Android without Google: the Murena - /e/ Project blew me away!

Поделиться
HTML-код
  • Опубликовано: 7 сен 2024
  • I've been trying to degoogle my life as much as possible lately, but there are 2 main holdouts: youtube, and Android. While I still haven't found a competent enough youtube alternative, apart maybe from LBRY, I might just have found the Android replacement I was looking for! Let's take a look at the /e/ operating system !
    Support the channel on Patreon:
    / thelinuxexperiment
    Follow me on Twitter : / thelinuxexp
    My Gaming on Linux Channel: / @thelinuxgamingexperim...
    Follow me on LBRY: lbry.tv/@TheLi...
    The Linux Experiment merch: get your goodies there! teespring.com/...
    What is /e/ - Murena
    "e" is a nonprofit project, backed by the /e/ foundation. Its goal is to provide a compeltely de-googled version of Android. This is in the strictest sense, as anything that might call to Google has been plucked out of the operating system: the google services, app store, default applications, even the time server and DNS have been changed.
    The /e/ operating system is the result: it can be installed on a lot of Android smartphones, from a fairly wide selection of manufacturers, or you can order a refurbished smartphone from the /e/ website More recently, /e/ has become available on the Fairphone 3 as well, which you can buy preinstalled with /e/ from their online store.
    Gael also told me that the PinePhone might be a target at some point, and they already had a port for the PineBook.
    /e/ account
    As you won't be using any Google services, the /e/ project feels that you also need a few services for day to day use, that's why they provide you with a free /e/ account. This is basically your own user account on the /e/ project's Nextcloud, with an email address that ends in e.email, as well as contacts, a calendar, some file storage, photos, and tasks.
    In term of features, the /e/ team is also working on End to End encryption, which is proving tricky to implement, as well as the ability to self host the /e/ online services if you want to have as much storage space as you'd like and control your data 100%.
    They also have an SMS to cloud feature that allows you to keep your messages when you change phones, and are working on the ability to let users log their geolocation in the cloud if they want to, to be able to find their device if it gets lost or stolen.
    The /e/ OS experience
    The /e/ OS is very inspired by iOS in terms of look and feel, out of the box. You get a default grid of icons, some widgets when you swipe left, no standard Android app drawer, and a global search if you swipe from the top.
    The OS ships with default apps for everything you might need out of the box, and all of these apps are open source, just like the OS itself.
    Most of these are forks of other open source applications, for example, the web browser is a de-googled fork of Chromium, the mail client is a fork of K-9, the camera is a fork of OpenCamera...
    Some apps are the default Android applications, like the contact, clock, calculator, keyboard, or gallery, and some are just preinstalled apps available anywhere alse, like MagicEarth for maps, PDFViewer Plus for PDFs, or OpenTasks for the todo list.
    Using these applications, you also won't help but notice the Android roots behind them: older tab bars, three dot menus and pop-ups abound, and look like the stuff you'd have been using on an Android Kit Kat smartphone. This doesn't mean they're bad, but it does look a bit dated compared to the smooth interfaces of today. Some might prefer this older style, but I know I don't.
    But why would you prefer /e/ over another Android custom ROM ? Well, as Gael Duval puts it, they are not targeting tech savvy users, or geeks. They want to offer a simple option that even beginners can get to grips with, without jumping through too many hoops and sacrificing convenience.
    /e/ offers integrated services out of the box so you don't have to look for them intially, they put a lot of effort in the launcher user experience, and they are 100% Google Free. They are probably the only one to address the low level stuff as well, like the connectivity checks, or the NTP server, while most other custom ROMs still send information to Google.
    Installing apps
    /e/ doesn't try to reinvent the wheel here: they provide their own app store, that is basically a mirror of the applications available on the play store. Not all of them will be as up to date as the ones available on Googl's markeplace, and some of them won't be available, but the selection is pretty large here.
    You also get some nice touches that you won't find on competing stores, like a privacy score. This is determined by scanning the apks and identifying the permissions they require, as well as the trackers they include, so you know, when you install an app on the /e/ store, what it will collect, and if you can reliably use it or not.

Комментарии • 2 тыс.

  • @boatymcboatface9683
    @boatymcboatface9683 4 года назад +2369

    I'm a very happy that the RUclips algorithm recommend me a video on how to remove google services 😁

  • @alejandrorivas404
    @alejandrorivas404 4 года назад +1203

    I remember when i installed a custom rom on my Motorola moto g first generation, i forgot to install google apps and battery lasted for 2 days, and that day i realized that google do more on the background

    • @paulofreireslaw
      @paulofreireslaw 4 года назад +96

      RUclips vanced > newpipe

    • @fred-youtube
      @fred-youtube 4 года назад +24

      @@DRSDavidSoft Try Firefox or Chromium on your phone insted

    • @Kuri0
      @Kuri0 4 года назад +14

      @@DRSDavidSoft use microg

    • @Fruitarian.
      @Fruitarian. 4 года назад +8

      Just like huawei phones these days

    • @fred-youtube
      @fred-youtube 4 года назад +12

      @@paulofreireslaw I use YT Vanced, btw (you cant reply to comments or see them on newpipe)

  • @feelshowdy
    @feelshowdy 4 года назад +109

    An important distinction: /e/ didn't start from AOSP, aka the "scratch" of Android. They started from forking LineageOS, and benefited from the de-googling and optimizations already done by Lineage contributors. This is why they could focus on beautifying the UI, adding branding, making their app store, and removing extra Google stuff Lineage didn't remove in order to replace it with their own implementations. I still think /e/ adds a fair amount of value to its Lineage base, though. It's precisely because they already had a good base that they could build good stuff on top it. The beauty of open source!

    • @TheLinuxEXP
      @TheLinuxEXP  4 года назад +12

      Thanks for the precision !

    • @TheNerd
      @TheNerd 2 года назад +2

      At the end of the day it doesn't matter. If you do not provide access to one of the 2 big AppStores, you need a BIIIIIG Appstore with all important Apps yourself.
      If you don't have it, you fail. I mean if Blackberry and Microsoft both fail, because of this exact issue, the e project is going to fail for sure.

