And why do you believe that is the case? Maybe the programmer wants us to find out we're not real. This could even be the sole purpose of the simulation, a simulation is usually run with a purpose/goal in mind. PS: I want it to be clear that I personally do not believe we are in a simulation.
Hitchhiker's Guide to the Galaxy: "There is a theory which states that if ever anyone discovers exactly what the Universe is for and why it is here, it will instantly disappear and be replaced by something even more bizarre and inexplicable."
@@dakotadad8835 Nope, it is "So long, and thanks for all the fish". This might sound nitpicky, but it makes a difference. Your simulation is sloppy, so you might actually be a simulation, as a real conscious being would have looked it up … (3 + 3) x 7 … ;-)
I absolutely love your strict sense of epistemological truths by saying that illogical things are not necessarily wrong. We just can't verify them scientifically
@Jorge A. Of course the scientific method is limited. Science only attempts to explain natural phenomena by natural causes. All claims that the only form of knowledge is science is scientism, a philosophical/religious position.
This is how I approach the concept of God. For simplicity I describe myself as an atheist. But really, I'm an agnostic atheist. I don't BELIEVE there's a God because there is no scientific / tangible evidence, but don't entirely rule it out since I know things can exist that can't be verified (at least, not yet).
Every so often Occam's razor fails, after all. The cosmological constant is such an example, which Einstein proposed to explain how the universe could not collapse, before learning the universe was expanding and labeling that his biggest mistake. But it turned out that needless complication that wasn't needed to explain the universe was true anyway.
@@jeff6413 There is no scientific tangible evidence of God? How about all physical reality? It is certainly measurable. It is certainly evidence that there was an uncaused cause - which is what people call God. Whether God is a person/intelligence is a completely different question. That too has very good evidence.
I'm a software developer and had this idea we could be a simulation for many years already, I didn't know someone would say some day that believe it almost like a religion, that's crazy. A possibility, it's just that. And please stop trying to understand it from our technology point of view, quantum processing don't have to even be mentioned, it wouldn't exists outside our "reality" if we are a simulation, it could be something totally unexpected for us. Imagine an AI NPC from a virtual world without own access to internet in any how, trying to figure out how we the creators are, and then arguing that for them to be simulated, we (the creators) need to have an insane amount of chaos and soul stones at least level 12, so he concludes it's not possible.
Yea that's how I see it too. If we are in a simulation, who knows what the reality looks like? It could be like 100 dimensions or some shit, who knows? But it's just a possibility, there is no way to find out for us.
The problem with this reply is that she isn't using technology to understand the simulation theory. These are the exact kinds of analogies that people who seriously hold to the simulation hypothesis actually make. She's just referencing the examples that they commonly refer to.
I’ve narrowed this to the following possibilities: 1. It’s boring if you don’t 2. You’re being punished 3. It is specifically these difficult situations that need studying 4. The rewards are greater if you do. 5. The universe (or the creator of the program) is intrinsically evil.
@@jmarkinman woah, I'll go with 4th one. Even though it wasn't what I expected but still choosing the hardest level has provided above average success (only once as I haven't explored other servers/maps).
The crux of her counter-argument is that we do not possess any computer algorithm capable of re-producing various physics, like general relativity. That isn't exactly true anymore. Wolfram's latest project is doing exactly that: reproducing the systems we see in our own universe, like quantum mechanical effects or relativity, etc., using simple cellular automata algorithmically modified via simple rules. Just google Wolfram's New Physics. Verrrry complex systems have been algorithmically generated by simple cellular automata and, while the underlying mechanisms of our own observed universe have not yet been reproduced in this way,- they might be, and there's little reason to think that they cannot, given what Wolfram's project has already churned out.
@@tylerchambers6246 she's also partially incorrect. there are ways to experimentally test for various simulation scenarios, there are actual scientific papers on this. obviously, if all of the tests turn up negative then maybe the simulation hypothesis is wrong (for what we can check), and the hypothesis has other problems on its own beyond tests. But that's the opposite of pseudoscience, that's science.
We are immortal, non-physical beings having a temporary human experience in a "virtual reality", and the purpose of life is to increase the quality of our consciousness, while lowering our entropy, through learning and evolving by making good and bad choices. Please familiarize yourself with former NASA physicist and consciousness / out-of-body expert Tom Campbell's Theory of Everything, if you'd love to have your mind blown by a non-dogmatic reality model without a single flaw.
