📰 Go to ground.news/drbrian to see through media bias and become a smarter news consumer. Subscribe through my link for 40% off unlimited access this month!
Our genes are like biological archives, holding clues to our evolutionary history and the journeys of our ancestors. Through genetic analysis, we can trace human migration patterns, discover ancient connections between populations, and uncover shared genetic traits that have helped us adapt to different environments. They also reveal the influence of natural selection, showing how diseases, climate changes, and diets have shaped us over millennia. Ultimately, our genes provide a powerful window into our collective past, offering insights into where we come from and how we’ve evolved into the diverse species we are today.
Thanks so much Brian. As a huge Dawkins fan I so often hear him repeat the same answers, thanks so unimaginative questioning. With your interview it has been a huge pleasure to hear you guys cover a bit of new ground!
Thanks so much! *What was your favorite takeaway from this conversation?* _Please join my mailing list to get _*_FREE_*_ notes & resources from this show! Click_ 👉 briankeating.com/list
DNA has an extremely high data density. It is estimated that one gram of DNA can store approximately 1.5 exabytes (1.5 billion gigabytes) of data. This is due to the fact that DNA encodes information at a molecular level, using sequences of four nucleotide bases (adenine, cytosine, guanine, and thymine). Storing 1 exabyte of data would require either tens of thousands of hard drives or hundreds of thousands of flash drives.
Goodbye Mr Chippy* - is this your Final Bow ? 😢😢😢😢😢😢 *a wordplay on that wonderful 1939 movie “Goodbye Mr Chips” and “Chippy” the affectionate name for Chipping Norton, the Professor’s ancestral home in Oxfordshire.
58:22- yes pain may be useful in teaching the organism not to engage in a particular activity which may cause it harm, (ie touching a hot stove), but why should something like menstruation and childbirth be so agonizing if they’re just normal bodily functions ?
Are they, to the majority of the women? Many women dont suffer from it. We have to zoom out even further to no be contamined by our way of life, civilized life with clock every day organisation, our way of eating industrialized food, pills ingestion... its just a guess. We need to zoom out sufficiently to think free from the things everyday people live. Our species didn't evolve fron only the last one hundreds years. For example, is this kinda menstruation pains are felt the same by indigenous population.
How the code of measure on the smallest scales is so well defined & ordered is amzing because lattus structure fludlike sandwich middle is messy complex hard and only gets more complex in environmental decay and gravity bound up tension in space. Our brain only see unform order of skin as if uniformly granted deterministic simplicity but it ignore all the hidden axioms of decay that we put under the microscope. If you begin at scale whee Jesus left over finger print starts and remain in that frame of reference on through its a very different picture on that scale than what we think we aee. Obviously, this is more metamorphosis, not evolutionary, but still, it has a time and place application none the less.
In reference to the wiring design of the human eye, the first camera sensors were designed exactly the same way with the wiring on the same side as the light sensing elements. Why? because it was so much easier although it was less efficient from a photo sensitivity standpoint. More recent camera chips employ a back grinding technique whereby the back of the Silicon wafer is thinned to allow light to reach the photo sites from the other side and thus avoid the wiring. So the obvious engineering approach is not always the most expedient. Perhaps nature "feels" the same way.
Are the Arts (music, painting, sculpture, literature etc) also an Extended Phenotype ? Why did humans evolve to create these things unless they aided in reproductive success ?