    • @____-gy5mq
      @____-gy5mq 2 года назад

      E started with markiplier, stop lying

    • @jacquelineliu2641
      @jacquelineliu2641 2 года назад +3

      @@TheNerd apkpure, apkcombo, apkmirror: Are we a joke to you?

    • @MsDuketown
      @MsDuketown Год назад

      Which version of Android and what date was it released? lol, as mobile history is being written.
      Plenty of OS'es to choose from, but it depends on your device and SoC.
      Open Hardware is still a little lagging.

  • @abubkurian1625
    @abubkurian1625 4 года назад +1792

    I would like to see more linux phones, need a third OS in mobile world...

    • @NymezWoW
      @NymezWoW 4 года назад +157

      Android IS Linux

    • @abubkurian1625
      @abubkurian1625 4 года назад +242

      NymezWoW android only uses the linux kernels, everything else is built specifically for it. I meant GNU/linux, open source and free software.

    • @NymezWoW
      @NymezWoW 4 года назад +56

      Abu b.kurian Android is free and open source.

    • @abubkurian1625
      @abubkurian1625 4 года назад +91

      NymezWoW its free and open source but not a free-software, i meant like GNU...

    • @patternwhisperer4048
      @patternwhisperer4048 4 года назад +176

      @@abubkurian1625 Abu is right, just because it has a linux kernel it doesn't mean that android adhers to linux distros general philosophy. Google's android has added many closed source proprietary parts to the android ecosystem. So yes, android is open source but google is strangelholding its ecosystem

  • @undertaken5200
    @undertaken5200 3 года назад +254

    January 2021 gonna make this video very popular. Nobody like google, Apple, amazon, Microsoft, etc...

    • @TheLinuxEXP
      @TheLinuxEXP  3 года назад +27

      Let’s hope so :D

    • @dopechannoodles9791
      @dopechannoodles9791 3 года назад +25

      That’s what brought me here. About to trash my iPhone. Done with apple google amazon microsoft and all the rest. And waiting on a dip to buy into Bitcoin. Huge learning curve tho.

    • @bill6872
      @bill6872 3 года назад +15

      @@dopechannoodles9791 I’m in the same boat. I have an iPhone 11 Pro Max. Nice phone, but i can’t support Apple anymore. I need to find another phone similar, but with tons more privacy. Any idea what might be a good alternative?

    • @Savage1776_
      @Savage1776_ 3 года назад +21

      86 millions people had their VOTES crapped on!! So yea !!!!

    • @Savage1776_
      @Savage1776_ 3 года назад +11

      @@bill6872 maybe Oneplus...but they use Google.. the sad thing is we made these companies what they are and now they're abusing their power on us

  • @njseashorechas2698
    @njseashorechas2698 3 года назад +147

    Very impressive speaking skills! We need these phones in the USA! HUGE demand for anything Google free now!

    • @shanemangold8257
      @shanemangold8257 3 года назад +3

      We have them! Get one now

    • @estebanjones2112
      @estebanjones2112 3 года назад +3

      Dont forget about Apple Charles

    • @njseashorechas2698
      @njseashorechas2698 3 года назад +9

      @@estebanjones2112 Apple is now censoring and blocking apps now in the USA

    • @estebanjones2112
      @estebanjones2112 3 года назад +3

      @@njseashorechas2698 I know. That is what I was trying to add to your comment. We need to start changinf from web searches to mails and phones.

    • @njseashorechas2698
      @njseashorechas2698 3 года назад

      @@estebanjones2112 Glad I Subscribed to your channel. Keep us updated!

  • @LordWaterBottle
    @LordWaterBottle 4 года назад +37

    The highest praise for a product that was given temporarily for review is "I'm considering buying it instead of sending it back"

  • @Seltyk
    @Seltyk 4 года назад +420

    /e/ foundation has a history of bad open source behavior. The OS is a fork of a _really_ old build of LineageOS (not that forking is an issue, it's just out-of-date), they shamelessly remove credits from Lineage code, and everything on /e/ can probably be achieved on LineageOS in under 10 minutes manually

    • @jothain
      @jothain 4 года назад +73

      Oh boy, I was about to comment that why not just go LineageOS, but if this is a ripoff of that. Well forget it.

    • @AbteilungsleiterinBeiAntifaEV
      @AbteilungsleiterinBeiAntifaEV 4 года назад +33

      I don't know this YTber, but it looks like he has no clue about android.

    • @User9681e
      @User9681e 4 года назад +6

      I don't like linage os as well but a fan of graphene os

    • @rockasaurio1771
      @rockasaurio1771 3 года назад +21

      Thanks for the useful information! I was about to post the question about if the "e account" was something forced or optional; the moment i listened about it on the video, i immediately thought of it as suspicious.

    • @rockasaurio1771
      @rockasaurio1771 3 года назад +1

      @@AbteilungsleiterinBeiAntifaEV Yes such truth can easily be inferred from the content of his channel.

  • @waltz9230
    @waltz9230 2 года назад +2

    This is the best lighting setup I’ve ever seen on RUclips ever.

  • @SaynYT
    @SaynYT 4 года назад +276

    So nobody is going to talk about how fast the operating system is without any google services installed?

    • @asthenyukimori9853
      @asthenyukimori9853 4 года назад +44

      And more battery saved.

    • @janithcooray5546
      @janithcooray5546 3 года назад +5

      it's faster. obviously.BUT Are you forgetting About Push Messages? only offered by google. Samsung too(horrible).

    • @openlink9958
      @openlink9958 3 года назад +13

      @@janithcooray5546 ... I have a samsung and I have no idea what push messages are, lmao

    • @janithcooray5546
      @janithcooray5546 3 года назад +5

      @@openlink9958 android phones and iOS phones use push services to receive notifications from web. Like what’s app messaging etc. it plays a huge roll in battery life. But you won’t receive messages

    • @laphlaes
      @laphlaes 3 года назад +9

      @@janithcooray5546 That's what MicroG is for :)

  • @LordHolley
    @LordHolley 3 года назад +16

    Glad I've kept some of my older phones, they will be perfect to set this up with.

