Bumblebee - How Character Killed A Movie | Anatomy Of A Failure

Поделиться
HTML-код
  • Опубликовано: 22 окт 2024

Комментарии • 4,9 тыс.

  • @Filmento
    @Filmento  4 года назад +814

    The vid has some copyright problems which is why no audio right now, check back in a couple days!
    e: should be fixed now. Tweet at me if it isn't.

    • @canttalk-busypurging
      @canttalk-busypurging 4 года назад +13

      For a second I thought my phone was broken

    • @fleshborg
      @fleshborg 4 года назад +3

      ....1 year later(french accent)

    • @The_Protectors_Universe
      @The_Protectors_Universe 4 года назад +3

      The Justice League movie is better than the Bumblebee movie

    • @tylerkister4628
      @tylerkister4628 4 года назад +5

      @@The_Protectors_Universe I wouldn't say that I think this movie had more of a family feel to it best transformer movie by far

    • @Alestorm5000
      @Alestorm5000 4 года назад +1

      You made a typo at about 15:18. Just so you know...

  • @deathcon6261
    @deathcon6261 4 года назад +5028

    Filmento: Calls it a flop.
    Hasbro: "This movie gave us more of a profit then The Last Knight."

    • @mattimusprimal637
      @mattimusprimal637 4 года назад +560

      Death con This guy doesn’t understand the concept of profit, all he saw was that Bumblebee made under half a billion and thought it was a flop. Not taking to account its budget or marketing cost, so which was far less than The Last Knight. TLK was a flop due to the total cost being $520 million in budget + marketing and made only $602-$605M worldwide (with $130.1M domestic) while Bumblebee total cost is roughly $204M in budget + marketing and made $465-$467M (with $127.1M domestic, on a budget of $102M). So he’s just wrong!!

    • @jonathancontreras5069
      @jonathancontreras5069 4 года назад +311

      Mattimus Primal honestly, people these days think if it doesnt make over a billion its a flop

    • @infinitepowerTF
      @infinitepowerTF 4 года назад +56

      @@jonathancontreras5069 Agreed 👍!!!

    • @planetschlock
      @planetschlock 4 года назад +143

      Yeah, didn't they say in that same Hasbro press conference that Bumblebee was solidly profitable and TLK lost over $100 million after it was all said and done? I honestly don't know what Filmento is going on about here.

    • @JamesASharp
      @JamesASharp 4 года назад +35

      So? The action scenes lacked Bayhem. The film had heart, but it was boring to me. Forrest Gump has a lot of heart, and it's a classic. The latter film succeeds where the former film fails.

  • @Iamkenuff
    @Iamkenuff 4 года назад +2434

    My main complaint: how dare they tease G1 soundwave and not milk him.

    • @monsieurnaggert3134
      @monsieurnaggert3134 3 года назад +98

      They probably save that for later.

    • @danieltighe8281
      @danieltighe8281 3 года назад +183

      Soundwave superior, Autobots inferior!

    • @Alexander-gv1in
      @Alexander-gv1in 3 года назад +107

      _L A S E R B E A K E J E C T_

    • @GoldenRice01
      @GoldenRice01 3 года назад +61

      *Ravage eject operation destruction*

    • @kuronyra1709
      @kuronyra1709 3 года назад +16

      I'll give you one better, WE DON'T EVEN SEE SHOCKWAVE DAMN IT!

  • @AaronMosmeyer
    @AaronMosmeyer 5 лет назад +5454

    The movie failed in the US for several reasons.
    1) Marketing wasn’t too great, especially since the film went up against the successful Aquaman.
    2) “Transformers” was missing from the title so casuals didn’t know what it was.
    3) Some fans that knew what it was were suffering from burnout after The Last Knight.

    • @radrno7
      @radrno7 5 лет назад +376

      Agree with your points, but because it didn't have "Transformers" in the title? Really? The fact it's called Bumblebee, who everyone who knows Transformers knows that name, and has Bee's giant face on the poster weren't enough of a clue?

    • @windsweeper8002
      @windsweeper8002 5 лет назад +118

      The fact that Aquaman was successful and Bumblebee wasn't is just wrong.
      I've enjoyed the D.C. movies overall but Aquaman was definitely the worst. The acting wasn't great.

    • @drinibuzali1289
      @drinibuzali1289 5 лет назад +124

      @@windsweeper8002 yeah that's actually a very very objective opinion cause everyone including me would strongly disagree
      Aquaman was by far the best dc movie since the batman trilogy or even better the dark knight

    • @windsweeper8002
      @windsweeper8002 5 лет назад +40

      You're entitled to your opinion and for your sake, I'm glad you enjoyed Aquaman but I have to respectfully disagree.
      I'm not looking to argue here, just expressing my opinion.

    • @orionlax626
      @orionlax626 5 лет назад +101

      @Nagato is better than Punk Naruto TLK was good? Seriously? You've got to be kidding.

  • @crimsun3426
    @crimsun3426 3 года назад +939

    When they treated Bumblebee like a baby it reminded me of the time when they made Grimlock a mindless dinosaur in TF5 . Why does the leader of the dinobots want to eat a cruiser

    • @relatedfir
      @relatedfir 3 года назад +57

      The police cruiser grimlock ate probably tastet really good

    • @j.t.dennis4900
      @j.t.dennis4900 3 года назад +142

      To be fair, that's something the G1 version would probably do. However, that is the only aspect of The Last Knight I will defend

    • @alyssastern6073
      @alyssastern6073 3 года назад +19

      because a police officer would tell the king what to do and he wasn't a strong enough leader in king grimlock's eyes

    • @MT-rl6fn
      @MT-rl6fn 3 года назад +18

      You forget a few things, hes a dinosaur and mindless. What did you think would happen.

    • @notashark5189
      @notashark5189 3 года назад +1

      @@MT-rl6fn Idk? Maybe he can come up with a reason why the fuck would michael bay destroy the franchise??!?!?!?!?!??!?

  • @VG-eb1kd
    @VG-eb1kd 5 лет назад +1760

    "Heroes casually hangout on earth until evil comes to wipe them." Almost every DBZ arc ever lol.

    • @Yoseqlo1
      @Yoseqlo1 5 лет назад +62

      Hey, that's not fair! It's just half the arcs.

    • @hawoaliahmed6996
      @hawoaliahmed6996 4 года назад +9

      That could only be said about the radish ark

    • @robinachaibar8050
      @robinachaibar8050 4 года назад +27

      Yea but DBZ is a show
      Bumblebee is a movie

    • @TheDMind
      @TheDMind 4 года назад +72

      Note that in DBZ, the evil tends to show up fairly early in the arc, or at least their presence is felt. The rest of the 'waiting around' is them training and getting ready to face the evil - there's active motion towards a plot goal by the heros pretty much since partway through act1 of the arc.

    • @idkdamn978
      @idkdamn978 4 года назад +4

      nah dude. They train the whole time waiting for the evil to happen. Americans love training montages.

  • @aguywithalotofopinions412
    @aguywithalotofopinions412 5 лет назад +4108

    Bumblebee is a good movie. It's just that in order to make up for The Last Knight it needed to be perfect.

    • @m.a.k.dynasty4504
      @m.a.k.dynasty4504 5 лет назад +92

      It wasn't perfect. None of these movies are.

    • @luis7878
      @luis7878 4 года назад +178

      @@m.a.k.dynasty4504 then dont even bother with the series then

    • @meroshango9603
      @meroshango9603 4 года назад +11

      Not good at alll

    • @m.a.k.dynasty4504
      @m.a.k.dynasty4504 4 года назад +54

      @Plague Doctor
      He said that it needed to be perfect, which is wasn't. What's with the attitude piss pot?

    • @m.a.k.dynasty4504
      @m.a.k.dynasty4504 4 года назад +24

      @Plague Doctor
      Okay edgelord. Go back into your corner. Think about what you've done.

  • @TedTheFatCat
    @TedTheFatCat 5 лет назад +2665

    I agree with everything but calling the movie a failure is way too harsh. It was a move in the right direction and that must be celebrated.

    • @lonestarr1490
      @lonestarr1490 5 лет назад +166

      I think what he meant by that is that the producers consider it to be a failure.

    • @ClaireYunFarronXIII
      @ClaireYunFarronXIII 5 лет назад +234

      ...failure at the Box Office, not critically.

    • @coopergreen7961
      @coopergreen7961 5 лет назад +4

      Yes

    • @m.a.k.dynasty4504
      @m.a.k.dynasty4504 5 лет назад +23

      It still has flaws of its own that need to be addressed.

    • @meroshango9603
      @meroshango9603 4 года назад +36

      Right direction??? Is a nickelodeon show wich sooo many dump moments, they ruinn transformers

  • @toadetteremotewithwiimotio3330
    @toadetteremotewithwiimotio3330 3 года назад +2541

    They could‘ve made it so easy with one Plot:
    Find. Optimus. Prime.

    • @SlashTheWeasel
      @SlashTheWeasel 3 года назад +82

      I like your idea of plot

    • @noirody6256
      @noirody6256 3 года назад +90

      but optimus said that they were also coming to earth so why should they find optimus?

    • @SlashTheWeasel
      @SlashTheWeasel 3 года назад +177

      @@noirody6256 That is if they change the story and gave the characters a plot/something to accomplish in the story.

    • @noirody6256
      @noirody6256 3 года назад +15

      @@SlashTheWeasel yeah but they will need a reason to go to earth, i know it's a reboot but they're definetly gonna go to earth

    • @SlashTheWeasel
      @SlashTheWeasel 3 года назад +28

      @@noirody6256 Johnny's plot idea was just possiblity to Filmento's plot challenge.
      I agree that reason and should go to Earth. Possiblities: search for energy to renew Cybertron. That appeared a lot in G1. Find the Matrix which was kinda done in movies one and two with the Cube/Allspark and Matrix.

  • @filipvadas7602
    @filipvadas7602 4 года назад +2693

    This movie is honestly better than all the Bay movies for 3 reasons:
    1) The War on Cybertron segment was basically one massive love letter to the franchise. The G1 designs, the voice actors and the brutality of the war itself was great
    2) The characters actually have personalities that make them fun to watch
    Shatter and Dropkick in particular were actually fun villains that felt unique. Alredy this gives us more than what the Bay movies gave us
    3) It actually has enough restraint to not fall into the same trap of the Bayverse, giving us orgies of explosions and halfbaked Adam Sandler level comedy every 10 minutes.

    • @bottlesalts
      @bottlesalts 4 года назад +133

      I absolutely love character driven films. For example, Joker is probably on my list of top five favorite movies. However, I do somewhat agree that Bumblebee should have had a slightly better idea of what the plot was all about. But I seriously LOVED Bumblebee's whole character in this movie. I desperately want to see more like it in the future.

    • @frank8917
      @frank8917 4 года назад +78

      4) the soldier characters are actually good (especially the one played by John Cena)

    • @bottlesalts
      @bottlesalts 4 года назад +62

      @Franco Sal John Cena’s character wasn’t too bad in the movie, however, the “boyfriend” character - i forget his name - I think was terribly developed. He really served no purpose except for being a third wheel. In ways, I feel the movie would have been better without that guy. But Cena, on the other hand, even had his own little arc sorta thing, which was pretty good

    • @Fvckjus
      @Fvckjus 4 года назад +37

      Shit was wack with its 3 fight scenes 😭

    • @Leader7353
      @Leader7353 4 года назад +2

      @pinkgoat agreed

  • @God-T
    @God-T 4 года назад +634

    The one thing i liked about the bumblebee movie was the fighting choreography it looked so natural!

    • @Tremadog102
      @Tremadog102 3 года назад +98

      I thought it was a nice touch that when Bumblebee fought he used his opponent's size against them. It was more like martial arts compared to brawling. He couldn't afford to use brute strength to defeat his opponents so he had to fight smart.