Ekactly - it's mostly philosophical with some theological variants, at least for now. Different mathematicions have tried calculating the probabilities for the simu. Hypo. To be true, but for that they need to do a loooot of assumptions s which may or may not be true, and in the end the reselts no far have always come close to 50%. Once phycicists discover something that allows us to decide whether the universe is computable or not, or neurologists and/or computer scientists discover just how consciousness arises, then we'll have actual data to fill in the blanks of those calculations. So far, the best we have is educated guesses, no more
@@JosePineda-cy6om ...Plus philosophy, physics, mathematics and proofreading. I'd add English language comprehension and syntax usage, however Google's g-board is now so completely broken that adding these latter two would be somewhat unfair of me. If you *do* happen to use g-board, that is. And, on a seemingly unrelated topic, but just while we're all here, it may prove fruitful to actually read the words of comment you're responding to *before* responding to the comment.
He didn't write the paper to argue that we are in a simulation. It is entirely philosophical. See my full reply in the main comment thread. Bostrom believes his argument is sound, and that the simulation hypothesis itself is unlikely. www.simulation-argument.com/faq.html
Just discovered your channel, you remind me of so many of my favorite teachers from growing up, and it makes your videos and learning from them really cozy. Keep up the great work!
I wasn´t aware of this "argumentation" - it is so flawed it coud be from an flat earther of religious extremist. Didn´t they teach anymore basic reasoning anywhere?
The main concern I have about the simulation hypothesis, other than being unfalsifiable, is its recursive nature. If we would indeed be living inside a simulation, there's no reason whatever is running the simulation isn't inside a simulation itself. It's turtles all the way up.
It's funny you say that, because NDT used a supposed recursive nature in his argument that it's > 50/50. His argument presupposed that it's possible to simulate a universe in a universe in a ... But where, might these simulations be in each universe? It would seem bold to assume a piece could simulate another with comparable detail. So then we either we are the top level universe or we assume universes with greater complexity to explain our own.
That's not why he said it's 50/50. It's 50/50, because we don't know whether the conditions for the theory will be met, ie. that ancestor simulations are indeed possible and that humans don't become extinct in the future. Under these condition, he argues we definitely will create one, and then the chances that we are in thr real universe is basically zero, because the simulated universes will outnumber the one non-simulated 1 to almost infinity, due to their recursive nature. His 50/50 proclamation is a pure guess and honestly bullshit, as it is impossible to say whether we will be able to create ancestor simulations. That's also why his theory is so worthless. It is a nice thought experiment, nothing more.
@@zagreus5773 sure, it's just rediculous to assume that gives you 50/50 odds. Potential conditions we don't know the truth of doesn't automatically get 50/50 odds. Most ideas a human can come up with are false, even when you narrow down to the ones that seem very plausible. EDIT: Grammar
How's that an issue? It doesn't need to be infinite, anyway. It could be that our creators live in an universe which is not a simulation, and they're wondering about its nature.
@@emotionblur7214 It needs to be infinite for you to be sure. If we in our universe create an exact copy of it in form of an ancestor simulation, the copy will also create an exact copy, and so on. Therefore the number of simulated universes would approach infinity and we could say with certainty that we live in a simulation. The problem is that ancestor simulations are very unlikely to be possible. Therefor the theory is an interesting thought experiment, but nothing more. The theory was originally created by Nick Bostrom, a philosopher, NDT just jumped on it and seemingly never understood it. It is well known that NDT is a great example of Dunning-Krueger if it comes to philosophy. Your example isn't even a thought experiment. Theoretically anything is possible if you allow for other universes. That's nothing new and not interesting.
I think the simulation hypothesis is one of those cases where we can quote Carl Sagan: "It pays to keep an open mind, but not so open your brains fall out."
Sabine was speaking in another video that there is no infinite in real life. I think this is the strongest support for this hypothesis because it implies that there is a minimum resolution and a maximum limit which may be imposed to the simulation. Also, the existence of entropy is a strong advocate for this theory. Why ? Because over time everything gets destroyed which you can associate with small glitches/uncorrectable errors that piles as the time passes. You don't need to calculate everything to the smallest details and this was proven by Machine Learning models being able to simulate physics in almost real time . This is done by approximating the outcome of a simulation based on lots of training and without being aware of the underlying physical laws. You can even go further and look at the uncertainty principle which clearly limits your resolution and amount of details you can discover . Dismissing this as based on religious reasons doesn't mean your brain "falls out" but it means that we don't have enough information to confirm if this is true or not. It is easy to dismiss the existence of Jesus and the events in the Bible or other attempt to religions (like hinduism , islam etc) now , because after we got smarter and the humanity discovered more and more of the secrets of the universe the basis of those religions became childish and their stories are just less and less believable. This is not true of the simulation principle which, by every year that passes, becomes more and more likely just by observing simple stuff like the evolution of games from Pong to Huge Open Worlds , the increase in computation power or the increase migration to the virtual space which for many has become the place where they spend most of their life
@@danielstan2301 WTF are you even talking about? "Also, the existence of entropy is a strong advocate for this theory. " This is absolute nonsense. "Dismissing this as based on religious reasons doesn't mean your brain "falls out" but it means that we don't have enough information to confirm if this is true or not." Yes your brain has fallen out especially your reasoning from "entropy is strong advocate" just made me laugh. Go back got to watch Matrix stan. " because after we got smarter and the humanity discovered more and more of the secrets of the universe the basis of those religions became childish and their stories are just less and less believable." Exactly and some people decided to change those stories into STORIES ABOUT SIMULATION. " This is not true of the simulation principle which, by every year that passes, becomes more and more likely just by observing simple stuff like.. " EXISTENCE OF SIMULATION IN REAL WORLD DOESN*T IMPLY THE WORLD ITSELF IS SIMULATION YOU F IDIOT.