    • @nguyen3075
      @nguyen3075 3 года назад

      i did save my old phones, now the time dumb google

    • @Johnny-dp5mu
      @Johnny-dp5mu 2 года назад

      If 3g goes off line then what??

    • @sranang-kino
      @sranang-kino 2 года назад +1

      @@Johnny-dp5mu then you just got yourself a pocket PC use your imagination .

  • @idk-sy3iu
    @idk-sy3iu 4 года назад +43

    You: this is is Android without Google spying on you
    Also you: install YT Studio

    • @TheLinuxEXP
      @TheLinuxEXP  4 года назад +6

      Well, I've got to try it 😅

    • @MarkHobbes
      @MarkHobbes 4 года назад +5

      At least, less data is sent since there is no Google Play Services and it relies on microG :)

    • @idk-sy3iu
      @idk-sy3iu 4 года назад +5

      @@MarkHobbes so better battery 😂😂😂

    • @Steve211Ucdhihifvshi
      @Steve211Ucdhihifvshi 3 года назад +2

      Just put a firewall on your phone, allow what you want blovk everything else. Ive used it for yearrrs more recently google force the phone to try and restart around midnight and dump the firewall. So i turn data off etc.

  • @NoorquackerInd
    @NoorquackerInd 4 года назад +513

    Allow *Calculator* to make and manage phone calls?

    • @NijiDash
      @NijiDash 4 года назад +104

      Ikr, today I literally found a remote control app that needed access to my phone’s IMEI number. Wasn’t born yesterday, deleted that shit right away lmao.

    • @IntrovertedTechie
      @IntrovertedTechie 4 года назад +47

      @@NijiDash Mi remote even has privacy policy 🤣🤣🤣

    • @NijiDash
      @NijiDash 4 года назад +41

      @@IntrovertedTechie Yup that's the app I meant, well what did we expect from China right? 🤣

    • @IntrovertedTechie
      @IntrovertedTechie 4 года назад +7

      @@NijiDash yeah

    • @MasayaShida
      @MasayaShida 4 года назад +13

      @@NijiDash I've never used a xiaomi before but if you do abit of reading online they seem to be more trustworthy than companies like huawei and whatever the parent company is of oppo vivo and oneplus

  • @ahmd-mi9964
    @ahmd-mi9964 3 года назад +9

    We need to support such alternative freedom for the masses platforms.

  • @hermanwooster8944
    @hermanwooster8944 4 года назад +5

    Great video. A full Linux OS phone will happen when primary development switches from x86 to ARM. Until then, /e/ is the best thing going for people who are tired of corporations selling your data. The only issue now is getting privacy-respecting hardware.

    • @KSPAtlas
      @KSPAtlas 2 года назад

      Me waiting for Linux to focus on POWER and RISC-V

  • @nottjohn9418
    @nottjohn9418 3 года назад +18

    I use LineageOS and MicroG. After a short learning curve I can't really say I'm missing a lot.

  • @BxPanda7
    @BxPanda7 4 года назад +20

    I'd love to see some benchmarks between this phone and it's google counter-part, i always wondered just how much processing power and battery these google services take up and if disabling them would make a noticeable difference or not.

  • @dagg497
    @dagg497 3 года назад +3

    Firefox or Opera with Adblocker.
    Use duckduckgo search engine.
    Sideload apps from apk mirror.
    Use Vanced instead of RUclips.
    Use microG for login to Google maps and RUclips services..
    And use Microsofts outlook app instead of the stupid Gmail.
    I wish Android was stripped off all telemetric Google contact and Bloat apps..aswell as a virtual machine for running apps in so they dont bypass app permissions which the surely do. I still get very specifoc instagram ads even though i turned off mic and camera access on all Facebook apps

  • @zski1
    @zski1 3 года назад +2

    This is a great start to shut these monopolies down. But my only skepticism is...it still has Android which the roots are from Google.

    • @TheLinuxEXP
      @TheLinuxEXP  3 года назад +1

      Yeah, that’s why I just released a video about pure Linux on a phone :)

  • @csr2537
    @csr2537 3 года назад +2

    Huawei: We have Android with no Google preinstalled on our phones

  • @yummiermussel5331
    @yummiermussel5331 3 года назад +19

    Here in January 2021, and how right they were for creating this! We are getting more Orwellian every day...

    • @thomasmeunier8669
      @thomasmeunier8669 3 года назад

      The original idea is right, but the work is badly done & i'd recommand using CalyxOS or even LineageOS instead of this OS that is a big security hole filled with bugs

    • @TheLinuxEXP
      @TheLinuxEXP  3 года назад

      It’s far from badly done. I’ve been using it for months and it’s stable, and polished.
      Other roms aren’t close in terms of what they remove from Google.

    • @thomasmeunier8669
      @thomasmeunier8669 3 года назад

      @@TheLinuxEXP what they remove? default dns? + what , connectivity check? ...
      it's BS

    • @TheLinuxEXP
      @TheLinuxEXP  3 года назад +1

      It’s not. They have a page listing everything they removed.

  • @tralhasdojean
    @tralhasdojean 4 года назад +14

    Nice video!
    I never understood Google Services... It slows down all the system just to open apps you could use directly from the browser... It's stupid.

    • @claudiacardinelli1867
      @claudiacardinelli1867 2 года назад +3

      Tracking, hacking, to build a more complete profile of you, including biometrics and location. Then share it with Chinese businesses, etc.

    • @sranang-kino
      @sranang-kino 2 года назад

      that's what responsibility brings ..

  • @enyvokaz
    @enyvokaz 4 года назад +4

    Cool video, never heard of this project before. Thanks for the review 👍👍

  • @rklauco
    @rklauco 3 года назад +1

    Thanks. This is what I needed to kick the effort off the start line. Purchased (bit damaged) old S9 to test, if I like it, I'll grab the S9+ from /e/. Thanks a lot!

  • @claudiacardinelli1867
    @claudiacardinelli1867 2 года назад +1

    I subscribed.
    Also thanks for giving credit to the musical artist/song.
    If I like the the music, I like to know who it is.
    I'm sure they want to be known as well.