    • @TF2Fan101
      @TF2Fan101 3 года назад +55

      Something else I felt was clever about the choreography, particularly whenever Bumblebee was fighting, was that he used his size to his advantage. He was able to show, through his acrobatic abilities and quick-thinking, that he could be a capable fighter.
      To quote Yoda, 'Judge me by my size, do you?'.

    • @chj2
      @chj2 2 года назад +12

      Indeed - and I LOVE the fact that the fighting style in Bumblebee actually employed TRANSFORMING for once! Shame it took almost 6 movies to see that. . .

    • @siphonophores
      @siphonophores Год назад +5

      I just love that they used actual fighting styles instead of just trying to grab and throw each other.

    • @CaptainRockoBD
      @CaptainRockoBD Год назад

      @@TF2Fan101that’s my favorite thing about bumblebee. He’s been like that even in the Bayverse.

  • @TheStargateNerd
    @TheStargateNerd 5 лет назад +539

    I regret not seeing this movie at the cinema, because I was surprised by how good it actually was. The opening fight on Cybertron was also amazing, even if it was woefully short.

    • @g.d.graham2446
      @g.d.graham2446 2 года назад +3

      True

    • @YouKnowMeDuh
      @YouKnowMeDuh 2 года назад +2

      I mourn how little we got to see of that amazing fight sequence....

    • @MrChickennugget360
      @MrChickennugget360 2 года назад

      Same here. After watching the Bay Films i had lost all interest in the franchise.

    • @sidearmsalpha
      @sidearmsalpha 2 года назад +3

      @@MrChickennugget360 Probably why this movie underperformed. I almost walked out of The Last Knight because of how bad it was. When I heard about Bumblebee, I was seeing that it would be different but I was still skeptical but I'm so glad I watched it in a theater. Easily the best one and a big step in the right direction for the franchise. I think a lot of people were expecting it to be more of the same garbage from Michael Bay and that's why a lot of people skipped it. What a shame.

    • @SnowEspeon
      @SnowEspeon Год назад +1

      @@Holisticxoxo idk man, i appreciate a slow paced feel good sentimental story every once in a while, and we got to see bumblebee being an amazing fighter in almost every fight scene that did happen, so it was a great balance for me

  • @qwench3am553
    @qwench3am553 3 года назад +887

    I think he was acting like a baby because he forgot everything about himself and his mission optimus gave him

    • @247.mp4
      @247.mp4 3 года назад +111

      Bumblebee was always a kid in a "mans" body (arent we all) and always adapted to his friends. He was only heroic when he needed to be. Also, how should he know what a socket is without touching it

    • @notashark5189
      @notashark5189 3 года назад +8

      @@247.mp4 His world and his people are fucking machines... not saying they should have sockets there but they gotta charge some shit somehow

    • @stickiedmin6508
      @stickiedmin6508 3 года назад +51

      @@notashark5189
      But he has no memory of that world, or those people.
      He sees the thing, he can probably detect that there's electrical power flowing behind it so he decides to check it out.
      Simple enough.

    • @jaylenware363
      @jaylenware363 3 года назад +26

      @@notashark5189 Angry Sentinel Prime: wE aRe nOt MaCHinES

    • @coolmuzt
      @coolmuzt 3 года назад

      @Primus Productions! Yeah when he took care of Spike he was so cute

  • @BiggestGal
    @BiggestGal 5 лет назад +766

    The character focus was hardly the issue, it was the overall feeling of burnout moviegoers felt over The Last Knight and Age of Extinction.

    • @GringoXalapeno
      @GringoXalapeno 3 года назад +25

      I agree

    • @Nephalem2002
      @Nephalem2002 3 года назад +2

      Both of which were dogshit

    • @etam8099
      @etam8099 3 года назад +4

      @@Nephalem2002 AOE was good tho

    • @kingslayerx1716
      @kingslayerx1716 3 года назад +10

      @@Nephalem2002 aoe wasn’t even that bad tbh. They just needed to lay off the unfunny jokes

    • @azpiapi
      @azpiapi 3 года назад +2

      It was just boring in general, never rewatched it or checked it out so that isnt the problem.

  • @TheSteelMagnum
    @TheSteelMagnum 5 лет назад +930

    Well, the Iron Giant doesn't exactly have much of a strong plot either. Aside from a young boy trying to teach a giant robot how to be human, or something like that. But its still a flawless movie.

    • @alexhorbacz1547
      @alexhorbacz1547 5 лет назад +70

      Besides the flaw of it not having a strong plot.

    • @xgray2012
      @xgray2012 5 лет назад +8

      Agreed.

    • @xgray2012
      @xgray2012 5 лет назад +18

      @@alexhorbacz1547 It's better than having no plot at all.

    • @m.a.k.dynasty4504
      @m.a.k.dynasty4504 5 лет назад +24

      @@xgray2012 That's doesn't change the fact that it's plot is still pretty weak in general.

    • @aidenshigaraki1998
      @aidenshigaraki1998 4 года назад +14

      that's not a fact, that's your opinion that it has a weak plot, its better then the weak what the hell plots in the bay movies, those are bad

  • @lockejawe4050
    @lockejawe4050 5 лет назад +127

    A lonely kid finds a stranded alien robot and then the two casually hang out until the villains come for them worked well in The Iron Giant...

    • @johnnyskinwalker4095
      @johnnyskinwalker4095 5 лет назад +9

      Iron Giant was a bomb too

    • @icecreamhero2375
      @icecreamhero2375 3 года назад +8

      @@johnnyskinwalker4095 It became a cult classic and it made the money back over the years.

  • @Seiaeka
    @Seiaeka 3 года назад +685

    As a fan of transformers, I didn't even know this movie existed until I found it on netflix. I was honestly disappointed that I missed it in theatres. I've still watched it more than once despite there being overall no distinct plot. I still want to see more transformers movies from this film. I would gladly watch them.

    • @Scion141
      @Scion141 3 года назад +29

      I think the reason a lot of people missed it was the lack of "Transformers" in the title.

    • @swordplaysgames
      @swordplaysgames 3 года назад +38

      @@Scion141 How do you not notice it’s Transformers when it has Bumblebee plastered all over it

    • @azpiapi
      @azpiapi 3 года назад +8

      @@swordplaysgames right

    • @firemaker1258
      @firemaker1258 2 года назад +4

      There’s going to be a seventh film, Rise of the Beasts.

    • @DESTRAKON
      @DESTRAKON 2 года назад

      I didn’t even watch it when it came out cause I was just done with tf at that point but I hear everyone saying it’s cool so I might check it out

  • @mityakiselev
    @mityakiselev 4 года назад +240

    "to hide Bumblebee from John Cena"
    I'm pretty sure he saw him literally in the beginning, he was standing right there

    • @jordon8658
      @jordon8658 3 года назад +5

      The point was to keep bee from getting john cena

    • @frde2190
      @frde2190 3 года назад +15

      Really hard cause John Cena is invisible

    • @geomania8533
      @geomania8533 Год назад

      Bet Cena could beat Megatron with a punch. Wonder if they’ll have Chuck Norris in the beast wars movie

  • @an_exlusive_channel
    @an_exlusive_channel 5 лет назад +857

    I like the character design in bumblebee, it's very reminiscent of the old cartoon series

    • @spideyguy3315
      @spideyguy3315 4 года назад +38

      It gives me that transformers vibe like the cartoon

    • @bradleyrenfroe2776
      @bradleyrenfroe2776 4 года назад +43

      @@spideyguy3315 That Vibe the Bayverse was missing.

    • @jareejones
      @jareejones 4 года назад +40

      I personally hate the design its looks fake tbh Bays looked real and detailed

    • @an_exlusive_channel
      @an_exlusive_channel 4 года назад +41

      Jaree Jones yeah Bay’s designs are pretty cool but I personally love the cartoon style

    • @spideyguy3315
      @spideyguy3315 4 года назад +9

      @@bradleyrenfroe2776 exactly

  • @Warhammer_lover
    @Warhammer_lover 5 лет назад +395

    Why do you compare bumblebee to E.T and not to “Iron Giant” ? I think it would be more accurate comparison IMHO

    • @tiagodarkpeasant
      @tiagodarkpeasant 5 лет назад +78

      because the iron giant was created to be a villain but discovered he could be anything he wanted, that is an entirely different plot than "et call home"

    • @VinWeiLee27171
      @VinWeiLee27171 5 лет назад +19

      Bumblebee at one point feels very villainess. So I do think the comparison is valid. They decide not to expend that idea, probably because in the first scene we already know bumblebee is supposed to protect earth.

    • @hansruhlmann454
      @hansruhlmann454 5 лет назад

      василий петрович Just what i thought too.

    • @NerdiconPrime
      @NerdiconPrime 5 лет назад +22

      @@tiagodarkpeasant Well the iron giant is ET if he were a giant alien robot Gun. They share the same story beats of; Human finds alien, befriends alien, helps alien both physically and emotionally, hides alien from Government, alien gets or almost gets caught, Human rescues alien or calms them down, Alien says goodbye to human Fin.

    • @NerdiconPrime
      @NerdiconPrime 5 лет назад

      Upcycle Shoes why’d you find it trash if it’s okay for me to ask?

  • @sharpwavethedecepticon6837
    @sharpwavethedecepticon6837 3 года назад +283

    This is why the Transformers Prime series was the greatest interpretation I have ever seen. Great overarching plot, good character development, and beautiful stylized animation. If someone make a live action movie based on that series and a lot of love was put into it, I would throw my money at them. If companies want to make a Transformers movie, look over Transformers Prime and how it’s so well structured. Use it as an example.

    • @cherry414
      @cherry414 3 года назад +43

      Now this guy gets it. TFP is everything the movies should've been.

    • @sharpwavethedecepticon6837
      @sharpwavethedecepticon6837 3 года назад +35

      @@cherry414 Honestly, imagine a movie Megatron that is as intelligent as TFP Megatron. He’s (TFP) literally the only Megatron I would take seriously. Prime also had better designs than the movies.

    • @azpiapi
      @azpiapi 3 года назад +15

      You forgot the fights.. they were amazing

    • @cherry414
      @cherry414 3 года назад +25

      @@sharpwavethedecepticon6837 True! The TFP design is almost nothing like the G1 ones, which Bay wanted to do in his movies, yet TFP design is beautiful. Also Meg's design in TFP! He looks menacing, elegant and a tyrant. In the movie, he looks like every other decepticons.

    • @MeisterSchwabbo
      @MeisterSchwabbo 2 года назад +14

      Indeed, TFP was by far the best transformers media ever created, in my opinion G1 sucks in comparison

  • @arnold3768
    @arnold3768 4 года назад +614

    Filmento: Bumblebee doesn't have a plot.
    Cats: am I a joke to you?

    • @apersonwhomayormaynotexist9868
      @apersonwhomayormaynotexist9868 3 года назад +22

      The thing is, Cats isn't supposed to have a story and that's the thing that works in its favor. The movie was terrible but the Broadway show is one of the all time greats. This is a movie that could use more plot

    • @swiftstreak98
      @swiftstreak98 3 года назад +29

      @@apersonwhomayormaynotexist9868 How dare you compare Bumblebee to that heaping shit pile

    • @apersonwhomayormaynotexist9868
      @apersonwhomayormaynotexist9868 3 года назад +4

      @@swiftstreak98 I'm saying this is better then the cats movie, just not the show because the show is an all time great

    • @swiftstreak98
      @swiftstreak98 3 года назад +1

      @@apersonwhomayormaynotexist9868 The show is just as bad

    • @apersonwhomayormaynotexist9868
      @apersonwhomayormaynotexist9868 3 года назад +9

      @@swiftstreak98 I'm gonna take a wild guess and say you've either never seen the show or hate musical theater with a burning passion. Either way, you're not an unbiased critic. I'm someone who loves musical theater, but also loves action movies, so yes I'm biased, but much less so. Plus, I've actually _seen_ both so...
      Also just look at the critical reviews by the people who _are_ unbiased, they agree with me.

  • @oliaustfjor6247
    @oliaustfjor6247 5 лет назад +1288

    Yeah, because a 93% on Rotten Tomatoes with the studio being so happy with it they confirm it as a reboot and with sequels like it in mind is a failure...
    Sure.