When are scientists going to figure out that the changes in the measures of time and distance due to the amount of gravity in the vicinity change the speed of light relative to our measures of time and distance where we are inside of a galaxy? Scientists can’t seem to figure out that where gravity changes time and distance it changes the speed of light and the rate of causation. Space is not flat in the measures of time and distance on larger scales just like the Earth is not flat on larger scales. Light MUST indeed *always* travel 186,000 miles an hour at the speed of light C. When distance is stretched from having less gravity, light must still complete traveling that distance in the time determined by C. That means the light is traveling faster as perceived by us in a more contracted frame of reference where there is more gravity. Add to that the fact that a second passes by faster away from the center of mass which increases the speed light MUST travel even more. It’s really not complicated. It’s so simple. It’s the very reason things appear to be moving faster than the speed of light moving away from the center of the galaxy because they are moving faster away from the center of the galaxy yet without exceeding the speed of light. I don’t know why that is so hard to understand. There are three rates to consider. 1. The diminishing effect or draw of gravity away from the center of mass. 2. The increasing rate of time away from the center of mass. 3. The increasing measure of distance away from the center of mass. Speed is measured by time and distance which both change and that changes the speed of light and causation. Things happen faster. Distance gets longer without gravity and time goes by faster, both of which combine to speed up causation. The light has to arrive at a farther distance faster when distance is stretched *and* time also goes by faster. *Then* there is the first thing to consider and that is the diminishing draw of gravity the farther away it is from the center of the galaxy which means things eventually slow down the farther away they are from the center mass of a galaxy. (It's not complicated. No dark matter is needed.) 😎 Redshift happens when light leaves a galaxy. Blueshift happens as light enters a galaxy. All things being equal, the light will be redshifted as it leaves a galaxy and then blueshifted back again as it enters our galaxy. Except we already know galaxies are different sizes. The distant galaxies that we can see are very large and the distances between here and there is excessive causing more redshift than our small galaxy can blueshift back to its original spectrum. The more distant a galaxy is the more accumulated gravity there is from nearby masses causing more redshift.
@@emmetbrown7228 You're describing every theist that ever existed. Dawkins works with evidence or the lack thereof. If evidence was discovered that disproved any of his hypotheses he would change it to include the data discovered or drop it and start again. Here's a quote from Dawkins on this very subject; "There was an elderly professor in my department who had been passionately keen on a particular theory for, oh, a number of years, and one day an American visiting researcher came and he completely and utterly disproved our old man's hypothesis. The old man strode to the front, shook his hand and said, "My dear fellow, I wish to thank you, I have been wrong these fifteen years". And we all clapped our hands raw. That was the scientific ideal, of somebody who had a lot invested, a lifetime almost invested in a theory, and he was rejoicing that he had been shown wrong and that scientific truth had been advanced." So you've advanced the hypothesis that Dawkins is driven by ideology, not evidence. Yet he holds the above anecdote highly enough to have repeated it in print, lecture & discussion many times. Your hypothesis seems to be discounted by the evidence. Your reply, or lack of one, should reveal if you are driven by ideology or led by the evidence. Don't take my word for it, I could be fabricating evidence. Go see if I am right that Dawkins thinks this way. Maybe read the book this appears in (I'd put money on you not doing this. Although I'd need evidence one way or the other 😆). So what say you? Do you withdraw your baseless claim, presented without evidence because, like most ley people, this is something you "feel" yet haven't researched. I await your reply with interest. Edit 24 hours later... No reply yet. Maybe the OP is busy. Let's give it another 24 hours before drawing any conclusions.
If we create AI beings which share our capacity for pain, both physical and emotional, along the ability to experience joy - then we have the moral obligation to treat them as our equals with the same rights and freedoms that we have. Which in my opinion, defeats the entire purpose of this enterprise in the first place. I thought the whole point of creating sophisticated computers and powerful robots is so they can aid us in complex calculations and perform the dangerous, repetitive & unpleasant tasks no human should/could ever do. If they also have “feelings” it’s simply another kind of slavery. Given our poor track record with how we treat biological life forms, would we treat artificial ones any better ? Apart from ethical considerations, there’s also the possibility that sentient AI could lead to humanity’s eventual extinction. Imagine trying to quell a rebellion led by beings way stronger and smarter than we are ! “The Terminator” might not be so far fetched after all.
If you ignore some very important parts of a theory, the theory will always be flawed and incomplete. Dawkins is no stupid dude, but he lacks something very important.
Showing head bangers and trance dancers as examples of music connoisseurs is a pretty poor way to illustrate the spiritual value of music or get to the difference between the Lord of the Dance and the Lurers to Lurid Dances
If any of the undead species in the multiverse offer Dawkins eternal life, I'm declaring war on that species. We don't need any more insufferable boors.