  • @SuperDesignguy
    @SuperDesignguy 4 года назад +7

    This is a great video. We'll done. Thanks for sharing. Apple and Google have their teeth in everyone, and our data should be our data. Part of me feels a project such as this, could be bought up by a major phone manufacturer highlighting the advantages of being decoupled from Google. We need a major phone manufacturer to do this in my opinion. LG, Sony, even Samsung could do this and I think it would really take off.

  • @ariedov
    @ariedov 4 года назад +7

    Most of the apps still use Google/Firebase analytics. So by installing any of the third-party closed-source apps - Google is still there.

    • @pmscalisi
      @pmscalisi 3 года назад

      How many sites can be accessed without an app?

    • @rodnocker6172
      @rodnocker6172 3 года назад

      That’s true but the trick is they can’t connect it too your identity!

  • @gamingcollection270
    @gamingcollection270 3 года назад +2

    Really interesting to see that these projects are coming out. And I'm really planning on switching to them in the future. Or use my older devices and just put that OS on it instead of buying something new. Enough options that respect the user and their privacy to choose from if you ask me.

  • @justinmcginty6815
    @justinmcginty6815 4 года назад +3

    I just stumbled over this blog. This is great news. I'm not tech savvy though, so I'd have to wait for the installer app.
    I'm over these tech giants. Open source is the way to go. Keep on working on the installer. You will get my business.

    • @TheLinuxEXP
      @TheLinuxEXP  4 года назад

      Yeah as soon as they can make this painless, they'll grab more market share !

  • @patricelauverjon2480
    @patricelauverjon2480 3 года назад +2

    Beyond Systems: we depend on our abilities to react timely according to the present moments.

  • @uniqhnd23
    @uniqhnd23 4 года назад +79

    Graphene OS is also completely degoogled and probably the most secure version of android ever

    • @ivanguerra1260
      @ivanguerra1260 4 года назад +16

      That´ right, but it´s only available for Pixel Phones that are Google´s Spyware.

    • @hermanwooster8944
      @hermanwooster8944 4 года назад +9

      @@ivanguerra1260 It's safe to say most phones are spyware. It's going to take time before open hardware is developed.

    • @ricecake1228
      @ricecake1228 4 года назад

      Yes, but installing it is a hassle.

    • @t3ch-1t89
      @t3ch-1t89 4 года назад +7

      I'd go with lineage, since pixel pretty much has a blackbox proprietary security chip, and security via obscurity is a bitch.

    • @UrbanaticLemonade
      @UrbanaticLemonade 4 года назад +4

      I love it. e foundation can go suck on Toes

  • @wanderer8200
    @wanderer8200 4 года назад +59

    This video: Android without Google
    Huawei: First time?

    • @matthew8153
      @matthew8153 4 года назад +9

      AceOculus
      He means without Google OR China.

    • @wanderer8200
      @wanderer8200 4 года назад

      @@matthew8153 i meant in an literal way

    • @jdtsb8856
      @jdtsb8856 3 года назад +3

      I have a Huawei, it runs Google. What Huawei product doesn't have Google?

    • @wanderer8200
      @wanderer8200 3 года назад +1

      @@jdtsb8856 clearly you live in an alternate universe

    • @jdtsb8856
      @jdtsb8856 3 года назад +4

      @@wanderer8200@ Like I said, I own a Huawei. I asked a legit question. If you don't know the answer, don't waste your time replying with nothing.

  • @krono996
    @krono996 4 года назад +5

    9:43 Google Firebase Analytics, Google Admob
    It's almost impossible to find bigger apps without anything Google related IMO. Obviously, since they are for Android.

  • @BWGPEI
    @BWGPEI 2 года назад

    As a fan of LineageOS and it's ability to update older phones to a reasonable version of Andriod, I think it's nice to see additional work being done. The "pico" version of "google" stuff on top of LineageOS is just sufficient to get to the Play Store and download what you actually need to have on YOUR phone. As happens I don't need much, grin.

  • @johngiuffrida
    @johngiuffrida 3 года назад +2

    Wow...that seemed like a really good, objective review. Thanks Stranger!

  • @johnbamber7374
    @johnbamber7374 4 года назад +4

    This is an awesome review. I bet the /e/ Foundation is blown away by this reception. Excellent choice on their part to not actually sponsor it.

    • @TheLinuxEXP
      @TheLinuxEXP  4 года назад +3

      Had I known I would have liked it so much, I would have asked for money 😅

    • @johnbamber7374
      @johnbamber7374 4 года назад +1

      @@TheLinuxEXP, I do wish you had been compensated, as I hope you're able to keep making videos indefinitely; however, I think it adds even more weight to your overwhelmingly positive review that it wasn't sponsored.

    • @TheLinuxEXP
      @TheLinuxEXP  4 года назад +1

      For now, I have no plans to stop :) I can't make a living on what RUclips pays me, but it could happen if the channel keeps growing :)

  • @kuyawill25
    @kuyawill25 4 года назад +242

    "Android without Google"
    You mean Huawei Phones today?

    • @invntiv
      @invntiv 4 года назад +101

      Is that a joke? Trading Google for Huawei is like being happy having the choice of which tool your torturer will use on you

    • @kuyawill25
      @kuyawill25 4 года назад +27

      @@invntiv Can't take some kind of a Satire, Aren't you?

    • @gracefulcubix4730
      @gracefulcubix4730 4 года назад +3

      Ah yes oak OS. Heard it is faster than android

    • @muyin
      @muyin 4 года назад +26

      @@invntiv the CIA still haven't provide any evidence that Huawei collects user data tho.

    • @fenn_fren
      @fenn_fren 4 года назад +47

      @@muyin Every Chinese based company provides data to the Chinese govt.