    • @galvanizedcorpse
      @galvanizedcorpse 5 лет назад +57

      so what is your problem, do you have one? speak it loud, not with feminine sarcasm sissy boy

    • @oliaustfjor6247
      @oliaustfjor6247 5 лет назад +367

      Гальванизированный Труп
      Didn’t know sarcasm was considered feminine nowadays.
      But hey, it’s 2019.
      Learn something new every day

    • @THEKXRMANETWORK
      @THEKXRMANETWORK 5 лет назад +144

      Гальванизированный Труп bitch people like you think everyone is a feminist who likes this movie bruh people just like Transormers shut the fuck up bruh damn

    • @oliaustfjor6247
      @oliaustfjor6247 5 лет назад +102

      ERROR-TRI
      Love the 86’ film.
      I’ve seen every live action film in theatres since 2007.
      Love the first bay film.
      Didn’t care for the sequels.
      Loved Bumblebee.
      It’s like a really long episode of the 84’ show and that’s why I saw it three times.
      Don’t jump to conclusions like that, my man.
      Die hard transformers fan right here and have been since I was a kid.

    • @oliaustfjor6247
      @oliaustfjor6247 5 лет назад +81

      LOL, now just realizing you were replying the jerk who called me a feminine sissy.
      Sorry, my mistake, hahaha

  • @enderdrone6432
    @enderdrone6432 5 лет назад +594

    Or they could have focused the story ENTIRELY on Cybertron than Earth.

    • @TheManOfMyriad
      @TheManOfMyriad 5 лет назад +110

      Imagine animating Cybertron for a whole movie. In our modern style.
      I'm not sure the movie budget would've lasted, even with added extras.

    • @HenryLouis21
      @HenryLouis21 5 лет назад +72

      First off, what story is there to tell about Bumblebee on Cybertron, sure there could be a lot of cool stories of him on Cybertron. But Bumblebee's character is a character who has a strong relationship with humans and strong connections with them. So making a movie about him on Earth with a bunch of human comrades is an interesting one.

    • @ryanbarker5217
      @ryanbarker5217 4 года назад +1

      @@HenryLouis21 it could have been an interesting one with a better writer and director. as it stands, it's everything wrong with modern 'cinema.' i agree, just being on cybertron is pointless... that is, even more pointless than cheap cash money grab prequels are to begin with.

    • @HenryLouis21
      @HenryLouis21 4 года назад +12

      @@ryanbarker5217 First of all, this is not a fucking prequel, its a reboot. This has literally been announced from like a year ago. Do your research.

    • @KevinLopez-cz9xs
      @KevinLopez-cz9xs 4 года назад +25

      Umm... have you heard of fall of cybertron? Yes, it’s a game, but at the same time, it gives a movie-like experience what with all the character interactions and cutscenes

  • @caiosilva2167
    @caiosilva2167 3 года назад +88

    Was the lack of plot really the main problem ?
    Maybe so when taking the larger audience into account, but as a TF fan my biggest gripe is how this movie doesn´t really focus on the cybertronians as characters, it´s very human centric, Bumblebee may be the title character but i wouldn´t say he is properly fleshed out, he is mute and *amnesiac* for most of of the story and basecally acts like a puppy to Charlie who is the one to actually get the spotlight, i fear Hollywood producers still don´t trust in the Transformers to actually carry the story as characters.

    • @xgray2012
      @xgray2012 3 года назад +14

      Okay. That is a much better analysis, dude.

    • @geomania8533
      @geomania8533 Год назад +4

      Least we had a plot. Unlike the bay films which have too much plot that you can’t really see what’s going on. Also the fact that their aren’t transformer scrotums or too many explosions. Which is progress for making Transformers great again.

  • @rosea4592
    @rosea4592 4 года назад +455

    The movie was amazing. The reason it failed was very one went to see aqua man . Everyone I knew said “ nah let’s go see aqua man “

    • @mrmercy554
      @mrmercy554 3 года назад +17

      I mean your right and tbh the Aqua man movie wasn’t that good

    • @Terminal_Apotos
      @Terminal_Apotos 2 года назад +16

      I’m a DC fan but honestly I’m Surprised Aquaman was able to carry his own movie and beat a Bumblebee Movie who’s arguably a more popular character.

    • @YouKnowMeDuh
      @YouKnowMeDuh 2 года назад +1

      Oh that's sad. What I've seen of Aquaman was not very thrilling, lol.

    • @cloudystorm7314
      @cloudystorm7314 2 года назад +6

      It didn’t really fail though. Overall it made 467 million. This video just showed the domestic gross

    • @dannyjp-diego2938
      @dannyjp-diego2938 2 года назад +3

      AND Aquaman have more issues than bumblebee's plot

  • @siloPIRATE
    @siloPIRATE 5 лет назад +226

    This movie sounds like Iron Giant
    Find robot, army come for it, save robot

    • @trevorrogers95
      @trevorrogers95 5 лет назад +3

      Iron Giant dies, bro.

    • @siloPIRATE
      @siloPIRATE 5 лет назад +28

      @@trevorrogers95 He doesn't. He explodes, but begins reassembly because heroes never die

    • @jeagerkej3171
      @jeagerkej3171 5 лет назад +10

      siloPIRATE Except iron giant has a good plot and a heart warming story.
      Bumblebee is a 4K dumpster fire.

    • @jeagerkej3171
      @jeagerkej3171 5 лет назад +2

      @Henry Louis21 If you just watched the video and still think this movie even has a plot and that would be the end of our conversation.

    • @HenryLouis21
      @HenryLouis21 5 лет назад +18

      @@jeagerkej3171 First of all watched the video and I disagree because the movie had a plot and a story to follow. The movie's narrative was about a girl who finds a robot and needs to hide it from the rest of the world. It is mostly a teenage coming of age story that has elements of the Iron Giant and E.T

  • @EmeralBookwise
    @EmeralBookwise 5 лет назад +461

    Bumblebee made nearly as much money as Last Knight on only half the budget. Doesn't sound like a failure to me. If any thing it looks more like proof of how cost ineffective Bayhem is.
    Also, the movie doesn't lack a plot, it's just telling a different kind of story, one that leans more into the slice of life genre.

    • @mr.cuttystabby5331
      @mr.cuttystabby5331 5 лет назад +50

      And far too many people dislike slice of life type movies, myself included, but every now and then we get a gem like Bumblebee. The movie was solid and I can't wait for the next one.

    • @LinkMarioSamus
      @LinkMarioSamus 5 лет назад +19

      This is what I was thinking, yes. I understand most of what is said in the video is from the perspective of how it could have been marketed better, but sometimes in life things do happen and people take actions for seemingly no reason. That's not to say every movie should be like that, but more that that's simply another form of storytelling.
      Admittedly I have not actually seen this film (I get the feeling I will though), but from what I gather about it, a film like this might represent a turning back to old-style movies that people went to see just to watch people hanging out, like an Easy Rider, Midnight Cowboy, or American Graffiti. Although I haven't seen those films either so I'm largely going off of what they're supposed to be about, but still. Not everything needs to have a clear Point A and Point B.
      I still get the point but come on, this is clearly not a high-concept film and was never meant to be.

    • @LeaderOfTheLostSouls
      @LeaderOfTheLostSouls 5 лет назад +22

      No I watched the movie and I agree it has no plot, you can be a slice of life story yet have some goals or a background plot for the characters. Characters can have their personal own goals, Charlie did have a small one connected to her father’s car which she dropped once she got bumblebee, sadly, and bumblebee lost his goal for most of the movie due to memory loss, the villains had goals tho.
      Also most of the time the Slice Of Life stories are better for shows and anime not movies.
      But fair point on how well it did compared to the Last Knight, the movie makers and causal people are just dumb thinking if it’s smaller numbers it’s bad even though it did good for its cost and such.
      Also it doesn’t need to be a “High Concept Film” to have a plot or characters to have goals lol

    • @alexhorbacz1547
      @alexhorbacz1547 5 лет назад +5

      Anyone who says that this movie doesn't have a pot hasn't seen E.T considering they are almost identical.
      So that argument kind of sucks.

    • @LeaderOfTheLostSouls
      @LeaderOfTheLostSouls 5 лет назад +7

      Alex Horbacz Ummm no
      The video itself mentions E.T. and the fact it had goal(s) and plot so idk what you are on lol
      It was mentioned at 3:45 and he points out the differences so no your memory, counter, and eyes/ears suck cuz it was touched upon.
      How about watch the movie for more than a few seconds or minutes before you say stuff that is talked about in the video and look like a fucken moron talking out of your ass.

  • @nargacuga05
    @nargacuga05 4 года назад +107

    Wouldn’t this argument also apply to ET then, I find the idea that “he’s an adult” is a valid argument to be flawed, his memory was corrupted, which doesn’t entail anything specific by nature, applying reason to what is and isn’t affected is more of a nitpick than anything else

    • @hamdurger
      @hamdurger 3 года назад +38

      he also picked on the fact that bumblebee acts like a baby that would stick his finger into a socket even though bumblebee landed on a planet unknown to him. Its not like Cybertron also had sockets for some reason.

    • @jordon8658
      @jordon8658 3 года назад +2

      3:54 he just explained that unlike bumblebee et had an overarching plot

    • @jordon8658
      @jordon8658 3 года назад

      @@hamdurger they do though....but i get your point

    • @aetheriox463
      @aetheriox463 2 года назад +3

      @@jordon8658 they have sockets that are identical to those in the US at the time the movie was set? if that made any sense whatsoever i would still doubt it

  • @BangDoMusic
    @BangDoMusic 4 года назад +118

    I was 30 years old when immigrant legally to the U.S. My mission is to have a job and support the people who raised me up in my hometown. I went to ESL class to learn English and I felt like I was a 5 years old boy - tried to figure out the language and everything. Then after 1 year I went to college made friend with 18 year-old friends and even younger guys at my part time job, which made me feel like i was a teenager. That proved that the plot you pointed out here is haven't formed yet since this is the very beginning time of Bumblebee on Earth, where he has to kick start again in a new place, made friend with a little cute human, feel like "how the hell she's so sweet but have too much emotional struggles". He got influenced by the new friends (just like I treated my first American friends like gods), and still figure out the new place during this movie. The director had put himself in Bumblebee - an Alien- a foreigner in a completely new place. I love this movie because empathized with the bot, and the kid, somethings that Michael Bay was totally fail.

    • @shinchanindia6306
      @shinchanindia6306 3 года назад +7

      your comment is totaly true btw loved your life story mate

    • @minchai2943
      @minchai2943 3 года назад +2

      I feel ya mate

    • @BangDoMusic
      @BangDoMusic 3 года назад +4

      Thanks for your empathy, Shinchan, Min, Sweetblackblood,

    • @shinchanindia6306
      @shinchanindia6306 3 года назад +1

      @@BangDoMusic welcome bro hope you live great life

  • @ToonamiT0M
    @ToonamiT0M 5 лет назад +2001

    Transformers fans saw Bumblebee. Normies saw Bayformers.

    • @IP_Films01
      @IP_Films01 5 лет назад +7

      Yup

    • @FP19487
      @FP19487 5 лет назад +18

      That doesn’t help anyone.. Surely there’s some way to connect both world. Imo Bee looks way too ‘Bayformers’ than it should be unlike OPrime.

    • @cosmicspidermanx9569
      @cosmicspidermanx9569 5 лет назад +8

      I was gunshy after the last 5 movies that's not my fault that's Hollywoods. And I'm only buying the bluray for the cybertron scene, im just done with people in these films. Hell I'd take a cheesy live action remake of the 80s film

    • @andrewphillips8341
      @andrewphillips8341 5 лет назад +4

      To bad they could make the human characters remotely interesting

    • @stingysmailbox8209
      @stingysmailbox8209 5 лет назад +30

      People who wanted to see this movie-
      TF fans: This is what we've been wanting for years! A transformers film with an actual writing and character development. And an homage to G1.
      Normies: HAILEE STEINFELD😍😍😍😍😍😍😍😍😍😍😍😍😍😍😍😍😍😍😍😍😍

  • @GridCube
    @GridCube 5 лет назад +158

    they have already said there's gonna be a sequel to bumblebee, because it was a success for the budget it was given.