He makes it up as he goes along 😂 Who decides which body is beautiful or attractive . Continues to assign agency to chemical structures he calls genes and now viruses and still more bacteria? Will he next assign consciousness? Cooperative genes? A sociological term. Day by day he gets closer to Gaia ideology.
The only way quantum consciousness can get into the future is via reincarnation, and Karma is the force that guides it toward the experiences that create it's optimal future in the multiverse.
Since we are apparently looking into genealogies, enough with all of the disinformation. Neanderthals are Eurasians and Denisovans are a mix of Eurasians and Sino Canaanite tribe of Sinim with the D y-hg in Asia and or the House of King Nimrod’s descendants with the C y-hg both of which are Hamitic, Cushite and Canaanite. DNA migrations show that Native Americans crossed the Atlantic to Central America from the Mediterranean Sea. There are four or more haplogroup lineages that show this migration route, the A C&D maternal mtDNA lineages and the Q paternal Y chromosomal lineage as well as probably the C paternal y-hg lineages made this same crossing to Central America and then spreading north and south from there. People are ignoring actual known human history. The actual historical records and DNA migrations show that everyone spread out from Mesopotamia. Ancient history is essential for everyone to know, especially that of the sixteen original civilizations… that are from the sixteen grandsons of Noah. We should learn ancient history before trying to learn science. The following are the paternal Y haplogroups that make the most sense. 1. The first inhabitants of Italy (K) Tubal 2. Thracians (L) Tiras 3. Greek sea people (T) Javan 4. Siberians & East Asians (NO) Magog 5. Eastern Europeans & East Eurasians (P) Meshek 6. Medes (Q) Madai 7. Western Europeans (R) Gomer 8. Hebrews and Arabic (IJ) Arphaxad 9. Elamites (H) Elam 10. Assyrians (G) Asshur 11. Arameans (F1) Aram 12. Lydians (F2) Lud 13. Cushites (AB, C) Cush 14. Egyptians (E3) Mitzrayim 15. Canaanites (E2, D) Canaan 16. Original North African Phoenicians (E1) Phut The only way to determine the actual paternal lineages is with the Y chromosome. E1 is Phut, E2 is Canaan and E3 is Mitzrayim. The descendants of Cush are A B and C with C being the descendants of the House of King Nimrod the first King of the world with many descendants (reinforcing his genes) which was in Mesopotamia and Assyria otherwise known as the Sumerians. The descendants of Nimrod later spread to the Americas and Pacific islands. It’s the reason Olmec statues often appear Polynesian since they share the same common ancestor with Polynesians. In America it’s C3 and in the Pacific islands it’s C2. The D paternal haplogroup Sino descendants of Canaan migrated from Canaan east to Andaman Islands, China, all the way to Japan and Tibet. The C paternal Y haplogroup descendants of Nimrod migrated as far as South Asia, Australia, the Pacific, Mongolia, Europe and all the way to the Americas by way of Atlantic accounting for the Olmec civilization in Central America as well as the Q Y haplogroup descendants of Madai ancestor of the Medes that also crossed the Atlantic to Central America along with the maternal lineages of A C and D. The A maternal mtDNA haplogroup belonging to the *Semitic* N lineage accompanied the Eurasian Q paternal Y haplogroup to Central America. The C&D maternal haplogroups belonging to the *Eurasian* M lineage also accompanied the Atlantic crossing of the Q paternal haplogroup Medes and probably the C paternal haplogroup to Central America. The Semitic B maternal mtDNA haplogroup seems to have crossed on the other side via the Pacific Ocean to South America. The Mediterranean paternal R1b and the maternal X2a (also found in Galilee) represent yet another Atlantic crossing of the Phoenicians in the days of King Solomon considering also the additional Mediterranean paternal Y chromosome haplogroups of T, G, I1, I2, J1, J2, E and B in found in Native American today in addition to the R1b found in Native American Populations. J1 and J2 are Arabs and Jews. (I1 is most likely the tribe of Dan and I2 resembles the movements of the tribe of Asher) Of course there is also the Cohen 50% of which are J1 P58 known as the Cohen modal haplotype which identifies the IJ lineage of Hebrews and Arabs that are descended from Arphaxad. J2 M172 is the largest group of descendants probably of the House of the kings David and Solomon. Now you know a lot more of what is now verified human history. Neanderthals were Eurasians descended from Japheth and Denisovans are a mix of Eurasians and Canaanites and or Cushites descended from Ham. We know this because of the people living today who have Neanderthal and Denisovan DNA. The mtDNA maternal lineage of the out of Africa claim goes from African to Eurasian and then to Semitic while the Y chromosome lineage goes from African to Semitic and then Eurasian. So according to that Africans produced Semitic males and Eurasian females who then produced Eurasian males and Semitic females completely invalidating the Out of Africa claim. *The reality is that all of these various lineages had to have existed simultaneously.*
The irony of Dawkins saying you can’t opt out of science when it goes against your Faith. I think he does it all the time, he constantly misrepresents evidence to fit his narrative, he ignores evidence that contradicts his claims, and tries to suppress dissenting voices.He wants to spend more time on the science and less time on being a anti-theist if you ask me.
