DNA Sequencing: The Chain Termination Method (Sanger Method)

Поделиться
HTML-код
  • Опубликовано: 28 окт 2024

Комментарии • 123

  • @g.m.43
    @g.m.43 8 лет назад +16

    at 0:35 please note that the 3'-end of the primer should point towards the region, which is to be sequenced. because the polymerase elongates the chain in 5'--->3' direction.

  • @oscarnator2324
    @oscarnator2324 5 лет назад

    Conor here is putting out the BEST video on the Sanger method!!!

  • @jessemaretzki8002
    @jessemaretzki8002 4 года назад

    Was trying to read this out of a textbook which was hard to understand conceptually. The video made things clearer. Thanks!

  • @Abominatrix650
    @Abominatrix650 11 лет назад +2

    I have been a tricky time with DNA Sequencing and you have provided brilliant help! Thanks!

  • @simeonandrews8223
    @simeonandrews8223 10 лет назад +30

    Note that this is not quite how modern Sanger sequencing is done. Rather than using radioactively labeled dNTPs, the ddNTPs each have a different fluorphore on them. There is only one reaction, and the sequence is read by looking at the color of fluorphore on the end of each consecutively longer strand.

    • @spagetti001
      @spagetti001 9 лет назад +2

      Simeon Andrews yeah but this is what it's based on, and if you're able to understand this, the fuorescent method is easier do decipher imo.

    • @jenniferwilson7654
      @jenniferwilson7654 7 лет назад

      yes but if kids at school are struggling to understand anyway then might as well just learn the right one ! it would be nice to have seen the nucleotides actually add in a short animation or at least series of diagrams so its not all in your head. nice video though.

    • @takkat12345
      @takkat12345 7 лет назад +3

      Students taking a genetics course need to know the old way sequencing was done as well as the newer ways.

    • @Bestmann3n
      @Bestmann3n 7 лет назад

      nothing like an intensive purpose

    • @nomsamahlangu1036
      @nomsamahlangu1036 6 лет назад +1

      That's Automated DNA sequencing, not Sanger method

  • @greyhound681
    @greyhound681 8 лет назад +20

    Your voice make me feels calm.
    Sorry for being weird.

  • @momokokochuchuchu
    @momokokochuchuchu 8 лет назад +98

    the accent made this vid even better

    • @Nickoking12
      @Nickoking12 7 лет назад +11

      No you can't barely understand him at some points which makes 50% of these videos a pain in the ass to watch

    • @arielacorte-real7611
      @arielacorte-real7611 6 лет назад

      Exactly

    • @Zaper06
      @Zaper06 6 лет назад +4

      Not really. He kinda swallows half of the words.

  • @KM-cw1gv
    @KM-cw1gv 10 лет назад +5

    Simple and straight forward. Thank-you!

  • @I.G.61
    @I.G.61 9 лет назад +3

    You've helped me so much, thank you. Even though I'm german I understood it very well. This video is definitely the best one you can find on RUclips.

  • @tomgannan6845
    @tomgannan6845 Год назад

    Insha'Allah Allah has allowed me to find this video mashallah i will do well in my exam

  • @romaissasenoussaoui1559
    @romaissasenoussaoui1559 8 лет назад +1

    All clear Now and the accent made it a lot better Thank you !

  • @aysiasantana5862
    @aysiasantana5862 9 лет назад +19

    i love your accent oh my gosh i watched for that mostly i kinda zoned out lol

  • @merry506
    @merry506 4 года назад

    I only started watching these videos for my Science class because I didn't take the basic course in the previous year...Now, I'm getting recommendations on MCAT exam tips...TT

  • @tk112190
    @tk112190 11 лет назад

    Nice short video. Just what I needed, thanks so much

  • @wazscience
    @wazscience 11 лет назад

    When you digest your Dna it is always done with a restriction enzyme that s widely available and we'll known, which includes information on the specific sequence the enzyme cuts at.

  • @PhoenixVert
    @PhoenixVert 6 лет назад

    Roy from the IT crowd!!! (Really great video by the way!)

  • @tushi1993
    @tushi1993 8 лет назад +2

    You add the primer from 3' to 5'. Shouldn't it be the other way around or is that just the case for DNA polymerization ?

  • @MegaReluctant
    @MegaReluctant 5 лет назад +1

    I don't understand how knowing one base (the detectable one) helps determine all the bases on the strand. I've seen several videos like this that just end with this comment but don't explain it. Confused.