  • @catcatcatcatcatcatcatcatcatca
    @catcatcatcatcatcatcatcatcatca 4 года назад +6

    Phones are the current frontier on pushing against Google and Facebook; but I think the key is efficient containers and limiting the amount of data matched from different sources. I can't see neither the public choosing to move past Facebook's apps and Google's services, nor those companies willingly giving up permissions or access to personal data.
    So we need one android that can effectively allow usage of the apps, while denying the corporations usage of the users. No amount of polishment or ease of use can cut that corner - and those parts will most likely follow naturally.
    Another option is to have a cultural movement to de-contaminate our life from excessive use of technology all together. If an OS that can deliver that catches enough interest, it can most likely force the corporations other than the tech giants to reposition on issues like privacy and maximising screen time.
    But I don't think this solves either problem. If the /e account could provide anonymity while using the most popular services, it could be useful. If their cloud services included a VPN and an account/password manager, things could be different. And if the apk-store included a way to actually limit the permissions, it might be more interesting for the general public.

  • @GroverAU
    @GroverAU 3 года назад

    Note: Apple was the first company to sell data to companies and has been for decades (since iPod). Just because you might not see an add, does not mean that they are not collecting and using your data for profit. In fact, one of the biggest data collection groups was formed by Apple specifically for data mining people.

  • @modm8843
    @modm8843 3 года назад +3

    I love the word “DEGOOGLED”

  • @pascalr.7083
    @pascalr.7083 4 года назад +4

    Hey Nick thx for this video. I was looking for a New OS for my smartphone and this one seems to be perfect.

  • @BlenderDumbass
    @BlenderDumbass 4 года назад +17

    The permissions on Android always annoyed me.
    I wish there was an option to install the package and not give it all the permissions it want. Like activate and deactivate them as I need to use this or that.
    Like allow camera in the web browser. If don't allow the site will say something like. Sorry this feature is not working. Bla bla.

    • @TheLinuxEXP
      @TheLinuxEXP  4 года назад +8

      I agree 100%

    • @hanschannel599
      @hanschannel599 4 года назад +1

      I think it will do if you use some of AOSP flavor like LineageOS

    • @eduard647
      @eduard647 4 года назад +2

      Some sites today straight up won't work i you just deny notifications from them, it's really shady stuff

    • @FullOilBarrel
      @FullOilBarrel 4 года назад +1

      @@eduard647 dont use those shit sites

    • @jothain
      @jothain 4 года назад +1

      OnePlus phones are quite nice on this. It'll ask if you want to give permission x for app y. It also more specifically gives that third and to me most interesting option "deny if program is running in background".

  • @basdfgwe
    @basdfgwe 4 года назад

    Hosting your eservices will get me buying this phone.

  • @RicardoJavierMelero
    @RicardoJavierMelero 3 года назад

    I think that PWA's would make possible the dream of many different Linux mobile OS, not having to worried about apps...

  • @threepercent490
    @threepercent490 3 года назад +7

    Gotta get one of these to save myself from the covid genocide contact tracing Psychopathy. Thanks for making this video. Much appreciated.

  • @d0g_0f_Christ0s
    @d0g_0f_Christ0s 3 года назад +4

    Degoogled sounds tight ✊😉

  • @pirosoffaireyes
    @pirosoffaireyes 4 года назад +12

    How is their privacy policy like? I might have to check that out. Better than google using your data for everything adrelated I guess.

  • @tibor8472
    @tibor8472 4 года назад

    I have installed on Samsung A5 2016. Works very well. It has at least more than 700-800 MB of free space in RAM after system load, compared to factory system, which is Nougat (/e/ is Pie) and has maximum 300 MB in same situation. It gets updates frequently and install is quite simple. According to me, /e/ is recommended, if you did not need for latest technologies and eye candies and you have a compatible model.

  • @goldfinger0072
    @goldfinger0072 3 года назад +1

    Great, i have transformed my S8 to this operating system, and it looks indeed a little bit basic, but everything works fine and am very happy with it!..thanks!

  • @kosinusify
    @kosinusify 3 года назад +3

    Now that's interesting. I heard about another French approach to de-Googling Android while maintaining user-friendlyness. It's a company called iodé, who have taken a pretty similar approach to /e/. Maybe you could make a review about them as well and compare them? I would definitely be interested in seeing that, because I am currently not sure about what to use as my next mobile OS.

  • @shubhamshejaval8526
    @shubhamshejaval8526 4 года назад +8

    Fortunately this video haven't seen by any RUclips employee.

  • @hardiksrivastava9174
    @hardiksrivastava9174 4 года назад +3

    I personally tried /e/ on my old Redmi Note 7 Pro last year, but honestly I did not like the replicated look and feel of iOS but I can see as to why they are trying to do that. Also from what i can see in the video the /e/ version seems to be based on Android 8.0 which is basically 3 years old at this point. Instead of /e/ I would personally install a more recent version of any custom rom based on Android 10 with microG and use that. I personally as a custom ROM user do not have any issues with aosp using ntp server default or anything else, but then that's highly subjective.

    • @TheLinuxEXP
      @TheLinuxEXP  4 года назад

      Android 8 it seems, yes, but honestly there's not much difference anymore

    • @hardiksrivastava9174
      @hardiksrivastava9174 4 года назад

      @@TheLinuxEXP From a technical point of view it does make a difference, sooner or later old versions of android would stop getting official security patches and /e/ team would need to rebase their project on newer sources on android. I'm not trying to say /e/ is bad or anything but then it would have been better if there was a more recent version of android as a base :)

    • @TheLinuxEXP
      @TheLinuxEXP  4 года назад

      Oh they'll probably do it when it's necessary :)

    • @kazzTrismus
      @kazzTrismus 4 года назад

      half of googles updates are just another "communication" opportunity..
      honestly some of yall bleeding edge guys will download the "just spying on you" update.
      android has barely improved since marshmallow... mostly just google stealing customisation ideas

    • @nickvolt2816
      @nickvolt2816 4 года назад

      " I did not like the replicated look and feel of iOS but I can see as to why they are trying to do that."
      LOL. Funny thing - Xiaomi also replicate iOS in many places and this is ok? ;)

  • @gabriellopez-mw8qc
    @gabriellopez-mw8qc 3 года назад

    I do like the idea of de-googled phones fighting with disinformation rather than just phones that create privacy by withholding it

  • @lucmorvan1867
    @lucmorvan1867 4 года назад +1

    It also looks like the /E/ OS weather app is showing Brest as mostly cloudy, which by nature is an improvement versus the Android/IOS phones always listing rainy or showers... 🤔 Jokes aside the OS looks very interesting and definitely matching an increasing demand. Great videos as always! Keep up with the great work.