The simulation argument concludes we are most likely NOT in a simulation. Sometimes it seems like no one has actually read the paper. (I really hope im not wrong on this one lol I've read the paper several times it's pretty interesting but maybe i forgot)
There's more than one version of the argument, and lots of iterations from many different sources. Mostly I think it's just an interesting idea, but it'll be great if someone ever develops some testables.
@@Egonkiller Yes. If you, like the person in the video, are referring to Bostrom's Simulation Trilemma ... yeah, it absolutely does NOT claim we are simulated. It sets forth a scientific/philosophic trilemma that concludes ONE of three things must be true ... only one of which is that we are simulated beings. For some reason, "hard scientists" have lost their minds over this, while scientist/philosophers like Nick Bostrom and David Chalmers talk about it reasonably. I guess science without philosophy really is a bad thing.
But how on earth do these people come up with the likelihood/odds for it being true or not? It seems to me that every "theory" about this subject, whatever their conclusion may be, are all based on a very shaky foundation of assumptions and conjecture to witch they assign some arbitrary numbers. We just don't know. All we can really conclude is, that at this point we don't know enough to rule it out. What does it matter anyway? If you knew life was a simulation, what would you do with that knowledge? I doubt there are any cheat codes or Easter-eggs to be found.
@@1112viggo What do you mean by "likelihood/odds?" The original source of this, Nick Bostrom's trilemma, simply sets forth a philosophical argument ... "If A, then B," etc. It is interesting and compelling. Beyond that, I think people read too much into it. And, to be clear, Bostrom absolutely did NOT claim that we are living in a simulation.
Ah, let me rephrase this but in 600 pages written on turgid prose but laced with so many pop-culture catch-phrases that you don't notice. It's gonna be a hit! :^)
No problem, A & CT, the neural structures of a butterfly cannot possibly support the complicated ideas of Chung Tzu, so he dreamt of the butterfly, definitely NOT the other way around. (I'm glad some one finally asked. Cheers.)
@@andsalomoni Ok, good point. But there was this sleep research experiment where a group was deprived of REM sleep and the control group was awakened the same times as the first but on random times. After a few days the control group was just a bit groggy, but the first group was hallucinating. What dreams are for didn't this experiment answer. But it suggests that dreams are to sort and generalize the impressions the brain gets. A debriefing, so to speak. Then there's the fact that children more often have nightmares and moves around more when sleeping. There must be some reason to that.
@@abaddonanon7573 Dreams are ways to solve unresolved mental issues. If in everyday life the mind accumulates issues of any kinds, the dreams are ways that the mind uses to solve them, or at least face them, with imagination. If you hinder this solution, the mind goes mad and starts to make it in the awake state, hallucinating. The one who doesn't accumulate garbage in the mind in daytime life, doesn't need dreams, and actually sleeps in deep sleep only. Persons with a years long experience of meditation practice can reach this condition.
"um actually" Pseudoscience is “a collection of beliefs or practices mistakenly regarded as being based on scientific method.” By definition, Multiverse, RNA World, Scientific Racism Hypotheses are classified as “Pseudoscience”.
@@moses777exodus The RNA-World-Hypothesis is based on the observation of information storage and catalytical behaviour of RNA molecules. So I would argue that it is a valid hypothesis derived by scientific means. The downfall of all abiogenesis hypotheses is, that it is hardly testable what the first replicator was. On the topic of the Multiverse and Scientific Racism I am with you.