  • @jeepee93
    @jeepee93 10 лет назад +8

    primer annealed to wrong side of strand in video as annoted

  • @abidnaseer9621
    @abidnaseer9621 8 лет назад +4

    I think ddNTPs are labbled not dNTPs.
    Am I right??

  • @wazscience
    @wazscience 11 лет назад

    usually this is done on DNA fragment that have been formed using restriction endonucleases. These enzyme only cleave the DNA at specific sequences so we can use these "restriction sites"as sites to add the primer.

  • @lavenderlemons888
    @lavenderlemons888 8 лет назад +6

    I'm still confused why reading across the bands will tell you the dna sequence. am I missing background info that would help?

    • @deenaharoon1
      @deenaharoon1 8 лет назад +1

      Did you find the answer yet ?
      I have the same question 😑

    • @lavenderlemons888
      @lavenderlemons888 8 лет назад

      +Deena Haroon I typed all this on my phone and only now realized all the typing errors. sorry. I hope you can read past it and it was able to explain it properly. (as a note, although it may look like the 5' end is the end shortening, it should be the 3' end that is being removed and shortened.)

    • @i0like0water
      @i0like0water 8 лет назад

      +Jessica Wong hey im not entirely sure myself but the video mentions that the gel can separate molecules by even one base. And usually, when you use a gel you always have a marker (I'm assuming these markers mark different intervals across the length of DNA). So if you combine this with the fact that each lane has a band corresponding to a termination by a base of that lane, you can read off (using the marker) where these bases are on the fragment of DNA.
      Not too sure I made any sense there hah

    • @i0like0water
      @i0like0water 8 лет назад

      +Jessica Wong actually, you probably don't even need a ladder here. I think the main fact is that you have a primer, so you can make a defined start point. So the template bound to the primer should be the smallest molecule. On a gel, this should be at the bottom. So now, if you have all other molecules in the well separated by a single base, you can pretty much read the order in which they appear, from the primer sequence onwards (or upwards in the gel).
      Again, hope that makes sense. I'm busy studying for a genetics exam :-p

  • @jamescampbell5816
    @jamescampbell5816 9 лет назад

    Thank you!! Awesomely simple! So many crap explanations of this out there...

  • @Lexigrl07
    @Lexigrl07 6 лет назад

    Super helpful for my biochemistry midterm! Thanks :D

  • @jackalexander9078
    @jackalexander9078 10 лет назад

    @JPFamisan so you add the primer to the complimentary strand, in order to replicate the sense strand with the mixture of free dNTPs and ddNTPs?

  • @شركةالثقةللقبولاتالدراسية

    Thanks . it's good illustration video for DNA sequencing technique .

  • @melissaflores3336
    @melissaflores3336 8 лет назад

    Great animation! Thanks for uploading

  • @sathiyaatchaya1591
    @sathiyaatchaya1591 7 лет назад

    Easily explained so much useful

  • @borbalaolahnehorvath4678
    @borbalaolahnehorvath4678 8 лет назад +3

    Hi, sorry when I'm wrong, but DNA ploymerase goes from 5' to 3', so is the primer in the video on the wrong side, isn't it ?

    • @lobsterairsoft499
      @lobsterairsoft499 8 лет назад

      +Borbála Horváth DNA pol goes from 3' to 5'

    • @PeterAllen
      @PeterAllen 8 лет назад +2

      +Borat Sagdiyev To rid of any confusion: DNA Poly replicates in the 5' to 3' direction complementary to the template strand which will appear 3' to 5'.
      Edit: Removed PolyIII as Poly I is used in this method.

    • @lobsterairsoft499
      @lobsterairsoft499 8 лет назад +1

      +Peter Allen Thats awkward phrasing. DNA polymerase travels in a 3' to 5' direction, producing a NEW DNA strand in the 5' to 3' direction

    • @PeterAllen
      @PeterAllen 8 лет назад +1

      You're correct, sorry about that! Thanks for rephrasing!

    • @jenniferwilson7654
      @jenniferwilson7654 7 лет назад +1

      I think you are correct - new nucleotides add on to the 3' end - so that would make it the wrong way round

  • @malihatahir1866
    @malihatahir1866 8 лет назад +1

    Sanger method is used to determine dna sequence and requires a primer. Then how, a primer sequence is known?

  • @xMangaDarkAngelx
    @xMangaDarkAngelx 11 лет назад

    Now why couldn't my lecturer explain it like that? Always adding useless side notes! Thank you for the clear explanation!