    • @atom104n
      @atom104n 5 лет назад +14

      true but they are gonna add more Bayhem to help with the "problem" they saw with Bumblebee which I am not looking forward too. Bumblebee is a great movie in my opinion, and it should improve on as it goes and not go back to the Bayhem we had with the transformers series

    • @VinWeiLee27171
      @VinWeiLee27171 5 лет назад +3

      I think bumblebee is a testing ground. The goal for the company seems to be breaking even with this reboot, not a massive box office number. They did hit their goal, so make sense to have a sequel with more fights.

    • @TalkingAboutYooh
      @TalkingAboutYooh 5 лет назад +1

      @@atom104n More Bayhem? Says who? You? Source please.

    • @atom104n
      @atom104n 5 лет назад +3

      @@TalkingAboutYooh Sorry, I should of put "probably going to add" as speculation on what they were going to do with the series.

    • @kennethsatria6607
      @kennethsatria6607 5 лет назад +8

      @@atom104n Oh dear, I hope that just means a little more explosion... I absolutely loved the detailed fight choreography of Bumblebee.
      Optimus with his size and power flips and locks enemies, Bee tackles and grapples around them and even uses the blade more
      I am hoping to see an Optimus and Megatron fight where they get physical like what we see

  • @БорисОхлаждай
    @БорисОхлаждай Год назад +6

    The only two things that are memorable about this movie are:
    1. The reuse of Iconic G1 designs.
    2. The fight scenes. I love how Bumblebee doesn’t just brute force through everything but uses his wits to overcome his opponents. Like he immobilized one with a chain or got the other destroyed by the colliding tanker.

  • @DCRStudios
    @DCRStudios 5 лет назад +336

    Bumblebee wasn't a box office failure, yes, the movie doesn't compare with the money made by Bayformers but for a movie of 100m, 500m worldwide is not bad.
    But I agree that the movie have weak story but great characters.

    • @FearingVirus
      @FearingVirus 5 лет назад +14

      yeah, but given the studio only takes a MAXIMUM 65% cut of the box office, with far less coming from China (where they made most of their money), add in the marketing budget, and they probably made a relatively tiny amount of profit.

    • @adarkwind4712
      @adarkwind4712 5 лет назад +5

      FearingVirus and in understanding you’re trying to restart a franchise many have come to loathe and hold in disdain having multitudes of happy moviegoers and reviews. You can look on that small profit and understand you’re not starting at the beginning you’re starting in the red because you have to build up that trust again. So small profit yes but if they keep going with movies like this focusing on the transformers, it’ll make money.

    • @FearingVirus
      @FearingVirus 5 лет назад +4

      ADARKWIND all of which I understand and agree with. I was just trying to make OP, and anyone who reads his comment, aware that while the movie may not have technically performed “badly”, it didn’t exactly perform “good” either, when all factors are considered.

    • @dan200tf6
      @dan200tf6 5 лет назад +4

      @@FearingVirus yet the studio confirmed it was profitable so were good

    • @FearingVirus
      @FearingVirus 5 лет назад +3

      Dan200 Tf ....right. Once again. Didn’t dispute that it MADE profit. I was just pointing out that it didn’t make MUCH. It’s like if you ran a business that you put $10,000 dollars into creating, and made back $10,005. Technically you made a $5 profit, but that doesn’t inherently mean your business was very successful.

  • @171QA
    @171QA 5 лет назад +134

    Whenever I want a good laugh, I come back and watch this video and reread the news that says Bumblebee is now part of a new film reboot. XD

    • @shanonfree8210
      @shanonfree8210 3 года назад +4

      Wait, really?

    • @poodn4559
      @poodn4559 3 года назад +13

      @@shanonfree8210 yep, completely new universe

    • @swiftstreak98
      @swiftstreak98 3 года назад +18

      @@poodn4559 Thank Primus

    • @mizaelmendez3843
      @mizaelmendez3843 3 года назад +5

      Who would be directing it? Please say it’s not Michael Bay!

    • @poodn4559
      @poodn4559 3 года назад +16

      @@mizaelmendez3843 I mean, probably Knight. The guy who did this film

  • @MidnightStorm4990
    @MidnightStorm4990 5 лет назад +1794

    Bumblebee was actually a really good movie tbh

  • @pawarl.o.s.881
    @pawarl.o.s.881 3 года назад +39

    That opening on Cybertron is still one of my favorite movie scenes.

  • @Galimeer5
    @Galimeer5 5 лет назад +588

    If Bumblebee came out before the crapfest that was the conclusion of Michael Bay's Transformers, the movie would've done exceedingly well.
    But to the average movie-goer, they see a movie poster for Bumblebee and think "Oh, another bad Transformers movie. No thanks"
    That's why Bumblebee was a flop Stateside -- because the "Bayformers" left a sour taste in everyone's mouth.

    • @mikumikuareka
      @mikumikuareka 5 лет назад +33

      >"Oh, another bad Transformers movie. No thanks"
      Ah, yes, you're right. That's the reason I didn't go to the cinema as I always do.
      I actually enjoyed the first 3 Bay's Transformers. Maybe it's not kind of movies with "deep meaning" but, oh boy, IMHO they were very entertaining.
      But after that... It just became lame and stupid as fuck. No good plot (comparing to previous ones), no good ideas (comparing to previous ones), action scenes were boring (just boring), CGI and special effects became ugly and lazy and of course OF FUCKING COURSE A LOT OF PRODUCT PLACEMENT WHAT THE FUCK MICHAEL DID I PAY TO WATCH ADS THAT I ALREADY WATCH 24 CURSED HOUR EVERY CURSED DAY OF MY CURSED LIFE FREE OF CHARGE WHY MICHAEL WHY JUST WHYYYY
      Um yeah, I didn't enjoy that. So my expectations were low, I didn't want to face this kind of disappointment again and I decide not to watch Bumblebee at all.

    • @robertlopez7888
      @robertlopez7888 5 лет назад +4

      @Adrijana Radosevic You saying? The Blitzwing scene was a show of sounds and explosions in cinemas, everybody was enjoying it

    • @thecartooncynic
      @thecartooncynic 5 лет назад

      but there's still no plot

    • @tfcollect2690
      @tfcollect2690 5 лет назад +8

      That's BS.
      I see nothing but excuses for the lack of domestic success of this movie. If they would've started with BB before Beyverse. There would be no more TFmovies. Here's why.
      The 80s cartoon version woukd never play well in a real life timeline. What you seem to not think about is this. My kids were born in the 90s. What they see is what relative to their timeline.
      80s flatnose truck, VW Bettle, walking Tapedeck that ejects cassette tape looking transforming robots
      Transformers that has earth looking car parts that has never been to earth. Why does a robot on cybertron has rescue insignia on him "Ratchet" windshield wipers, etc. Robot jets that look like their from earth but they transform into alien jets.....does that make sense?
      This is why they didnt take that route in the Beyverse because that 80s era is over and it would not translate well in a live action film. And in 2019....they were correct and the domestic failure proved it. Whether you like it or not. The Beyverse made more sense. They didnt look like nothing on earth, they're not from earth. So having a protoform made sense.
      Again, my kids are born in the 90s. They were teenagers when the movie came out. Every vehicle was relative in their timeline. Soundwave being a satellite made logical sense than a damn tapedeck. Seeing them scan a vehicle to take on a disguise from their alien bodies made sense. To have them not look like anything relative to earth vehicles while living on Cyberyron makes sense.
      And let's not forget every movie had a plot and sub-plot. No matter how cheesy.
      1. Boy finds car robot/ searching for the cube
      2. Boy wants to save robot leaders life/ matrix of leadership/star harvester
      3. Robot leader finds mentor/Sentinal Prime/turns traitor/ pillars to bring Cybertrin to earth and turn earthlings into slaves to rebuild Cybertron
      Are you catching on?
      Regardless of what happened in between there was a purpose from point a to point b. The BBM had none of it. No plot relative to BBs purpose for even being on earth. And nothing he did throughout established that. Then you have a girl teaching a warrior robot how to hide?....anyway. this was a good movie. But I'd rather watch the Transformers Movie one. DOTM, AOE. over this any day. I'm a 70s baby. I grew up on G1. But I also understand that this is new age. The G1 cartoon and movie was great for my generation. The live action G1 generation if the Transformers is for my kids who are now adults and still love their Beyverse G1 generation. That's for them. Who am I to infringe on their generation? I had mine and now I'm enjoying theres and proud to know that their generation of the transformers was inspired by mine. By which I get a better since of appreciation for Bayverse.

    • @thanhclips
      @thanhclips 5 лет назад +4

      It was that simple. The last transformers movie bombed and the fans had enough. They weren't gonna go watch it. Look at X-Men 3. It did great bc X-Men 2 did great even though it was a bad movie. Having the previous movie doing good helps the next one.

  • @LuisLopez-ub4pp
    @LuisLopez-ub4pp 5 лет назад +406

    Bumblebee makes the quality all the latest Bayformers movies. And I felt the first time that a film based on the transformers I really got pleasure and no irritation!
    Bumblebee workes because the Director of this film takes care of the "Character" and his development, not the explosions, action and sea of toilet humor. (Take in example the same scene, where Bumblebee simply pissing on agent Simons)

    • @Commander_Shepard.
      @Commander_Shepard. 5 лет назад +3

      Still unironically funnier than any scene that had Charlie's family. Especially that annoying little brother. Urggghhhh

    • @XepptizZ
      @XepptizZ 5 лет назад +7

      Yeah, it had character, but noactual developement. Shit just "gets resolved" for no real reason. Suddenly the family is fine and suddenly bums and charls have to split. She was also a useless character through and through. Only near the end was she useful. And saving someone through the power of love doesn't count, that's the cheapest plot device ever invented by anime.

    • @Commander_Shepard.
      @Commander_Shepard. 5 лет назад +13

      @@XepptizZ I know I'm gonna get lot of shit for this but Sam had more development is first movie than Charly did in "character-focused" Bumblebee movie.

    • @MrAsh1100
      @MrAsh1100 5 лет назад +1

      @@XepptizZ Hey hey, Anime didn't invent that kind of power plot! Anime told love to kill itself......oh dear....

    • @XepptizZ
      @XepptizZ 5 лет назад +7

      @@Commander_Shepard. Development? The only development is from the army guy, he gets called to action by nearly dying, because of aliens. Gets blinded by hatred. Double whammy when his suspicions get confirmed by the decepticons deceit. Than reconciles with bumblebee after seeing the truth. That is more character development than all the other characters from the movie combined.

  • @fawnw7778
    @fawnw7778 4 года назад +539

    focus on the character didn’t kill it, aquaman did thats literally it

    • @calebweldon8102
      @calebweldon8102 3 года назад +59

      Yes people always try so hard to get why movies don’t make money but it’s usually just (competition)

    • @dr.boring7022
      @dr.boring7022 3 года назад +55

      Not just Aquaman, but the best movie to come out around that time: Spiderverse

    • @IconicProps
      @IconicProps 3 года назад +2

      Except Aquaman was garbage. Which boggles.

    • @lye27
      @lye27 3 года назад +2

      @@IconicProps 1B in theaters buddy. How is that garbage?

    • @ogrimzyz8643
      @ogrimzyz8643 3 года назад +6

      @@IconicProps yeah aqua man is ok, but it dominated the cinemas when it came out

  • @HinchMellow
    @HinchMellow 3 года назад +103

    Bruh the reason why he doesn’t ack like an adult is because he lost ALL HIS MEMORIES

    • @mawa-chanmanaha7472
      @mawa-chanmanaha7472 3 года назад +33

      And he is in a foreign planet and is curious about things like that~

    • @HinchMellow
      @HinchMellow 3 года назад +8

      @@damll2975 doesn’t mean they know anything about living
      They basically become a child again. Needing to relearn everything

    • @atheistmando4976
      @atheistmando4976 3 года назад +6

      @@damll2975 technically true. But also not true, as he was learning to converse with people. That, and language is an identity that even in people with amnesia, still are capable of processing. As well as childish manurisms, the childish manurism can be explained with PTA Post Traumatic Amnesia, where they lose all memory, but will have a tendancy to act child like. Tho i dont agree entirely with connor. It just shows how much you know about amnesia.