@@JonnyCook I’ll give an example of each: He often misrepresents evidence of common descent as proof for the theory of evolution. He ignores evidence that contradicts the theory, such as proof that the germ line can be altered through mutations to the somatic cells, the Weismann barrier is breached. He champions for the scientific community to rebrand the theory of evolution as fact not theory in a bid to end discussion as to its solidity.
If you would like to accept Jesus as your Savior, please pray this aloud: "Lord Jesus, I repent of my sins and surrender my life. Wash me clean. I believe that Jesus Christ is the Son of God. That he died on the cross for my sins and rose again on the third day for my Victory, I believe that in my heart and make confession with my mouth, that Jesus is my Savior and Lord."
@@jeffreyluciana8711 if you would like to accept the importance of factual evidence to guide your understanding of how you got here and what came before you, chant this aloud, ACGTTCAGTCAACTGTATCGCTAGTACTGCCATCGTGACGTTCAGTCAACTGTATCGCTAGTACTGCCATCGTGACGTTCAGTCAACTGTATCGCTAGTACTGCCATCGTGACGTTCAGTCAACTGTATCGCTAGTACTGCCATCGTGACGTTCAGTCAACTGTATCGCTAGTACTGCCATCGTGCCTGATAACCTTTAC
![What Is The Higgs Field? Matt Strassler [Ep. 460]](http://i.ytimg.com/vi/s6XHHxwbqi4/mqdefault.jpg)
📰 Go to ground.news/drbrian to see through media bias and become a smarter news consumer. Subscribe through my link for 40% off unlimited access this month!
Thanks for being a member of my community 😊😊😊
The Vatican cover up on The Next Level Soul. Check it out for some Alchemy understandings. 😮
Thanks for the interview!
@@sulljoh1 my pleasure
Splendid interview.
At 21:55, could you have ment (the Science article by) Phil. W. Anderson?
@@borisrotstein Thanks very much
Our genes are like biological archives, holding clues to our evolutionary history and the journeys of our ancestors. Through genetic analysis, we can trace human migration patterns, discover ancient connections between populations, and uncover shared genetic traits that have helped us adapt to different environments. They also reveal the influence of natural selection, showing how diseases, climate changes, and diets have shaped us over millennia. Ultimately, our genes provide a powerful window into our collective past, offering insights into where we come from and how we’ve evolved into the diverse species we are today.
another amazing discussion. thank you dr. Keating.
Really appreciate this !
Thanks so much Brian. As a huge Dawkins fan I so often hear him repeat the same answers, thanks so unimaginative questioning. With your interview it has been a huge pleasure to hear you guys cover a bit of new ground!
Masterfull delivery and raising complex thought.. love it 💕
Great subject matter. Excellent guest.
Thanks so much! *What was your favorite takeaway from this conversation?* _Please join my mailing list to get _*_FREE_*_ notes & resources from this show! Click_ 👉 briankeating.com/list
Richard Dawkins :D will be a great watch!