    • @TheLinuxEXP
      @TheLinuxEXP  4 года назад +2

      Hahaha yeah, it never rains in Brest, it's just slightly grey and moist outside 😅
      Thanks for watching :)

  • @leighjenkins5601
    @leighjenkins5601 4 года назад +19

    I'm running Lineage OS and fdroid instead of google play.

    • @Joshlul
      @Joshlul 4 года назад +1

      This is better. /e/ are not magicians, nanodroid would accomplish something similar if you ran it in lineage, /e/ apps are proven insecure and send personal data over plaintext. BEWARE

    • @SpaceTimeBeing_
      @SpaceTimeBeing_ 4 года назад +2

      Lineage OS isn't completely degoogled. It still has a lot of dependencies on google codes and features. Also you could just use the other custom roms, they are all the same with more features if they are stable.

    • @Joshlul
      @Joshlul 4 года назад +1

      Neither is /e/

    • @jothain
      @jothain 4 года назад +1

      @@SpaceTimeBeing_ It's pretty highly degoogled imo. I noticed quite many misbehaves because of those missing features from g's services.Though I can't say/claim it's 100%

    • @gibberishdump1610
      @gibberishdump1610 4 года назад

      @@jothain ewwlo.void.partidopirata.com.ar/

  • @trippinf472
    @trippinf472 4 года назад +3

    As always great video!

  • @SuchtFaktorHoch10
    @SuchtFaktorHoch10 4 года назад +5

    I have only one question:
    Can I finally make an actual backup of the whole phone?

    • @AbteilungsleiterinBeiAntifaEV
      @AbteilungsleiterinBeiAntifaEV 4 года назад +1

      That's something u can do with the TeamWin Recovery, aka TWRP. It doesn't matter which ROM u use, because it's the recovery. In fact, I'd advise against this ROM, just get TWRP and any other ROM. Same difference, only that this ROM is outdated and ugly imo

  • @KLiNoTweet
    @KLiNoTweet 3 года назад

    I seriously consider buying one. Thanks for the recommendation!

  • @finnk1289
    @finnk1289 3 года назад

    If anyone wants the features of e/ on an unsupported device or with more up-to-date Android, try LineageOS. It's AMAZING. They support almost every device and constantly make newer versions.
    You will only miss out on the e/ account, something actually quite intriguing to me.

  • @raz0229
    @raz0229 4 года назад +3

    Why doesn't Huawei just team up with /e/ Project and use eOS in their latest phones

    • @josephanand16
      @josephanand16 4 года назад

      I think Huawei would still not be able to use this. Because the phone is Android based which is still owned by Google. Since the eproject is AOSP users can do what they like , but will not be allowed to make a business out of it. Hence eOs is "non profit"

    • @raz0229
      @raz0229 4 года назад

      @@josephanand16 Yea, makes sense

  • @gosth81
    @gosth81 3 года назад +3

    I'm seriously thinking to try this OS, I'm actually using a Redmi Note 8

  • @owaisparkar
    @owaisparkar 4 года назад +6

    Huawei wants to know your location

    • @TheZenytram
      @TheZenytram 4 года назад +2

      Is deGoogle but not deChina.

    • @khatuntsovmikhail6223
      @khatuntsovmikhail6223 3 года назад

      Huawei is more fair than Google! theybare saying we are selling cellphones. Google sell you service =)

    • @onebiglotus7347
      @onebiglotus7347 3 года назад

      Totally not a huawei employee

  • @nikolaidisharalambos6396
    @nikolaidisharalambos6396 3 года назад +1

    If something is for free, the product is you.

    • @TheLinuxEXP
      @TheLinuxEXP  3 года назад

      I generally agree with this phrase, except in the case of open source. It’s generally all free of charge, but you’re not really the product either :)

  • @rob-toolsandtech2521
    @rob-toolsandtech2521 4 года назад

    This is pretty cool. The ultimate would be if you can run android in a virtual machine. Turn on VM when you need to use a google app, or another low privacy app, then turn it back off when you’re done. Even if the controls for the host OS take up a bit of room on the screen somewhere, most of the modern phones have enough screen real estate for that anyway. Plus, if you ever upgrade the phone, running the VM on the new phone would be as easy as copying the file to the new phone.

  • @ahmada.562
    @ahmada.562 4 года назад +3

    I'm glad I got this recommendation 🙂 That said though, I find that this eOS is a major downgrade compared to the extremely feature-packed experience Samsung offers on their devices. Where's DeX mode? Where's Edge Panels? Where's the extremely versatile notes app? Where's GoodLock?
    I'd much rather just uninstall all the scroogle software that came on my Note 8 and stick with Samsung's extremely feature-packed, yet privacy-friendly offerings. Then control the traffic from my Note 8 with AdGuard Premium. Which is what I've done thus far.
    Make it OneUI based then we're talking.

    • @TheLinuxEXP
      @TheLinuxEXP  4 года назад +2

      That's features I had never used on my Samsung phone, they just clutter Android IMO with all that stuff that creates duplicate features :)

    • @ahmada.562
      @ahmada.562 4 года назад +3

      @@TheLinuxEXP Duplicate features? Lol, sounding like one of them uninformed reviewers. Samsung's software offerings are miles more feature-rich compared to scroogle's. So much so, literally EVERYTHING "new" to pitifully-limited stock Android 11 has been on my Note 8 right out of the box with Android 7.
      Heck, stock Android's desktop mode is still merely been in beta all this while, whereas Samsung DeX is already replacing chunky windows Laptops/Desktops in police vehicles and offices. How do you consider that "duplicate features"?
      Those duplicate apps you get out of the box are merely there for the user's convenience in deciding whether they want scroogle's data-harvesting services or Samsung's feature-rich and privacy-friendly services. The user can simply uninstall/disable the ones they don't want, which is what I did to all the scroogle apps on my Note 8.