    • @sub-zero5433
      @sub-zero5433 3 года назад +3

      he should still have his soldier instincts bruh. and even if he didn’t have those he’s an adult alien robot, not a kid

    • @damll2975
      @damll2975 3 года назад +1

      @@sub-zero5433 exactly like there are somethings a solider never forgets like how to handle a gun or change a baby’s diaper

  • @rsfilmdiscussionchannel4168
    @rsfilmdiscussionchannel4168 5 лет назад +133

    A flop, despite the fact that it ultimately made back it's money, has now been branded as a reboot and has a sequel in the works. It struggled for sure, but it ultimately came out well.

    • @bruceleeds7988
      @bruceleeds7988 5 лет назад +2

      Wow not even YOU said the movie is good

    • @rsfilmdiscussionchannel4168
      @rsfilmdiscussionchannel4168 5 лет назад +10

      @@bruceleeds7988 It is. Most people thought it was, so I didn't feel like stating that.

    • @natesmodelsdoodles5403
      @natesmodelsdoodles5403 5 лет назад

      @@rsfilmdiscussionchannel4168 exactly. it'd be a fairly redundant thing to say.

    • @m.a.k.dynasty4504
      @m.a.k.dynasty4504 5 лет назад +2

      @@rsfilmdiscussionchannel4168 Not everybody thinks that way about it though.

    • @knucklejoe26
      @knucklejoe26 4 года назад +7

      @@m.a.k.dynasty4504 and not everybody thinks its bad, what's your point?

  • @botbee2316
    @botbee2316 4 года назад +142

    Here’s the thing, I think that the explosions have a reason to happen in Bumblebee. If an asteroid with an autobot or deception in it it will crash down hard! Also considering Shatter and Dropkick ran into a gas station.

    • @minchai2943
      @minchai2943 3 года назад +17

      These are the justified explosion

    • @orhandalegend
      @orhandalegend 2 года назад +9

      i mean in the bayverse movies even their machine gun rounds cause mini explosisons to pierce enemy armor

    • @aetheriox463
      @aetheriox463 2 года назад +6

      @@orhandalegend crosshairs falling over literally caused explosions

    • @orhandalegend
      @orhandalegend 2 года назад +3

      @@aetheriox463 have you heard of dust and sparks?
      seriously, if you are calling sparks explosions, the you shouldnt criticize the movies

    • @aetheriox463
      @aetheriox463 2 года назад +1

      @@orhandalegend no no they were actual explosions, just small ones. it was in TLK when cogman broke his finger. if it was just dust then sure but it wasnt, it was a few mini explosions

  • @mrsirdba
    @mrsirdba 5 лет назад +55

    I feel like the plot is driven by the deceptions, they have goals, the autobot side is character, deceptions are plot

  • @fly1714
    @fly1714 3 года назад +68

    Filmento: "Bumblebee has no plot"
    Slice of Life Anime:

    • @austindemuynck9460
      @austindemuynck9460 3 года назад +16

      Tru. But this ain’t anime. This is a galactic civil war between giant transforming robots that beat the crap out of eachother because of different ideologies. Pretty sure that’s not a slice of life. Unless you mean having *Half* of Jazz

    • @icecreamhero2375
      @icecreamhero2375 3 года назад +12

      That's different. When you turn on slice of life anime you expect silly shenanigans. Also when a show is 20 minutes you can basically do whatever you want. A 2 hour movie is trickier.

    • @babyroxasman
      @babyroxasman 3 года назад +4

      No I feel like SoL still have plot. They at least let you know what the entire episode is going to be about

  • @justanothergeek6379
    @justanothergeek6379 5 лет назад +94

    And you talk about there being no subsatnce to drive the plot ,well you could also argue that adventure and charlie's quest to get over her dads loss is something that drives the plot.

    • @aztn19
      @aztn19 5 лет назад +8

      Just another geek true, though it has nothing to do with Bumblebee’s amnesia nor mission to protect Earth. This movie has the same problem as Solo: it was a side story that was expected to make as much as the main franchise films

    • @Team974
      @Team974 5 лет назад +1

      True. But the movie is called bumble bee.

    • @LeaderOfTheLostSouls
      @LeaderOfTheLostSouls 5 лет назад +2

      Just another geek She did have that goal and it was connected to the car she was trying to fix till she gave up and got bumblebee which is a bit Eh
      But yeah I see what you mean overall
      I enjoyed the movie but it could of been handled better with the goals of the characters cuz it can be about personal goals if done well

  • @predaking8230
    @predaking8230 5 лет назад +116

    Bumblebee is more in line with the Iron Giant rather than E.T. And he was acting childish because he lost his memories and was exploring a new, strange world.

    • @MoLetalis
      @MoLetalis 5 лет назад +5

      True, but the Iron Giant is basically E.T. but with a robot.

    • @predaking8230
      @predaking8230 5 лет назад +3

      @@MoLetalis Because E.T. came first. If it was the opposite, if Iron Giant had come before E.T., then we'd be having the same conversation but flipped.

    • @MoLetalis
      @MoLetalis 5 лет назад +1

      @@predaking8230 exactly my point. Iron Giant = E.T. but more people know E.T. because it's a more original and classic movie than Iron Giant

    • @predaking8230
      @predaking8230 5 лет назад +1

      @@MoLetalis Your point isn't valid. Saying E.T. is better because it did the "Person and their other-worldly companion" trope doesn't mean anything. It just did it first, like I said. You wouldn't compare HTTYD to E.T.? Both play the trope, but instead of an alien one's a dragon.

    • @MoLetalis
      @MoLetalis 5 лет назад +1

      @@predaking8230 Why do you keep bringing up these other subjects? I never said E.T. is a better movie. I'm just saying it's a more widely known and original movie and that therefore Filmento is comparing Bumblebee to that film. He could also have compared it to Iron Giant, yes. But it is not as famous and is just one of those films that is more or less the same as E.T. but with a slightly different setting, but also fun to watch.

  • @ghost_pl9259
    @ghost_pl9259 5 лет назад +113

    I think a better title would be "How lack of plot killed a movie". Focus on character does not always exclude plot.

    • @ghost_pl9259
      @ghost_pl9259 5 лет назад +7

      @Adrijana Radosevic Did you even watch the video? Plot and story shouldnt be considered the same thing.

    • @enderziom04
      @enderziom04 5 лет назад

      'Almost'

    • @SaintsBro217
      @SaintsBro217 5 лет назад +17

      The plot is pretty straightforward. Bee lands on earth, loses his memories and meets Charlie. Together they rediscover his past and save the world from the Decepticons. It's not Shakespeare or anything and it's rather silly to expect complex plots from a story like this.

    • @Michael_ORourke
      @Michael_ORourke 5 лет назад +9

      @@SaintsBro217 The movie has a plot but the two main characters aren't a part of it until the end, Bumblebee and Charlie have no goals until the very end when the Deceptions find Bumblebee. The subplot of the Deceptions coming to earth to find Bumblebee, then befriending the US government and getting their aid was actually more interesting because they had a clear goal. Like the video said, if Bumblebee/Charlie's goal had been to find/fix his voicebox then it would have made the movie more engaging. Characters hanging out and doing random things does not make an interesting movie.

    • @SaintsBro217
      @SaintsBro217 5 лет назад +8

      @@Michael_ORourke
      Their goals are also straightforward. Bee wants to make Charlie happy and Charlie wants to help Bee hide while they find out where he came from. I don't know why everyone seems to be missing this.

  • @Presto5L
    @Presto5L 3 года назад +89

    Bumblebee really gave me what I wanted, the story, the characters, funny and light hearted comedy, and that absolutely wonderful war on Cybertron scene. When you watched it you didn't feel like you were watching giant robots battling it out for control of the planet, it was like looking at humans fighting over whatever we'd fight over. That and Soundwave coming through with the vocals in the middle of the war.

  • @hicknopunk
    @hicknopunk 5 лет назад +717

    I liked Bumblebee. Probably my favorite live action transformers movie.

  • @darrylaz3570
    @darrylaz3570 5 лет назад +229

    Sorry, Filmento, I do not agree at all. The reason Bumblebee kinda flopped is because the competition. It was pitted against Aquaman and Mary Poppins Returns, both have already got huge box office results. Pitted against them both is literal suicide.

    • @captainobvious90
      @captainobvious90 5 лет назад +21

      The flaws he pointed out are valid, but doesn't necessarily affect the low turn out. Your reasoning is made much more sense imo.

    • @UltimateKyuubiFox
      @UltimateKyuubiFox 5 лет назад +28

      TheWorkingMachine Aquaman made more money than God that December. Their argument isn’t stupid, it’s substantiated. Aquaman was a massive blockbuster action-fest where Bumblebee is a smaller-scale movie from a franchise that had burned people before.

    • @TFanPage101
      @TFanPage101 5 лет назад +29

      Not to mention, Spider-Verse.

    • @cyanrex1074
      @cyanrex1074 5 лет назад +6

      TFanPage101 Yeah it’s really a surprise bumblebee made enough money in general. It’s like when they put solo against infinity war and Deadpool 2 even if fans didn’t want to go see it, it probably would have failed

    • @16bitworld2
      @16bitworld2 5 лет назад +4

      Not only that, but Bumblebee is a solid character yes but he is not popular enough to draw a huge crowd

  • @MarkyMatey
    @MarkyMatey 5 лет назад +54

    There are plenty of movies that aren't ordained by plot, but by characters.
    I found it refreshing that a blockbuster is less occupied by plot and more with characters.

    • @adrianbundy3249
      @adrianbundy3249 5 лет назад +7

      Even those movies mostly focusing on characters still have plots. The good ones anyway.
      There are two types of writing though, both with good and bad examples: Stories where plots drive the characters, and stories where characters drive the plot. A generic movie like Independence Day is a good example of the former, and Game of Thrones, at least early on - had great examples of the latter. But make no mistake, there was still deep plot threads. Good cinema almost always has to have plot.

    • @android19willpwn
      @android19willpwn 5 лет назад +2

      it's fine to have something more focused on characters than plot, but focusing exclusively on characters will cause many people to lose engagement at one point or another, as the runtime stretches on without a feeling of progression to keep them invested. I'm not saying you can't do that and have it be good, but as he said that's the plot of a low-budget indie film. It's not going to be as engaging for a super wide audience and it's extremely difficult to market to that wide audience, so it's difficult for such a film to make summer block-buster levels of money. And that's a problem when you're pouring summer block-buster levels of budget into special effects and marketing.

    • @Michael_ORourke
      @Michael_ORourke 5 лет назад

      Character's actions should drive a plot forward. The main character's actions in Bumblebee do not drive the plot forward, therefore creating a feeling of stagnation while watching the movie. I felt slightly bored watching this movie and had a hard time figuring out why until I saw this video. I have no problem watching a slow moving character drama as long as character's actions cause things to happen in the story, otherwise the characters end up not being interesting. Charlie was set up as an interesting character but she doesn't do anything interesting in the movie.

    • @johnnyskinwalker4095
      @johnnyskinwalker4095 5 лет назад

      well you have to have an interesting story. which it didn't have

    • @ReaperBlaze76
      @ReaperBlaze76 5 лет назад

      @@Michael_ORourke Charlie starting up Bee is literally what makes the Decipticons come to earth.

  • @MAN-zg7dj
    @MAN-zg7dj 3 года назад +222

    This design of bumblebee is literally the best one.