  • @beepboop9079
    @beepboop9079 6 лет назад

    Is the sequence of the DNA shown on the gel CGGTAGCTACATGACGTTCTGA?

  • @laurelcook9078
    @laurelcook9078 6 лет назад

    Are you Canadian by any chance? The way you said "aloow" was very French Canadian, but I like your accent a lot.

  • @patrickgarrie4315
    @patrickgarrie4315 9 лет назад +2

    Why are you making this from the hills of Ireland?

  • @Duffyyy94
    @Duffyyy94 7 лет назад

    Thanks, this made it so clear!!!

  • @hanse90
    @hanse90 10 лет назад

    This video was very helpful. Thank you :)

  • @Spartan1853
    @Spartan1853 10 лет назад +2

    Thank you. Very helpful.

  • @boci_music
    @boci_music 9 лет назад +43

    I'm going to fail A2 biology 😭 thanks though

  • @nidakallu8376
    @nidakallu8376 2 года назад

    At start of the process, we don't know the sequence of DNA ...then how the primer is designed?
    Kindly answer this question

  • @4oureveryoung
    @4oureveryoung 11 лет назад

    AMAZING EXPLANATION!!!

  • @charifasamam.d.7999
    @charifasamam.d.7999 8 лет назад

    thanks, its help me to understand my lecture and make it easierr !! Aplause 4 you :)

  • @kennedybrittain6299
    @kennedybrittain6299 8 лет назад

    Thank you!! Very clear

  • @robemoreno7736
    @robemoreno7736 2 года назад

    The primer needs to be on the 3' end not the 5'end. Remember, DNA is synthesized 5' to 3'.

  • @dr.nasiruddinmithumd4304
    @dr.nasiruddinmithumd4304 8 лет назад

    Thanks for the video

  • @tandyalaaliveni6523
    @tandyalaaliveni6523 2 года назад

    Thank you so much sir

  • @coolranchrebecca
    @coolranchrebecca 9 лет назад

    Should the primer be annealed to the three prime end? Great video by the way :)

    • @joeys_rattata5013
      @joeys_rattata5013 9 лет назад

      The primer anneals to the 3' end of the template strand becoming the 5' end of the new strand.

  • @tk112190
    @tk112190 11 лет назад +1

    The ending totally leaves you hanging.....

  • @oanalupu23
    @oanalupu23 11 лет назад

    very helpful video, thanks you!

  • @aleksandraantonczyk9178
    @aleksandraantonczyk9178 10 лет назад +2

    Very nicely made video, one question not related to the subject.. vere is the accent from ?

    • @DA-js7xz
      @DA-js7xz 10 лет назад +1

      Sounds Irish to me.

  • @razzlefrog
    @razzlefrog 11 лет назад

    I LOVE YOU YOU ARE WONDERFUL AND I LOVE YOU. Woo! Now back to studying.

  • @shalimashaji3052
    @shalimashaji3052 8 лет назад

    it is very informative

  • @vaibhavshah3254
    @vaibhavshah3254 11 лет назад

    Thank you so much! It helped alot!

  • @kim-julienguyen4264
    @kim-julienguyen4264 11 лет назад

    Perfectly explained! Thank-you :)

  • @Kenny-sl6hb
    @Kenny-sl6hb 8 лет назад

    Thank you so much.

  • @kennethshim7501
    @kennethshim7501 9 лет назад +1

    I thought ddNTP is radiolabled, not 'one of dNTPs'. if one of 'dNTP' was instead radiolabled, then you wouldn't be able to assess the length accurately.

  • @iiAngelic
    @iiAngelic 9 лет назад

    1:34 what did he say? "The DNA must now be separated onsite"?

    • @marijn5959
      @marijn5959 9 лет назад +1

      +Vivi33 The DNA must now be separated on size.

  • @ivanacevedo5219
    @ivanacevedo5219 7 лет назад

    why u don't have more videos like this?

  • @iraklikalichava5219
    @iraklikalichava5219 9 лет назад +3

    is this a computer generated voice?

    • @tianyinjia
      @tianyinjia 8 лет назад +1

      +Irakli Kalichava Irish country voice

  • @Chestersgorilla
    @Chestersgorilla 10 лет назад +11

    you sounds like you are in a giant saucepan

  • @WilfredLim
    @WilfredLim 9 лет назад

    Thanks so much

  • @ghadeeryousef1125
    @ghadeeryousef1125 7 лет назад

    thank for you 💖

  • @aboutstudies123
    @aboutstudies123 6 лет назад

    Thank you

  • @sarahbrown31
    @sarahbrown31 6 лет назад

    really good science pls

  • @eboyetraore6714
    @eboyetraore6714 10 лет назад

    You forgot to mention that you need to heat the ds DNA first. And than the DNA polymerase can add dNTPs and ddNTPs..