Fantastic! Tickets to 27th Oct London booked! See you Prof Dawkins!
sorry you are 10 years late it was in 2014 according to the description
@@belstar1128impossible as he only now published his latest book they talk about. 2014 is another conversation. Or just a typo in year number
The weather control also sounds like Lovelocks Ghia hypothesis tested for the aglal production of DMS gasas on clouds and the earth's albedo
Seriously great podcast , how don’t more people know about it!?
Hi, just amazing, incredible talk, all the best....
In 2017, scientists encoded a primitive movie into DNA in living cells and were able to play it back
DNA has an extremely high data density. It is estimated that one gram of DNA can store approximately 1.5 exabytes (1.5 billion gigabytes) of data. This is due to the fact that DNA encodes information at a molecular level, using sequences of four nucleotide bases (adenine, cytosine, guanine, and thymine).
Storing 1 exabyte of data would require either tens of thousands of hard drives or hundreds of thousands of flash drives.
Always 😊
Pop Richard, thank you!
Goodbye Mr Chippy* - is this your Final Bow ?
😢😢😢😢😢😢
*a wordplay on that wonderful 1939 movie “Goodbye Mr Chips” and “Chippy” the affectionate name for Chipping Norton, the Professor’s ancestral home in Oxfordshire.
Have you ever seen a carpenter in a chip shop in Chipping Norton?
58:22- yes pain may be useful in teaching the organism not to engage in a particular activity which may cause it harm, (ie touching a hot stove), but why should something like menstruation and childbirth be so agonizing if they’re just normal bodily functions ?
Are they, to the majority of the women?
Many women dont suffer from it.
We have to zoom out even further to no be contamined by our way of life, civilized life with clock every day organisation, our way of eating industrialized food, pills ingestion... its just a guess.
We need to zoom out sufficiently to think free from the things everyday people live. Our species didn't evolve fron only the last one hundreds years. For example, is this kinda menstruation pains are felt the same by indigenous population.
Excellent interview indeed!
How the code of measure on the smallest scales is so well defined & ordered is amzing because lattus structure fludlike sandwich middle is messy complex hard and only gets more complex in environmental decay and gravity bound up tension in space.
Our brain only see unform order of skin as if uniformly granted deterministic simplicity but it ignore all the hidden axioms of decay that we put under the microscope.
If you begin at scale whee Jesus left over finger print starts and remain in that frame of reference on through its a very different picture on that scale than what we think we aee.
Obviously, this is more metamorphosis, not evolutionary, but still, it has a time and place application none the less.
Love Richard Dawkins. Great content and presentation. 🇦🇺 🦘 😊
The extended phenotype is such a cool idea. This sort of thing is a lot more interesting IMO than the arguments about God
Do you start all of your interviews at Noon? Just wondering. Peace ✌️ 😎.
No 11a
bats do Fourier analysis on sounds, we do not. I mean some people have perfect pitch, but NO ONE has perfect phase.
In reference to the wiring design of the human eye, the first camera sensors were designed exactly the same way with the wiring on the same side as the light sensing elements. Why? because it was so much easier although it was less efficient from a photo sensitivity standpoint. More recent camera chips employ a back grinding technique whereby the back of the Silicon wafer is thinned to allow light to reach the photo sites from the other side and thus avoid the wiring. So the obvious engineering approach is not always the most expedient. Perhaps nature "feels" the same way.
Well it seems some sort of assembling as lower bound and combinotric bounds in the superpermutation as an upper bound.
Why does Brian whisper in his advertisements?
It's a secret.
If God had to design animals with protection from predators then why did he make the predators??
I hope your just joking.
Are the Arts (music, painting, sculpture, literature etc) also an Extended Phenotype ?
Why did humans evolve to create these things unless they aided in reproductive success ?
When are scientists going to figure out that the changes in the measures of time and distance due to the amount of gravity in the vicinity change the speed of light relative to our measures of time and distance where we are inside of a galaxy? Scientists can’t seem to figure out that where gravity changes time and distance it changes the speed of light and the rate of causation.
Space is not flat in the measures of time and distance on larger scales just like the Earth is not flat on larger scales. Light MUST indeed *always* travel 186,000 miles an hour at the speed of light C. When distance is stretched from having less gravity, light must still complete traveling that distance in the time determined by C. That means the light is traveling faster as perceived by us in a more contracted frame of reference where there is more gravity. Add to that the fact that a second passes by faster away from the center of mass which increases the speed light MUST travel even more.