    • @minchai2943
      @minchai2943 3 года назад +8

      Like the design is much more simple like g1 yet it is still live action

    • @MAN-zg7dj
      @MAN-zg7dj 3 года назад +1

      @@minchai2943 still better

    • @kaizarkthetitan0
      @kaizarkthetitan0 2 года назад +9

      @@MAN-zg7dj hell no

    • @g.d.graham2446
      @g.d.graham2446 2 года назад +1

      It is cuter

    • @jareejones
      @jareejones 2 года назад +1

      @@kaizarkthetitan0 lol fr

  • @187SicknesS
    @187SicknesS 5 лет назад +153

    I watched this movie last night for the first time and was on the wall about it...but, there was one thing that made watching this movie worth it.
    SOUNDWAVE

    • @187SicknesS
      @187SicknesS 4 года назад +4

      @Requiem Eye yeah, boomer cuz someone finally got Soundwave right in a transformers movie 😼

    • @GoodwillWright
      @GoodwillWright 4 года назад +12

      When Soundwave invades Earth.
      "Duuuude, look at this trash. He can't even transform into a bluray player".
      Jokes aside, I always loved Soundwave. Not sure why, he was kinda the cool character. And Laserbeak, Ravage and the Rumblers were also pretty cool.

    • @austindemuynck9460
      @austindemuynck9460 3 года назад +3

      @@GoodwillWright next movie should have been a dance battle between Soundwave and Jazz.
      Shit would have been fire

    • @aetheriox463
      @aetheriox463 2 года назад

      @@austindemuynck9460 no no no they should bring back blaster and have a stand off between them like every time they fought in the cartoon. THAT would be fire

  • @eomersimbajon2938
    @eomersimbajon2938 5 лет назад +271

    bruh, you just literally said he lost his memories. thats literally the reason why Bee is being like a child. A CURIOUS CHILD. he literally has no idea NOR DOES HE EVEN KNOW, what are the things around him.

    • @k.s.2935
      @k.s.2935 5 лет назад +70

      Depends on the type of memory loss. Usually people don't revert and become infantile when they lose memory. That was done in this movie to make Bumblebee "cute" and appeal to family movie audiences. Otherwise, Bumblebee has more issues than being the lamest Transformer.

    • @hthrun
      @hthrun 5 лет назад +32

      @@k.s.2935 I also don't think they explained enough how his memory worked. It wasn't technically erased because it came back later on when Charlie shocked him. Why did it come back then and not when he stuck his finger in the socket? Where was all that data in the meantime, a back-up drive? If so, why didn't it get reloaded automatically? If it was due to damage, Charlie shocking him shouldn't have brought it back, unless there's some healing aspect involved. But the movie didn't explain any of that, it was just another thing that just happened out of convenience.

    • @Sichko021
      @Sichko021 5 лет назад +7

      @@k.s.2935 Dude i will say only this... thank you for comment.

    • @catcatcatcatcatcatcatcatcatca
      @catcatcatcatcatcatcatcatcatca 5 лет назад +12

      Honestly there is no good explanation needed for bumblebee to act childisly. The problem with scene mentioned is that it's a lazy way to get detected.
      Bumblebee crushes cars and causes mayhem, but it only now matters? Audience will be cheated by that, as there is no coherent build-up. If anything, by the end bumblebee should cause less random mayhem, and be harder to detect. This is just another gag with no significant emotional loading. Important moments need already established emotional loading, a logical reason, or another significant aspect to work. Audiences don't complain about deus exmachinas unless they are both logically and emotionally unexpected.
      So I agree, this video misses the fault here. Bumblebee could act childlishly for any reason, and it wouldn't significantly worsen the movie. What matters that his actions and what follow from those actions is coherent.

    • @jeagerkej3171
      @jeagerkej3171 5 лет назад +7

      Rygart Arrow no, he acted like a fucking moron for the sake of the plot, because the writers are too fucking lazy and shitty to figure out how to move the plot forward otherwise.

  • @RowZilla42
    @RowZilla42 4 года назад +40

    actually no bumblebees a Child Soldier most versions of him he's born during the war

  • @defalt30
    @defalt30 3 года назад +44

    "Why does he act like a dumb little baby"
    That made me die of laughter 😂😂😂

    • @mrmercy554
      @mrmercy554 3 года назад +11

      You know good question oh wait it’s not literally the movie tells you why.he lost his memory at the beginning it told you that at the end of the blitzwing fight,it said “memory core failure”.

    • @NurseAmamiya
      @NurseAmamiya 3 года назад +4

      It's no surprise. Bumblebee acted similar in the first three bay films too.

    • @ultar2105
      @ultar2105 3 года назад +1

      @@mrmercy554 i hated blitzwing he didn't even look like from G1.

    • @youngmelo4963
      @youngmelo4963 3 года назад

      @@ultar2105 knight straight up said sorry about how blitzwing looked

    • @ultar2105
      @ultar2105 3 года назад

      @@youngmelo4963 he said that?? Even though he was the who made the movie.

  • @JaeTheGent
    @JaeTheGent 5 лет назад +85

    Crazy part, I'd totally watch a flick about the avengers just hanging out

    • @android19willpwn
      @android19willpwn 5 лет назад +19

      sure, but that's because The Avengers is riding off of a lot of character familiarity and series good will. Neither of which were luxuries that Bumblebee enjoyed.

    • @Michael_ORourke
      @Michael_ORourke 5 лет назад +5

      It'd be fun for about the first 10-15 minutes but it would get quickly boring without some kind of story.

    • @_V.Va_
      @_V.Va_ 5 лет назад

      Eating schwarma.

    • @goku21youtub
      @goku21youtub 5 лет назад

      *Mr. Jae Gentleman Extraordinaire* , wants to sound smart , sounds like a moron

  • @snacktime2497
    @snacktime2497 5 лет назад +397

    Yeah...Bumblebee wasn't a failure. It was the only good Transformers film to date, and the studio has stated that they were happy with the film's financial performance.

    • @Napzie
      @Napzie 5 лет назад +6

      Idk about that i tried to like it but the movie tried to be emotional for no reason.

    • @mariobadia4553
      @mariobadia4553 5 лет назад +52

      @@Napzie Better than EXPLOSIONS, SEXY WOMEN, USELESS RELATIONSHIP GARBAGE, MORE EXPLOSIONS, AND ROBOT BALLS!!!!!!!! TRANSFORMERS IN THE MEDIEVAL TIMES FOR NO REASON!!!!!!! EVEN MORE EXPLOSIONS!!!!

    • @Commander_Shepard.
      @Commander_Shepard. 5 лет назад +9

      Transformers 2007 is still waaaaay better than all of these IMO. Ones you get the G1 nostalgia glasses of cause.

    • @Commander_Shepard.
      @Commander_Shepard. 5 лет назад +9

      @Black Ninja I KNOOOOW right! I couldn't stand Charlie's moronic family and how much they got shoved in to the plot. As much as wierd Sam's parents were, they got out of the way when real action begin. And that girl bullies part. Who gives a fuck about "bullies", when Decepticons or literally on verge of taking over the planet.
      Charlie's brother tho....ughhhh...

    • @Napzie
      @Napzie 5 лет назад +4

      @Henry Louis21 All they did was spend a few days together then cry for each other at the end there was no build up what so ever for this emotional relationship between the two. Before i saw that movie i saw Into the Spiderverse and that movie made me get in my feels more than transformers.

  • @pradityapascalisprawito3153
    @pradityapascalisprawito3153 4 года назад +113

    Your perspective definitely opened my eyes to why the Bumblebee film didn't get that high of a rating, but personally Im just glad this aint no Micheal Bay Explosives demonstration :D

    • @sinpancho3089
      @sinpancho3089 3 года назад +29

      Well, the best rated Transformers films are the first one, and this one. They both have a rating of 7.1, according to IMDB. The others are kinda just there. Personally, I really enjoyed the third one, which was Dark of the Moon.

    • @kingslayerx1716
      @kingslayerx1716 3 года назад +2

      @@sinpancho3089 same

    • @etam8099
      @etam8099 3 года назад

      @@sinpancho3089 3 and 4 for me

  • @KneeCapHill
    @KneeCapHill 6 месяцев назад +3

    When I'm in a terribile movie take competition and my opponent is filmento: 🤯🤯😱

  • @ChrisTheGoodGuy
    @ChrisTheGoodGuy 5 лет назад +48

    I love the G1-esk designs of the transformers in this film. I hope they keep them.

  • @hardygal2
    @hardygal2 5 лет назад +67

    I really really liked Bumblebee. In terms of family fun, straight up amazing looking Transformers action, and good characters, it's kinda everything I wanted in a Transformers movie after what we've been getting for the past twelve years -though i will say that i enjoyed the first transformers movie a fair bit- It's not perfect by any means, but I really enjoyed it.
    However, when you said that the movie had no plot, I took a moment to think and almost yelled "Oh, wow, you're right!" There was very little active-ness when it came to the characters... MAN, that's unfortunate ^-^' Ah well, I still like it, but I do hope that Bumblebee's character driven formula is taken and improved upon by actually having the characters DO stuff instead of stuff basically just happening to them

  • @HairryPoppins
    @HairryPoppins 5 лет назад +60

    To do this: To save earth and get the autobots a mother world to call home
    First they must do this: Take down Shatter and Dropkick and stop them from calling Shockwave, Soundwave, Starscream and every decepticon on funds from destroying earth and the autobots. There's your plot

    • @Tyranatronus
      @Tyranatronus 5 лет назад +12

      That doesn't happen until the 3rd act, and Bumblebee doesn't even know because he had amnesia up until that point.

    • @tutumazibuko2510
      @tutumazibuko2510 5 лет назад +16

      @@Tyranatronus that doesn't change anything from what the plot is

  • @horrorbeyondhumancomprehension
    @horrorbeyondhumancomprehension 3 года назад +92

    I loved Bumblebee so much, it's my favorite transformers movie. I agree that the plot was slickly lacking, but the characters were enjoyable to watch, so that made up for it. Also, just because a movie doesn't make much money more than it's budget, does not mean it's a flop

    • @geomania8533
      @geomania8533 Год назад +2

      Plus we could follow along to the story. Unlike the bay films where the plot would lead to one thing then another then another.

  • @FiloAri
    @FiloAri 4 года назад +25

    Hey man, I've been binge watching your video analysis on movies and it inspires me to actually make a great story with reasonable plots. I've been a writer in the past and lost interest since I have no clear destination of what my story is going for. After watching and listening to you and your criticism towards the movies you covered, my eyes were open, and I know, as a writer what mistakes I've made in the past, and now thanks to you, know what to fix and improve. Keep making amazing content. Giving you love and support. Take care always.

  • @danielcervantes7826
    @danielcervantes7826 5 лет назад +40

    A cybertronian soldier finds himself in an alien planet, and is under the orders to protect it

    • @zad_rasera
      @zad_rasera 4 года назад +1

      Generic, lol.

    • @zad_rasera
      @zad_rasera 4 года назад +14

      "Robot gets lost. Robot must protect Earth."
      Let's change that to
      "Robot with amnesia gets lost and suddenly gets attacked by bad guys. With the help of a human girl, the unlikely duo undergoes a journey to beat the bad guys and to get robot's memory back."
      There. It's intriguing, right?

    • @Tosevite6622
      @Tosevite6622 4 года назад +2

      Micah Rhorer “I found a planet that's well hidden. Earth. You will travel there and establish a base for us. Once we've gathered the others, we'll join you.” -Optimus Prime. He’s basically telling Bumblebee to protect Earth, is he not?

    • @danielcervantes7826
      @danielcervantes7826 4 года назад +2

      @Micah Rhorer Prime literally says it in the speech, and yes its supposed to be generic and cheesy as many of the G1 jokes were

    • @oofoof6577
      @oofoof6577 4 года назад +1

      That is the worst plot I have ever heard. TLK has a better story then that. I'm not even kidding.