    • @TheLinuxEXP
      @TheLinuxEXP  4 года назад +1

      I'm not uninformed. I used Samsung phones for 6 years now.
      These features are, IMO, clutter. The Android experience in general is super messy.
      The settings are mostly illegible, Samsung adds their own apps in too of Google's and also i stalls some Microsoft apps by default.
      There are tons of hidden features in the settings that are just useless to me. Swipe for a screenshot? Wake up the phone when you lift it? That sidebar thing, which you can bring up by swiping the power button ?
      It's just totally unnecessary to my experience with a phone. If other people use them, then good for them, but I would much prefer a simpler skin, like the one /e/ offers.

    • @ahmada.562
      @ahmada.562 4 года назад +2

      @@TheLinuxEXP You're certainly entitled to your opinion, but having experienced the Note 8 as my first ever Samsung Smartphone (after over half a decade of using just jailbroken iPhones then switching to Android on a OnePlus One in 2014), I simply can NEVER settle for anything less versatile than this.
      That palm swipe to capture has come in handy for capturing screenshots of various apps that respond to the press of my Note 8's buttons. I'd much rather have the choice when I need it than be stuck hunting around for some 3rd party solution when I need it.
      Raise to wake, although I personally didn't enable it, I can certainly see its use for the situation where your phone's power button got damaged. Instead of always having to use some pin to reach the button on the motherboard each time you want to wake up the device, you simply pick it up. Again, I'd much rather have the choice than be scrambling for some 3rd party solution when required.
      Finally, the Edge Panels, that's a MAJOR feature I use EVERYDAY on my Note 8. It provides a whole bunch of time saving functions, so much so, I can NEVER settle for a device without it. Below are just a handful of uses:
      - It provides quick access to my favorite apps and app pairs from ANY screen, including the lockscreen
      - It allows quick opening of apps like the calculator in floating window mode (I simply drag it from the Apps edge panel to the center of my screen) so I can calculate whatever is on my screen at the moment without wasting time switching between apps.
      - It enables quick tracking of my stocks on the stock market, via the Yahoo Finance Edge panel.
      - Enables quick tracking of breaking news headlines.
      - Enables quick access to my special bookmarks, including my Kodi stream pairing websites, getting to which needs to be fast before it times out in Kodi.
      - Enables quick access to a compass/leveler/ruler/flashlight/tally counter
      - Enables quick access to my favorite contacts
      - Enables quick access to weather information
      - Enables quick access to data usage information
      All of that, accessible from ANY screen (including lockscreen) with merely a swipe (configurable on a per panel basis). Plus, it is further extendable with 3rd party apps from the app store. I certainly ain't settling for any device without it. Stock Android would likely implement it in another decade like all their other "new" features...

  • @pointlessink6084
    @pointlessink6084 4 года назад +4

    Sadly many apps needs google services to work, tho it's true we need another system.

    • @AbteilungsleiterinBeiAntifaEV
      @AbteilungsleiterinBeiAntifaEV 4 года назад +2

      That's what MicroG is for. Look it up.

    • @pointlessink6084
      @pointlessink6084 4 года назад

      @@AbteilungsleiterinBeiAntifaEV Hopefully that would be possible, tho a lot of companies in and out of the western market still depends on a "secured" google services.

    • @harshvithlani9399
      @harshvithlani9399 4 года назад

      There is also harmony os coming

  • @python3.x
    @python3.x 4 года назад +11

    Great content. Question: How to move from Gmail?

    • @TheLinuxEXP
      @TheLinuxEXP  4 года назад +7

      I have already done a video on that, in the same playlist ;)

    • @simonebertini1813
      @simonebertini1813 4 года назад +9

      @Linux CodeX protonmail and tutanota should be the best alternatives

    • @michaelenelmar
      @michaelenelmar 4 года назад +2

      Pay a serious email provider and use a different app. I really recommend fair email, It is a great piece of work.

    • @speedflam
      @speedflam 4 года назад +1

      Mailo is a simple alternative :)

    • @damienw4958
      @damienw4958 4 года назад +2

      If you have have a server, you can make your own relay on it.

  • @exposingthedarknesswiththe9190
    @exposingthedarknesswiththe9190 2 года назад +1

    *SEEMS THE e-PHONE HAS A WAYS TO GO BEFORE WE HAVE UNLIMITED TEXT AND EMAIL TEXTS, ETC. WE EAGERLY AWAIT THESE STANDARDIZED IMPROVEMENTS.*

  • @strsocerplaya9
    @strsocerplaya9 3 года назад +1

    I'm so excited I found this. I fully support their efforts!

  • @MaiONerds
    @MaiONerds 4 года назад +5

    The real question is how will they feed their employees?

    • @darylrobbins2325
      @darylrobbins2325 4 года назад +7

      You can buy refurbished phone with /e/ installed on it. You can also buy storage upgrade. Also donations.

  • @greyman1104
    @greyman1104 4 года назад +5

    I don't trust them a single bit tbh.

    • @erwindee7384
      @erwindee7384 4 года назад +1

      Why not? I'm getting a weird vibe too but can't put my finger on it.

    • @Kevin-yh8ol
      @Kevin-yh8ol 4 года назад +1

      @@erwindee7384 is it because the letter e is just a flipped letter G from Google?

    • @erwindee7384
      @erwindee7384 4 года назад

      @@Kevin-yh8ol No. I think I was feeling like they were ignoring the elephant in the room that is LineageOS. Can't remember now.

  • @4ida
    @4ida 4 года назад +6

    Lol newpipe (open source) or YT vanced (apk mod) with MicroG (open source reimplemention of the brat) can be good enough

    • @michaelenelmar
      @michaelenelmar 4 года назад +3

      I'm using both for quite a long time now. Both are ad free and allow background playback. New Pipe downloads audio and video. It's sometimes a bit buggy, but definitely worth the patience. It also includes ad free soundcloud which is also very cool. You even can search on the sound cloud app and then play it with New Pipe. Get F-Droid to keep it updated. RUclips Vanced is on XDA Developers, watch out there are some fakes.