  • @maroonhorizon1693
    @maroonhorizon1693 4 года назад

    The primer is on the WRONG SIDE.

  • @yawarkhan8309
    @yawarkhan8309 4 года назад

    I think primer is attached on wrong side!please explain this your video confuse me further!

  • @srijanachand6019
    @srijanachand6019 8 лет назад

    how to dowanlod this

  • @akhatib2805
    @akhatib2805 8 лет назад +1

    we want french traduction pleaze

  • @frusci4an1e
    @frusci4an1e 7 лет назад

    The primer is on the wrong end!

    • @filipematias2239
      @filipematias2239 7 лет назад

      I noticed that too *Kickass nickname btw*, and got a little confused. Nevertheless, great video. Thanks

  • @shrutisarode6148
    @shrutisarode6148 10 лет назад

    great :)

  • @James-Specter
    @James-Specter 3 года назад

    eire stand up !

  • @nazmarashid4987
    @nazmarashid4987 4 года назад

    V.nice..

  • @JO-mg6xc
    @JO-mg6xc 4 года назад

    He put the primer on wrong end!

  • @adamdictatedbutnotreadkadh8719
    @adamdictatedbutnotreadkadh8719 7 лет назад +1

    thumbs up if u rchs

  • @helsinkiin
    @helsinkiin 11 лет назад

    thanks for the good video but dear god you mumble at times

  • @franciscozorrilla8440
    @franciscozorrilla8440 6 лет назад

    ooohh haychee gruup

  • @SirWales
    @SirWales 7 лет назад

    interesting

  • @woodyxiao263
    @woodyxiao263 7 лет назад

    old-fashion way in at this omics era.

  • @adarshguptak
    @adarshguptak 9 лет назад

    or 35S? LOL

  • @annahaener
    @annahaener 2 года назад

    1:02 - reaction 'mixters', meaning mixtures? thanks for the video, but my ears bled listening to this accent, no offence really.

  • @TakiCyke
    @TakiCyke 9 лет назад

    german narrator

    • @TakiCyke
      @TakiCyke 9 лет назад

      Javier M thanks for the video ^^

    • @gumchewer9
      @gumchewer9 9 лет назад +6

      Javier M Irish actually

  • @joewaters9884
    @joewaters9884 7 лет назад

    I feel like this is a fake accent...

  • @omareaziz9115
    @omareaziz9115 8 лет назад

    YOUR VOICE IS DISTURBING.

  • @ChenyChenyChenyCheny
    @ChenyChenyChenyCheny 8 лет назад +2

    1. He fails to explain that it is the primers that got labeled so that X-ray can be used to see all sequences.
    2. His accent is annoying.
    3. He fails to mention the sequences differ by one base only in gel electrophoresis.
    Therefore I gave the video a thumb down.

    • @knockbridgeman
      @knockbridgeman  8 лет назад +47

      In reply to your critisms:
      1) Radiolabelling of nucleotides mentioned at 1:02. Also, at 2:09; "The gel is dried down and an X-ray taken. Since we radio-labelled a dNTP we can now see it show up on the X-ray film."
      2) A matter of opinion. I would point out that Irish accents are consistently ranked as some of the most attractive, but I understand that some people are just hard to please.
      3) This is incorrect. At 1:47 I mention how polyacrylamide gels can separate fragments differing in length by 1bp. Also I would point out, contrary to your point, that this is not true for all gels. Agarose gels for example, can typically resolve differences no smaller than ~40bp between fragments but this does depend on the gel percentage and other variables.

    • @ChenyChenyChenyCheny
      @ChenyChenyChenyCheny 8 лет назад +1

      Thumb up for the effort.

    • @SS-cr4xn
      @SS-cr4xn 8 лет назад +12

      wilson Liu u got rekt

    • @nha8909
      @nha8909 8 лет назад +2

      your comment is unnecessary

    • @PhoenixVert
      @PhoenixVert 6 лет назад +4

      if you understand it so well then why don't you make your own video?

  • @raikasupasayjin4549
    @raikasupasayjin4549 7 лет назад

    thank you

  • @rabinkc831
    @rabinkc831 5 лет назад

    thank you...