It’s really not complicated. It’s so simple. It’s the very reason things appear to be moving faster than the speed of light moving away from the center of the galaxy because they are moving faster away from the center of the galaxy yet without exceeding the speed of light. I don’t know why that is so hard to understand.
There are three rates to consider. 1. The diminishing effect or draw of gravity away from the center of mass. 2. The increasing rate of time away from the center of mass. 3. The increasing measure of distance away from the center of mass.
Speed is measured by time and distance which both change and that changes the speed of light and causation. Things happen faster. Distance gets longer without gravity and time goes by faster, both of which combine to speed up causation. The light has to arrive at a farther distance faster when distance is stretched *and* time also goes by faster. *Then* there is the first thing to consider and that is the diminishing draw of gravity the farther away it is from the center of the galaxy which means things eventually slow down the farther away they are from the center mass of a galaxy. (It's not complicated. No dark matter is needed.) 😎
Redshift happens when light leaves a galaxy. Blueshift happens as light enters a galaxy. All things being equal, the light will be redshifted as it leaves a galaxy and then blueshifted back again as it enters our galaxy. Except we already know galaxies are different sizes. The distant galaxies that we can see are very large and the distances between here and there is excessive causing more redshift than our small galaxy can blueshift back to its original spectrum. The more distant a galaxy is the more accumulated gravity there is from nearby masses causing more redshift.
🤦♀️
@@DrDeuteron Speechless I see.
❤❤❤❤❤❤❤❤❤❤❤❤ BRIAN & team really flop in this presentation C- one hopes for continuing improvement let’s all go to Sugar rock Candy Mountain
Thats amperical
But gene itself does not pocess will. How can it predict the future?
11:29. Perhaps Albert felt guilty about not giving credit to his wife for her critical contributions?
What's so unusual about microbes seeding the upper atmosphere? I could have told you that! For one thing, look at water movement and their size!
Sorry to say that you run too many ads and interruptions for me. My loss.
Dawkins literally said he believed a cell formed by a random lightning strike to a clay filled mud puddle. This is your athiest messiah!?!?!?
he might be right but he seems to be driven more by ideology than by truth
@@emmetbrown7228 You're describing every theist that ever existed. Dawkins works with evidence or the lack thereof. If evidence was discovered that disproved any of his hypotheses he would change it to include the data discovered or drop it and start again.
Here's a quote from Dawkins on this very subject;
"There was an elderly professor in my department who had been passionately keen on a particular theory for, oh, a number of years, and one day an American visiting researcher came and he completely and utterly disproved our old man's hypothesis. The old man strode to the front, shook his hand and said, "My dear fellow, I wish to thank you, I have been wrong these fifteen years". And we all clapped our hands raw. That was the scientific ideal, of somebody who had a lot invested, a lifetime almost invested in a theory, and he was rejoicing that he had been shown wrong and that scientific truth had been advanced."
So you've advanced the hypothesis that Dawkins is driven by ideology, not evidence. Yet he holds the above anecdote highly enough to have repeated it in print, lecture & discussion many times. Your hypothesis seems to be discounted by the evidence.
Your reply, or lack of one, should reveal if you are driven by ideology or led by the evidence.
Don't take my word for it, I could be fabricating evidence. Go see if I am right that Dawkins thinks this way. Maybe read the book this appears in (I'd put money on you not doing this. Although I'd need evidence one way or the other 😆).
So what say you? Do you withdraw your baseless claim, presented without evidence because, like most ley people, this is something you "feel" yet haven't researched.
I await your reply with interest.
Edit 24 hours later... No reply yet. Maybe the OP is busy. Let's give it another 24 hours before drawing any conclusions.
What ideology exactly?
@@forestgiest1380 good question i'd like to know it too
If we create AI beings which share our capacity for pain, both physical and emotional, along the ability to experience joy - then we have the moral obligation to treat them as our equals with the same rights and freedoms that we have.
Which in my opinion, defeats the entire purpose of this enterprise in the first place.