  • @moduleheadindependentcreat8158
    @moduleheadindependentcreat8158 5 лет назад +43

    I agree with you completely, I loved the film but I feel John Cenas character was underutilized and the villains way more compelling...it was like he was just waiting to get caught instead of actively trying to get his objective done. It doesn't hit you square square in the face but it's obvious once the film is over.
    And your suggestions made sense. 😁

    • @orionlax626
      @orionlax626 5 лет назад +2

      John Cena's character wasn't under-utilised. All human characters are way over-utilised. We don't want humans, we want actual developed Transformers.
      Also, did you even watch the film? His only objective was to scout and secure the planet. It's not really something he has to put time and effort into. Plus, he couldn't even remember who he was, nevermind why he was sent to Earth. It's not a huge plot hole, it makes perfect sense.

    • @moduleheadindependentcreat8158
      @moduleheadindependentcreat8158 5 лет назад

      @@orionlax626 Cenas character was the only thing that posed a challenge to the aliens objectives, both deceptigons and autobots, he was unfortunately written to roll with orders instead of taking risks. He was very underutilized.
      Bumblebee had ample time to remembered who he was, he should have put more effort into remembering why he was there after seeing even only part of Primes transmission... Who finds an important message in his circuits and goes right back to trundling about? Did it have to take a second viewing, if I'm correct, to get going, was that really necessary? Couldn't all that time have been spent actually moving the plot forward more effectively?
      The human element is just as important as the robot element if you really want to sell the franchise to as wide an audience as possible. Good knows I'm not going to see this film if it's only robots jostling about

  • @shadowgames6164
    @shadowgames6164 Год назад +4

    The story is actually more close to the iron giant, and it’s obvious in the scene where bumblebee gets red eyes and starts shooting until charlie comes in to talk and stop him

  • @TGtornadoe
    @TGtornadoe 5 лет назад +24

    I’d say the plot of the story is about the characters learning to not stay stagnant. We know Charlie can’t stay an angry loner and we know that Bumblebee is a soldier who can’t keep acting like a child.
    The plot revolves around us knowing that these characters must have a turnaround at some point of the story.
    It doesn’t matter that Charlie didn’t save Bumblebee when she dives after him, what matters is through this action we see that Charlie has changed for the better.
    We see how much trouble Bumblebee gets into while he is acting like a child so we are waiting for his return to form. Tension is added due to the presence of the Decepticons making every minute Bumblebee doesn’t shape up a second closer to them attacking a defenceless Bumblebee.
    I see your point about the plot because I had to think about this for a few minutes and even then it’s pretty thin. However hearing that the Transformers movies might go back to how they were makes me so disappointed that you’ll have to forgive me and other Transformers fans if we feel obligated to defend the movie despite your reasonable observations.

    • @freemechanism6674
      @freemechanism6674 5 лет назад

      I think the problem with what you're describing is that it's more so based on what an audience knows about movies. Yes, we know that the characters have to eventually take action but that knowledge doesn't actually describe a plot or drive a movie. In fact, that knowledge makes it feel even slower the longer they're not being proactive in their story. And they can't really do that without any clear goals.

    • @TGtornadoe
      @TGtornadoe 5 лет назад +2

      That’s true. I wonder sometimes if I would have enjoyed this film as much as I did if I hadn’t have seen the failings of the other Transformers movies. I imagine the film would have received a less positive reaction if it had been released back in 2007.
      I also have a slightly different idea of why the movie wasn’t as big at the box office. Bumblebee himself, we have now had 6 films where Bumblebee is a large focus. I liked this movie but even I’m getting tired of seeing this character. His story has been done and if they really go ahead with Bumblebee 2, I feel like we’ll see even lower box office numbers.

    • @freemechanism6674
      @freemechanism6674 5 лет назад +1

      @@TGtornadoe I think if the idea was to take the series in a different direction then they should have went with a different take on Bumblebee and made that clear in the trailer. There's no real reason other than continuity with the films that the character can't speak.
      From what I understand in the original transformers he communicated just like everyone else. Something that simple could have given the audience reassurance that this was something different as well as helped redefine his personality.

  • @PutineluAlin
    @PutineluAlin 5 лет назад +36

    Bumblebee movie didn't take the elements from Steven Spielberg E.T. it took the elements from The Iron Giant.

    • @lonestarr1490
      @lonestarr1490 5 лет назад +8

      ... which, in turn, took them from E.T. So by the law of transitivity, he's correct.

  • @curtthegamer934
    @curtthegamer934 5 лет назад +8

    A girl finds a stranded alien robot, and they work together to figure out the robot's mission. That's the plot.

  • @sathirakatugaha974
    @sathirakatugaha974 Год назад +9

    Thank you, finally someone not saying Bumblebee is the greatest thing ever

  • @RisingPhoenix05
    @RisingPhoenix05 5 лет назад +15

    I feel like theres no plot because they tried to make this a tie in as a prequel, yet distance itself from Bayformers

  • @NICKatronMC
    @NICKatronMC 4 года назад +46

    1:21-1:39 I legitimately paused the video, grabbed my face and yelled out loud, "No, no, no oh my god please NO" when I got to this part
    They did such a decent job at worst and the fact they want to undo it-

    • @quantum.starhop
      @quantum.starhop 4 года назад +2

      Shia Labeouf: nononononononononononononononono

    • @primus0348
      @primus0348 3 года назад +8

      I think what they meant was they want to bring back the action that was in those films while not making a mess of shaky cams and not knowing whats going on like bayformers,
      but if its coming from Lorenzo then i can understand why its a no

  • @scaramri782
    @scaramri782 5 лет назад +268

    It wasn't a failure.
    It wasn't directed by Bay.
    It was entertaining.

    • @johnnyskinwalker4095
      @johnnyskinwalker4095 5 лет назад +9

      and they won't make another one lol

    • @ryanchia8764
      @ryanchia8764 5 лет назад +4

      @Primus The Fourteenth what movie doesn't?

    • @rajarajanmanoharan
      @rajarajanmanoharan 5 лет назад +4

      If you were entertained by this movie, then you have really low & crappy tastes in my humble opinion. LOL.

    • @rajarajanmanoharan
      @rajarajanmanoharan 5 лет назад +1

      Hayden_ Exactly

    • @LeaderOfTheLostSouls
      @LeaderOfTheLostSouls 5 лет назад +7

      Well you two guys should chill and not be snobby little cocks
      It’s your opinion vs their opinion who cares about entertainment that’s subjective you morons
      Yes this movie is flawed and it lacks a plot or goals for main characters that’s true
      No need to be an ass tho

  • @KR-P
    @KR-P Год назад +5

    You were right about the studio's reaction to critique/criticism. Also Rise of the Beast has similar plot issue: Noah is about to destroy the transwarp (weird name) key which will stop Unicron from reaching earth ✅ But then he decides not to cuz...Optimus ❌. This scene could have been cut or made into a conversation and the plot would be unchanged. But imagine if Noah followed through but failed or even crazier actually succeeded in destroying it!

  • @corndogmaster12345
    @corndogmaster12345 5 лет назад +174

    Transformers lost it's value. All of the goodwill for transformers was used up. People are done with the franchise.

    • @TheUruse
      @TheUruse 5 лет назад +24

      I wish that applied to Fast and Furious.

    • @defiantwanderer7385
      @defiantwanderer7385 5 лет назад +28

      More like done with Michael Bay’s shit

    • @TheFalladin
      @TheFalladin 5 лет назад +5

      @@TheUruse The F&F franchise knows what it is, and in the end of the day you do care about the characters. While in most Bayformers it just became vissual noise because you did not care about any of the characters, oh look at Autobot got sliced in half, who was he and why should I care what happens to him?

    • @vladimiradidas1945
      @vladimiradidas1945 5 лет назад

      @@TheUruse at least fast & furious has some good movies and took some risks here and there. With Transformers, its the same bullshit over and over.

    • @muhaoai4693
      @muhaoai4693 5 лет назад +2

      @@TheFalladin It also doesn't help that because of the designs, once they get into a close quarters fight they tend to blur into a mass of grey with a few splashes of colour, plus the fights tend to degenerate into wild swings. The fight choreography in Bumblebee was a lot more interesting, especially since Bee was primarily yellow, Dropkick blue and Shatter red you could easily tell who was who. Plus they actually incorporated transformation into the fights, which I can't remember seeing in the Michael Bay films since... the first? When Starscream flew in guns blazing then transformed to engage the Autobots.

  • @TheAxelandx1
    @TheAxelandx1 5 лет назад +204

    You do realize this is the best Transformers movie to date, right?

    • @bernardoheusi6146
      @bernardoheusi6146 5 лет назад +23

      The first still is the best - or least worse...

    • @aliuniversal4100
      @aliuniversal4100 5 лет назад +24

      Thats a v e e e e r y low bar

    • @lockpinos
      @lockpinos 5 лет назад +20

      I think the first one is the best.

    • @Hybrid10Prime_Creative
      @Hybrid10Prime_Creative 5 лет назад +6

      He effectively said that

    • @thekerminator6521
      @thekerminator6521 5 лет назад +18

      Nah nah lads you’re forgetting the best transformers movie. The og 1987 transformers movie.

  • @BSJINTHEHOUSE420
    @BSJINTHEHOUSE420 5 лет назад +154

    It flopped because people don’t like bees.

  • @neonbunnies9596
    @neonbunnies9596 3 года назад +10

    0:28 Flimento: For years and years, Paramount releases loud mindless action movies that make billions of dollars at the box office
    Transformers: The Last Knight: *Are you challenging me?*

    • @primus0348
      @primus0348 3 года назад +1

      More like: Who dares to challenge me

  • @milano7250
    @milano7250 5 лет назад +32

    why ET? u watched iron giant?
    I mean, kid meets robot
    government wants to destroy that robot
    then robot does something cool at the end

    • @MoLetalis
      @MoLetalis 5 лет назад

      Yeah, but Iron Giant is basically E.T. so I guess he liked to compare Bumblebee to the original.

    • @MoLetalis
      @MoLetalis 5 лет назад

      @Henry Louis21 You name the only (irrelevant) difference, and now I'm supposed to tell you all the comparisons? That's not how it works. I liked both E.T. and The Iron Giant, but it's obvious which one is more original.

    • @alexhorbacz1547
      @alexhorbacz1547 5 лет назад

      Well. Bumblebee lives at the end so that could be a reason. Plus Iron Giant was a complete failure finacially when it first came out. And the critics were mostly lukewarm towards it. The only reason it got any momentum was because of home releases and tv network re-runs.
      It is still amazing though and I watch it every year.

  • @rkramer5629
    @rkramer5629 5 лет назад +27

    How did you not use the JOHN CENA!!!! Sound clip every time you were about to say his name lol 😂

    • @Xpzilla
      @Xpzilla 5 лет назад

      It'd be annoying. Plus that meme's like 4 years old now.

  • @yamuna6154
    @yamuna6154 4 года назад +16

    The plot was for Bumblebee needs to set up a rendezvous point for the Autobots. But he lost his memory. How did you miss that?

    • @austindemuynck9460
      @austindemuynck9460 3 года назад +4

      Yeah. But the goal for bee to regain his memory isn’t there. Without that goal, we loose those two other plot points

    • @edwardjamespepito
      @edwardjamespepito 3 года назад +2

      He intentionally missed it so he can have this content. easy :D

  • @noahfuc7131
    @noahfuc7131 Год назад +4

    I think it could’ve been pretty neat for Optimus to have initially given a real debrief to Bumblebee, but it glitched out or broke and all he got through was ‘Protect the Earth’. It’s an intangible and confusing goal. It could just be Bumblebee trying to figure out what the hell that means by finding Optimus or doing something else, or just entirely misinterpreting the message for comedy

  • @sorrycashonly5651
    @sorrycashonly5651 5 лет назад +76

    it failed? It still has a box office of 468 mil... That's pretty decent.