    • @MarkHobbes
      @MarkHobbes 4 года назад

      RUclips Vanced has features that are only available for RUclips Premium, pretty nice and no need to pay, also it removes entirely the ads (that's why a lot of RUclipsrs avoid talking and recommending using it) = Less revenue for them.

  • @user-mp3eq6ir5b
    @user-mp3eq6ir5b 3 года назад

    Now that I have read thru the review, I will watch it. Very well written, informative & anytime I see "open source" my antennas start vibrating. Like Mozilla with the T-Rex Hammer & Sickle "stand alone" installer.

  • @targeted4truthjahsun
    @targeted4truthjahsun 3 года назад +1

    The data collection includes biological functions breathing, schedule, eye dilations, voice changes modulations, and it's all analayzed with ARTIFICIAL INTELLIGENCE. It's called surveillance capitalism.

  • @thomaswalton9089
    @thomaswalton9089 4 года назад +3

    What a cheap company making you send it back after reviewing it for free smh

  • @chocoboasylum
    @chocoboasylum 3 года назад +1

    Very interesting! Specially now

  • @ElectromagneDikk
    @ElectromagneDikk 3 года назад +1

    I am so damn excited by this, oh man. It's literally going to be that kid on Christmas moment when I get one of these.

  • @bm-pp4xy
    @bm-pp4xy 3 года назад

    Google just shares our data to all but we have no option. Good to see competition

  • @PaulTaka123
    @PaulTaka123 4 года назад

    In any case as much as you want to run away from google and ios, and them harvesting data. The e account you sign to they will also harvest data. As long as you are going to sign in somewhere your data will be collected, and used somehow.
    There is no running away from data harvesting, its just that who do u want to give your data to

    • @TheLinuxEXP
      @TheLinuxEXP  4 года назад

      Except you'll be able to host these services yourself in the future if you want :)

  • @MxCrompli
    @MxCrompli 3 года назад +1

    I love how their entire brand is just the letter *e*
    2018 would be proud

  • @corataylor2205
    @corataylor2205 Год назад

    Appreciated the Yuka mention, such a slept on app.

  • @Rod_Knee
    @Rod_Knee 4 года назад +1

    Excellent review. I'll be trying /e/ after watching this. May breath some new life (and improved security) into my old phone, currently running LineageOS).

  • @Liberty4Ever
    @Liberty4Ever 3 года назад

    I love that there are downloads for many different older phones as well as relatively late model used phones with a no-G OS preinstalled for around $400.
    I removed as much G stuff from my phone as possible which doesn't get me much. This looks great.
    I can see carrying a stripped phone to use only as a phone and a no G tablet with no SIM card and only very rare access to WiFi for everything else - video, GPS, pictures, etc..

  • @LorenaTerryArtist
    @LorenaTerryArtist 2 года назад

    PLEASE keep us up to date on the E Project's progress via videos like these! It is PAST TIME that the US had a third option for people who don't want to be monitored nearly 24/7. I am especially happy that they are going to give users a way to easily download this eventually. I am completely & TOTALLY new to this world of wiping the native OS & downloading a different one, so that will definitely come in handy for me. 😁😍👍🏻👍🏻

    • @thomasmeunier8669
      @thomasmeunier8669 2 года назад +1

      Tip: don't try eOS, it is so bad

    • @elecbaguette
      @elecbaguette Год назад

      @@thomasmeunier8669 Tip: let people try things, to learn

  • @2disbetter
    @2disbetter 3 года назад

    For those unaware, you don't have to use any of E's default apps, you don't even have to use the launcher (bliss) that E OS uses. I for example use Nova Launcher. It is currently Android 9 or 10 depending on the image you are using.

  • @tontsar91
    @tontsar91 3 года назад

    I am so excited for Android without Google.

  • @trevormckellen5613
    @trevormckellen5613 3 года назад

    I like the OS and the fact that you still have access to the regular apps like Spotify

  • @TONYSESLCAFE
    @TONYSESLCAFE 3 года назад

    This guy is straight up. Quality channel.

  • @felipemoreira8308
    @felipemoreira8308 2 года назад

    There's a way of getting rid of big techs surveilance: using pencil and papers.

  • @mrwest5552
    @mrwest5552 3 года назад +1

    Fascinating. I understood the content of your review %99 through. Thank You.

  • @muhamadromdoni5501
    @muhamadromdoni5501 3 года назад

    Google says, let them create their own house, but the food must get from us.

  • @ryann6919
    @ryann6919 4 года назад +1

    This looks very promising. It's a good alternative to pinephone OSes (at least until they mature more). Would love to run this on a pinephone.

  • @gamethecupdog
    @gamethecupdog 2 года назад

    This led me to two very interesting discoveries, being that someones working on 3DS support on /e/, and that led to a continuation of linux on 3DS. Very fun stuff, if I learn how to I might contribute.

  • @kistnj
    @kistnj 3 года назад +1

    Lbry is a good alternative to RUclips you can also sync it with your RUclips channel if I understand it correctly

  • @Skeleman
    @Skeleman Год назад

    to put some context to that 12mb per day number:
    a lat and long take 16 characters or 16 bytes
    storing a copy of your exact location each second for a day would take just 1.3 MB (substantially less if you only stored when it changed and a timestamp)
    so with the remaining 11.5 MB they are certainly storing everyone you messaged, every website you visited, every app you opened, and who knows what else.
    a text description of every image you looked at? what do you think they trained their AI for.
    a transcript of every call you made? every word you spoke near your phone? what do you think they trained their AI for.

  • @Landofalcon007
    @Landofalcon007 4 года назад +1

    Your outro music is really funky, I love it.

  • @ElectricUAM
    @ElectricUAM 4 года назад +1

    I've been watching Eelo and /e/ since day one and know it will be my next phone. Since I've never flashed a phone before, I'm waiting on their installer to flash my old S7 but will soon get something from them directly. I hope it works well in the US, that's the only thing I have to make sure.

  • @rickchase6990
    @rickchase6990 3 года назад +1

    So relevant for 2021

  • @JakeWitmer
    @JakeWitmer 2 года назад

    *It would be nice to see an American public that cares about individual freedom.*