I thought the whole point of creating sophisticated computers and powerful robots is so they can aid us in complex calculations and perform the dangerous, repetitive & unpleasant tasks no human should/could ever do.
If they also have “feelings” it’s simply another kind of slavery.
Given our poor track record with how we treat biological life forms, would we treat artificial ones any better ?
Apart from ethical considerations, there’s also the possibility that sentient AI could lead to humanity’s eventual extinction. Imagine trying to quell a rebellion led by beings way stronger and smarter than we are !
“The Terminator” might not be so far fetched after all.
What sort of jeans do you recommend for a Beaver Cleaver who doesn't want to get damned?
Now get Denis Noble, he has a different perspective on the role of genes . He and o others don’t think they are the blueprint for life
Bro, why are you glowing?
If you ignore some very important parts of a theory, the theory will always be flawed and incomplete. Dawkins is no stupid dude, but he lacks something very important.
Some scientists believe washed uppppp
Showing head bangers and trance dancers as examples of music connoisseurs is a pretty poor way to illustrate the spiritual value of music or get to the difference between the Lord of the Dance and the Lurers to Lurid Dances
nothing ... they reveal nothing
If any of the undead species in the multiverse offer Dawkins eternal life, I'm declaring war on that species. We don't need any more insufferable boors.
He makes it up as he goes along 😂
Who decides which body is beautiful or attractive .
Continues to assign agency to chemical structures he calls genes and now viruses and still more bacteria?
Will he next assign consciousness? Cooperative genes? A sociological term.
Day by day he gets closer to Gaia ideology.
The only way quantum consciousness can get into the future is via reincarnation, and Karma is the force that guides it toward the experiences that create it's optimal future in the multiverse.
Since we are apparently looking into genealogies, enough with all of the disinformation. Neanderthals are Eurasians and Denisovans are a mix of Eurasians and Sino Canaanite tribe of Sinim with the D y-hg in Asia and or the House of King Nimrod’s descendants with the C y-hg both of which are Hamitic, Cushite and Canaanite.
DNA migrations show that Native Americans crossed the Atlantic to Central America from the Mediterranean Sea. There are four or more haplogroup lineages that show this migration route, the A C&D maternal mtDNA lineages and the Q paternal Y chromosomal lineage as well as probably the C paternal y-hg lineages made this same crossing to Central America and then spreading north and south from there.
People are ignoring actual known human history. The actual historical records and DNA migrations show that everyone spread out from Mesopotamia. Ancient history is essential for everyone to know, especially that of the sixteen original civilizations… that are from the sixteen grandsons of Noah. We should learn ancient history before trying to learn science. The following are the paternal Y haplogroups that make the most sense.
1. The first inhabitants of Italy (K) Tubal
2. Thracians (L) Tiras
3. Greek sea people (T) Javan
4. Siberians & East Asians (NO) Magog
5. Eastern Europeans & East Eurasians (P) Meshek
6. Medes (Q) Madai
7. Western Europeans (R) Gomer
8. Hebrews and Arabic (IJ) Arphaxad
9. Elamites (H) Elam
10. Assyrians (G) Asshur
11. Arameans (F1) Aram
12. Lydians (F2) Lud
13. Cushites (AB, C) Cush
14. Egyptians (E3) Mitzrayim
15. Canaanites (E2, D) Canaan
16. Original North African Phoenicians (E1) Phut
The only way to determine the actual paternal lineages is with the Y chromosome. E1 is Phut, E2 is Canaan and E3 is Mitzrayim. The descendants of Cush are A B and C with C being the descendants of the House of King Nimrod the first King of the world with many descendants (reinforcing his genes) which was in Mesopotamia and Assyria otherwise known as the Sumerians. The descendants of Nimrod later spread to the Americas and Pacific islands. It’s the reason Olmec statues often appear Polynesian since they share the same common ancestor with Polynesians. In America it’s C3 and in the Pacific islands it’s C2.