    • @gwenc1371
      @gwenc1371 5 лет назад +16

      Yeah, that opening bit about it 'barely making it's money back' is bullshit. It definitely wasn't a smash hit, particularly stateside, but it did well enough. Particularly when you remember all transformers films, way back from the start in 1986, are vehicles for toylines.
      If the toyline is selling well enough, and the film didn't completely tank, there'll be a sequel.
      This entire video feels like it missed the point a bit, honestly. Even going with the premise of it being a failure(which, sure, I doubt the producers were terribly happy with the numbers so we'll go with it), it has nothing to do with the story and everything to do with the fact that the franchise's reputation has been run into the ground by Michael Bay. Trying to take the franchise in a less Bayhem-oriented direction, without some serious advertising work and a hardcore media blitz emphasizing that change, is going to alienate the only audience paying attention to Transformers these days and result in a minor 'flop'. It's got nothing to do with the plot.

    • @ryanbarker5217
      @ryanbarker5217 4 года назад +8

      it was a moderate success, but not something that inspires great confidence in investors, imo. a big part of that is it was a success in china where they take more of the box office. you're much better off having a domestic hit than a foreign one. if the domestic numbers were better, it would be a big selling point. china can be fickle, but you also have to compete with chinese movies, too. i imagine it's tricky to position your movie for both markets, which is why it was killed here going against 'aquaman,' but maybe did well there because there weren't any new chinese releases posing much threat, i dunno.
      when your budget is $135M and you only gross $127M domestic, hm, you're going to have to really put on your salesmanship hat to convince me to open up my wallet. bear in my we're in an era where it's getting to be $700M is just so-so. true, the movie didn't cost as much as the others, but it wasn't cheap. sequels aren't expected to do as well as the first, either. plus, it doesn't have any big names attached to it.

    • @grandparamsayy5068
      @grandparamsayy5068 4 года назад

      The only thing I like is probably the opening scene

    • @nuwandelacruz9630
      @nuwandelacruz9630 4 года назад

      @@ryanbarker5217 this was actually the number 1 foreign movie in China the entire year. The problem is really the marketing of bumblebee and the producer admitted that and even claimed that bumblebee earned more profit than the last transformer movie because of the marketing cost. Anyway bumblebee is apparently going to have a sequel that will continue the story of Charlie and bumblebee. If the next movie won't sell then despise a heavy marketing then I guess the problem is really with the franchise. Until then we can only settle with how hailee and travis made this movie remarkable critics wise.

    • @ryanbarker5217
      @ryanbarker5217 4 года назад

      @@nuwandelacruz9630 the chinese market is like trying to entertain children. that's not to be a racial thing, simply pointing out what's been said in the movie industry a million times, so don't kill the messenger on that one. having worked with the chinese for three years, well, they don't tend to be as sophisticated as we are, so i do hate to agree with hollywood's true feelings on the market, but experience leads me to mostly agree. i used to watch a lot of videos on inside china, typical life, culture, that kind of thing, and it was like, ugh, these are helping me try to prove hollywood wrong.
      you can choose to think those are the ramblings of some random interweb asshole and i'd get that... but, that doesn't detract from the veracity. i mention all that to set a stage wherein the movies are altered to fit that market, and so goes the marketing. (you may notice an uptick in toilet humour, giant robots and dinosaurs/monsters, in inclusion of chinese cities, etc.. this is shit that market loves. black guys not so much, which is why finn was reduced in the chinese poster. the chinese are famously racist, after all.)
      american marketing was admittedly awful, it projected the movie as being some kind of post-apocalyptic war zone. but, it was also clearly another SJW thing, something that we are all so very tired of seeing, and it was just another lame script based on the 'save the cat' formula, which you should really check out if you don't know what that is (or just read the book, it's a fast and entertaining read especially for a how-to-write-screenplays -- you'll discover there's virtually zero story or character creativity in hollywood). once you go SJW, your story is ruined, and this is what you get when you hire christina hodson, a laughable hack, to write it. (the movie isn't fresh in my mind, otherwise i could offer a long list of checklists it clicked off in support of their agenda-ized 'entertainment.' it's all there, though.)
      a sequel was greenlit based obviously on the chinese box office supporting it. here, a sequel probably won't fare tremendously better than the first, and a lot of that will be because it's not going to be written for us, it'll be, i hate to this term, 'dumbed down.'
      it wasn't just the marketing that killed 'the last knight,' the fact it earned more than 40% less box office world wide killed it while operating on the assumption and budget it was going to be another billion dollar movie. a major reason why 'bumblebee' did 'better' than that was because BB cost a helluva lot less to make, not that people embraced it. 'dark of the moon' was the shift in numbers, and domestic b.o. for the franchise has been in a freefall since.
      what we'll get is another domestic box office dud, but they hope the foreign markets will make them a profit. it'll be modestly budgeted, geared towards the chinese audience, and be another outdated agenda-driven groaner using the same tired fill-in-the-blank script formula. that's even if the production goes through at this point given everything, but assuming things return to some normalcy.

  • @peterrosa3093
    @peterrosa3093 5 лет назад +17

    Bumblebee is better than all of the Bayformers movies combined. I really wish it made more because now we're probably gonna go back to incomprehensible garbage and awful product placement.

    • @gavo7911
      @gavo7911 5 лет назад

      +023 Studios That’s a bit of a strange request

    • @sander6438
      @sander6438 5 лет назад

      Your opinion

    • @velkylev4217
      @velkylev4217 5 лет назад +2

      First trans movie is much better than this boring thing

    • @orionlax626
      @orionlax626 5 лет назад

      @@sander6438 Most people's opinion. Bumblebee is objectively better than all of Bay's films, except maybe the first.

    • @optimusprimeleaderofautobo2496
      @optimusprimeleaderofautobo2496 3 года назад +1

      Shu up shut up bayformers and pacific rim better that stupid bumblebee movie and sonic movie!!!!! You haters of bayformers!!!!

  • @AdamWParkerDotCom
    @AdamWParkerDotCom 5 лет назад +5

    @14:20 Cena / Gov't has the voice box and they almost get it and then it is destroyed at the low point. Then Bumblebee uses the radio as his voice in the 3rd Act turn because he and the girl have been listening to it a lot while bonding --- chills.
    This had so much potential.

  • @jonathancontreras5069
    @jonathancontreras5069 4 года назад +13

    i mean bumblebee was supposed to protect earth, wasnt till the decepticons showed up that he had to do some, what else could he have done besides getting to know charlie, dude was confused on his ‘ no plot’

  • @Yezpahr
    @Yezpahr 4 года назад +7

    2:11 WE'VE BEEN RICK ROLLED BY A MOVIE!

    • @Pirate_birb
      @Pirate_birb 9 месяцев назад

      2:12 🎵never gon-🎵 *explosion*

  • @friday6448
    @friday6448 5 лет назад +7

    Bumblebee was fantastic and I am so MAD it didn't make money.
    The marketing actually convinced me to see the movie

  • @thevoidismyhome7242
    @thevoidismyhome7242 5 лет назад +49

    I liked Bumblebee, and I don't care if it was a 'failure', I felt it was awesome.

    • @zad_rasera
      @zad_rasera 4 года назад +1

      He liked the movie, too. Just watch it.

    • @cosmicmuse2195
      @cosmicmuse2195 4 года назад +4

      Also just because one person doesn't like a movie doesn't mean you are not allowed to. Even if that person is a youtuber. You can like things and acknowledge flaws. They aren't exclusive to each other.

    • @keithdanielaltizen4780
      @keithdanielaltizen4780 3 года назад

      It's not totally a flop though, it grossed from 207million with domestic expenses to 468 million ' so its still a won situation.

  • @Caravaggio44
    @Caravaggio44 3 года назад +7

    The "voice search" idea is really good! Definitely would have improved this film. It was a good movie, but dragged because of what you said - lack of directed plot.

  • @kileyingram9259
    @kileyingram9259 5 лет назад +66

    I really like Bumblebee and I hope we get a sequel

    • @yongwaiking1642
      @yongwaiking1642 5 лет назад

      The sequel is bumblebee founded by Sam…

    • @lilclarity7943
      @lilclarity7943 5 лет назад +9

      @@yongwaiking1642 uh no, not the same universe

    • @largeformatmaster2994
      @largeformatmaster2994 4 года назад +1

      I heard a sequel is in the works, just haven’t heard too much since the announcement of a sequel.

    • @duckyjoel5373
      @duckyjoel5373 4 года назад

      WELL LET ME TELL YOU
      *THERE WILL BE*

    • @ryanbarker5217
      @ryanbarker5217 4 года назад

      supposedly there's one in development. we shall see. there's a slot for a paramount/hasbro movie in 2021. granted, i looked on wiki, but neither the director nor writer are listed as this being something they're working on. i view this as a *very* risky sequel.

  • @davidgantenbein9362
    @davidgantenbein9362 5 лет назад +5

    I found this a really good analysis of what was missing in the marketing to pull me in. They really had no plot to sell out side of „girl finds Transformer“. It may be a good movie, but they were given the task to reinvigorate the franchise after some serious Bay burnout. This needed some hook, something to pull audiences in.

  • @garrynewby1442
    @garrynewby1442 5 лет назад +21

    Your version of the Bumblebee story sounds like a mcguffin. It works and it's the strategy avengers 2 used to move the story forward until the arrival of the villian Ultron

    • @oreganopotatohead8901
      @oreganopotatohead8901 5 лет назад +4

      Ultron was a failure, bad point.

    • @adrianbundy3249
      @adrianbundy3249 5 лет назад +4

      Simple plots are still better than no plots... And a good simple plot well executed can still be an awesome thing to watch.

    • @adrianbundy3249
      @adrianbundy3249 5 лет назад +4

      @@oreganopotatohead8901Disappointment from expectations. Not a failure.
      Made more than it's money back. And has greater than 70% on both critic AND audience scores last time I checked; which admittedly, was awhile ago. It just wasn't the smash box office hit people wanted the sequel to the Avengers to be, and what the trailers almost sold us on (an awesome Ultron).
      It's just I get annoyed with people confusing the lack of delivery of something great or even very good - with something that was bad, simply because it didn't do that. No, it wasn't great; but it wasn't bad, it was just mediocre to good, depending on who you ask. And not a failure to make money either.

  • @ShadowReaper-pu2hx
    @ShadowReaper-pu2hx Год назад +4

    I always liked the Michael Bay Transformers movies and still like them more than the new ones.

  • @_somestuff
    @_somestuff 4 года назад +48

    Even though I agree with you what at the movie has no plot, it has another problem: the movie has the usage of g1 designs. Believe it or not, but it might be one of the issues it failed. Like one commenter wrote in the comments below, not everyone watches g1 and falls in love with it instantly. They might not. There are a lot of people who like Bayformers designs and prefer them more than the blocky versions.

    • @quantum.starhop
      @quantum.starhop 4 года назад +26

      I don't think so. Art design is mostly subjective and the G1 design appeal is a call for those nostalgic for the G1 series. That does not necessarily alienate new audience members. In addition, many of the designs are a sort of cross with G1 and Bayformers, which appeals to both populations of the Transformers audience.

    • @dapperdanman8486
      @dapperdanman8486 4 года назад +10

      I havnt seen anyone actually complain about their G1 designs. They looked great

    • @_somestuff
      @_somestuff 4 года назад +6

      @@dapperdanman8486 There are... some people. I personally like them equally, even though I grew up with Bayverse.

    • @quantum.starhop
      @quantum.starhop 4 года назад +4

      @@_somestuff I doubt that the occasional stick in the mud is representative of the audience in general, or even representative of a mimor portion of the fanbase though.

    • @bonelesschickennuggets1868
      @bonelesschickennuggets1868 4 года назад +2

      @@quantum.starhop I think the blocky designs are by war more watchable and comprehendible than... the weird shaped bots in bayverse, specially for the decepticons, I often get lost on who is who when they have similar body shapes, size and colors.

  • @jamesmorgan1142
    @jamesmorgan1142 5 лет назад +7

    6:50 because is memory was erased (partially) in the first combat

  • @demetraeconomou6096
    @demetraeconomou6096 5 лет назад +71

    Let me tell you something lad.
    *N O B O D Y CAN NIDE FROM JOHN CENA*