he could win a major. Now i have proof.

  • @tenebrisdumplin4583
    @tenebrisdumplin4583 5 месяцев назад

    It's pretty funny that DK can function in melee for the exact same reason he's good in later smash titles, Cargo up throw up air is probably the best throw confirm in the series. The utter domination his punish game can levy against fast fallers combined with his tankiness are a very unusual profile for melee. You can even see Mango have to change his style somewhat and resign to walling DK out defensively.

  • @Clementinee
    @Clementinee 5 месяцев назад

    it’ll forever be Super Smash Con

  • @FloetryFox88
    @FloetryFox88 5 месяцев назад

    For over 20 years since 2002, I have BEEN saying that DK was a really good character!! I was a DK solo main in in Melee from 2006 to 2011 and was one of the first few people praising the character as a secret high tier for YEARS! Now that people are finally seeing DK's true potential like I have, it truly brings a smile to my face! 😂💯🙌🏿

  • @iMacxXuserXx485
    @iMacxXuserXx485 5 месяцев назад +1

    There will be more ICs representation in the top 50 soon. Nicki is coming for Top 50 with ICs!

  • @gorg9928
    @gorg9928 5 месяцев назад +1

    The 20DK is real.

  • @paz8723
    @paz8723 5 месяцев назад

    >small win
    >small win
    >small win

  • @legendarysoil1064
    @legendarysoil1064 5 месяцев назад

    Junebug is actually inspirational like bro decided that donkey kong should be broken and did it

    • @Thomas-nz4si
      @Thomas-nz4si 5 месяцев назад +1

      People have been saying DK was on the cusp of being viable for years now, usually being placed right below Ganon. I think a lot of people knew that DK was unexplored and had potential within the top 100, but I don't think anyone expected this. I'm interested in seeing what's going to be a bigger aspect in the future, matchup unfamiliarality or optimizing Kong's punish game.

  • @angelodegiule1753
    @angelodegiule1753 5 месяцев назад

    Low tier mains keep rising up. It’s beautiful to see

  • @inediblemangoes7797
    @inediblemangoes7797 5 месяцев назад

    Also your video editing is getting so fucking good

  • @BigDnotimpressed
    @BigDnotimpressed 5 месяцев назад

    A truly legendary moment!

  • @ghostbaleada
    @ghostbaleada 5 месяцев назад

    This tourney had some G&W mains also doing decently. I think G&W is next tier list shaker

  • @jakegwolford
    @jakegwolford 5 месяцев назад

    Walt remains undefeated.

  • @x9x9x9x9x9
    @x9x9x9x9x9 5 месяцев назад

    Off topic but if into the am brought back their old space hoodies I would buy them. My all time favorite zipup hoodies came from them.

  • @MeatSnax
    @MeatSnax 5 месяцев назад

    I know we did see a bit of a Sheik renaissance a couple years ago, but I really think there's a ground swell of low execution > large reward among the more recent top players, and we're gonna see optimized Sheiks taking more tournaments than ever.
    I also think the crowd plays a BIG factor in these low tier heroes, people really underestimate how much it can shake a player, even at the very tippy top, for everybody to be cheering every time you get comboed or KO'd. Think about any time you were playing with somebody who trash talked a lot or played in front of people who wanted you to lose, you really need practiced, professional composure to not have it affect you greatly. Someone like Leffen or Hbox who's used to being cheered against will have a much easier time than a flashy Fox main or someone who's normally a Top 8 underdog, I mean Axe has probably never been cheered against unless he was playing Amsa or Mang0 or somebody that REALLY gets the crowd going.

  • @Hario338
    @Hario338 5 месяцев назад

    have a good flight!!!

  • @jpeghub
    @jpeghub 5 месяцев назад

    i didn't know you did brawlhalla commentary, that's awesome