The D paternal haplogroup Sino descendants of Canaan migrated from Canaan east to Andaman Islands, China, all the way to Japan and Tibet. The C paternal Y haplogroup descendants of Nimrod migrated as far as South Asia, Australia, the Pacific, Mongolia, Europe and all the way to the Americas by way of Atlantic accounting for the Olmec civilization in Central America as well as the Q Y haplogroup descendants of Madai ancestor of the Medes that also crossed the Atlantic to Central America along with the maternal lineages of A C and D.
The A maternal mtDNA haplogroup belonging to the *Semitic* N lineage accompanied the Eurasian Q paternal Y haplogroup to Central America. The C&D maternal haplogroups belonging to the *Eurasian* M lineage also accompanied the Atlantic crossing of the Q paternal haplogroup Medes and probably the C paternal haplogroup to Central America. The Semitic B maternal mtDNA haplogroup seems to have crossed on the other side via the Pacific Ocean to South America.
The Mediterranean paternal R1b and the maternal X2a (also found in Galilee) represent yet another Atlantic crossing of the Phoenicians in the days of King Solomon considering also the additional Mediterranean paternal Y chromosome haplogroups of T, G, I1, I2, J1, J2, E and B in found in Native American today in addition to the R1b found in Native American Populations. J1 and J2 are Arabs and Jews. (I1 is most likely the tribe of Dan and I2 resembles the movements of the tribe of Asher)
Of course there is also the Cohen 50% of which are J1 P58 known as the Cohen modal haplotype which identifies the IJ lineage of Hebrews and Arabs that are descended from Arphaxad. J2 M172 is the largest group of descendants probably of the House of the kings David and Solomon. Now you know a lot more of what is now verified human history.
Neanderthals were Eurasians descended from Japheth and Denisovans are a mix of Eurasians and Canaanites and or Cushites descended from Ham. We know this because of the people living today who have Neanderthal and Denisovan DNA.
The mtDNA maternal lineage of the out of Africa claim goes from African to Eurasian and then to Semitic while the Y chromosome lineage goes from African to Semitic and then Eurasian. So according to that Africans produced Semitic males and Eurasian females who then produced Eurasian males and Semitic females completely invalidating the Out of Africa claim. *The reality is that all of these various lineages had to have existed simultaneously.*
"Darwinian selection" seriously???
The irony of Dawkins saying you can’t opt out of science when it goes against your Faith. I think he does it all the time, he constantly misrepresents evidence to fit his narrative, he ignores evidence that contradicts his claims, and tries to suppress dissenting voices.He wants to spend more time on the science and less time on being a anti-theist if you ask me.
I don’t think he does any of those things
can you please reply with examples of him doing this
@@JonnyCook I’ll give an example of each:
He often misrepresents evidence of common descent as proof for the theory of evolution. He ignores evidence that contradicts the theory, such as proof that the germ line can be altered through mutations to the somatic cells, the Weismann barrier is breached.
He champions for the scientific community to rebrand the theory of evolution as fact not theory in a bid to end discussion as to its solidity.
@@THIS---GUY if you read the comments attached to my post I have just done that in response to the other guy that replied
Too much propaganda, sad.
They're talking about genes and phenotypes, my friend
If you would like to accept Jesus as your Savior, please pray this aloud: "Lord Jesus, I repent of my sins and surrender my life. Wash me clean. I believe that Jesus Christ is the Son of God. That he died on the cross for my sins and rose again on the third day for my Victory, I believe that in my heart and make confession with my mouth, that Jesus is my Savior and Lord."
People with delusional thinking might need this; so, they could permanently live in that state.
@@jeffreyluciana8711 if you would like to accept the importance of factual evidence to guide your understanding of how you got here and what came before you, chant this aloud, ACGTTCAGTCAACTGTATCGCTAGTACTGCCATCGTGACGTTCAGTCAACTGTATCGCTAGTACTGCCATCGTGACGTTCAGTCAACTGTATCGCTAGTACTGCCATCGTGACGTTCAGTCAACTGTATCGCTAGTACTGCCATCGTGACGTTCAGTCAACTGTATCGCTAGTACTGCCATCGTGCCTGATAACCTTTAC
You presumably need to say it honestly (which means all contradictory worldviews are wrong.)
Yet she is still wrong about God being real