If we are living in a simulation, then the laws of physics as we know them are really just the rules of the simulation. Therefore, we wouldn't actually know the real laws of physics in the "real" world, so how can we say it wouldn't be possible to simulate? In the end though, it really doesn't matter. Even if we are in a simulation, that has exactly zero implications for how you live your life. You can't get out of the simulation, and you can't break the rules of the simulation (i.e. break the laws of physics). If the designers decide one day to just shut it all down, not only is there nothing you could do about it, you also wouldn't even be aware it had happened. You would simply cease to exist. This is what happens to everyone eventually, anyway. Whether by the simulation ending or you dying, you aren't going to be aware that it's over. What I'm getting at is that this reality or simulation we live in is what we have, and it makes no difference which it is. So, my take on the simulation theory is that I don't really care, because it doesn't matter either way.
@@B1GDINO yeah, it might mean nothing to me or OP but it defo has big implications for MANY people. it would be truly world shattering to anyone devoutly religious
Not only it wouldn't matter since noone can unplug (unless one starts preaching death is unplugging), but there's another issue - simulating that many "useless" people (possibly animals too then?) is a huge waste, isn't it?
Thanks Sabine - I did think that when Tyson brought out the 50-50 odds about simulation, it sounded like something being thrown in from nowhere rather than actual science. I expected better than that from an astrophysicist
Also, scientist don't pretend that their conversations is "sciense" or even should be. Kinda weird to critique a statement or dialogue for not "being science," since it probably even can't be. Statements CAN be part of science o/c, but that's a different matter.
If you watch the interview where he says that, you'll see it's just a bit of fun (which Sabine acknowledges). He wasn't saying it within a serious scientific context
As a philosophical idea the simulation hypothesis doesn't make specific claims about the nature of this reality, as much as it entertains the notion that there may be other realities than our own.
So long as the code is unhackable. I mean that's sort of the point of The Matrix. If you believe you are in a simulation then the idea that you could possibly reach outside that simulation would be fascinating, but there are so many things with so much higher possibilities of both being real and of being unlockable technologically that it seems kind of questionable to spend much time on a cosmic longshot unless you have a really good idea on how you could test it. One of the weird things about the intersection of science and philosophy is watching scientists, who've spent vast amounts of time learning science, suddenly discovering epistemological philosophies and wading in like because they are scientists and they haven't explored these things before that no one has. There was a big debate in the atheist community about whether Neil DeGrasse Tyson was an atheist, as he'd hedged his bets whenever asked directly but seemed to be leaning that way, but there he was, wading into simulation theory. (It was actually a fascinating debate that pitted some diverse ideas, from what is the difference between and atheist and a agnostic, but also do people have the right to label themselves something even if the evidence suggests they don't fit that label... which was getting some weird responses from people who in almost every other aspect of life would be all for letting people label themselves.)
Exactly. Even if reality is just interactions of fields and one dimensional strings of vibrating ???? - I still have to pay my mortgage by the 5th of the month.
Douglas Adams wrote irreverent comedy. He wrote for Monty Python’s Flying Circus. I would think that one must have a dull life if they are proud not to have read his stuff.
Her argument that it's not easy to reproduce the foundations of physics with code is valid only if we accept that the same foundations are true outside the simulation too. But if we live in a simulation the physics of our universe may very well be only an artifact of the simulation
@@mdbk2 but that is just another assumption and like stated at the end: it does not mean it is a wrong hypothesis. it just cant be proven therefore its unscientific to believe it is true.
But if that would be the case, it is still unscientific because science is a product of our “world”. Hence, circular argument, hence scientifically irrelevant. Hence, just a matter of faith, which is also fine. I think she’s just clearing the use of the terms.
@@mdbk2 erm a lot of people who've done the lightest pop science reading repeat this. Anecdotally my sister, my flatmate and one of my colleagues fully believe that we are in a simulation. The plot of the matrix revolves around this, and people have taken to using it for simulation theory example. This video is probably more for those who do believe in this hypothesis and this is an educational channel
I am a physicist and cannot support the arguments in this video. Physics is concerned with modeling reality. We are now at the point where the particle model can no longer explain the reality that has been explored. Science leads us now to believe that information is the basis of our reality. Now models are evaluated according to how well they explain reality and the virtual reality model can do that quite well. Many problems in physics disappear into thin air, such as the constancy of the speed of light, the entanglement of quantum particles and much more. And this really has nothing to do with belief, but is based on scientific knowledge that we have gathered from quantum physics. There is definitely logic on your side when you use virtual reality as a model.
@@petros_adamopoulos The fallacy with both claims of no evidence (simulation theory and God) is that evidence is redefined by those that claim there is none. Evidence for a particular idea does not require no other explanation. Evidence is not proof. Thats a common erroneous conflation. Thus in a murder case opportunity and motive is evidence against a defendant . It doesn't matter if there are alternative motives and others with opportunity. Again evidence is not proof. The defendant may in fact be entirely innocent and still have evidence of guilt. There are numerous evidences for God (which is why around 90% of the population including some scientists believe in god. You just label their reasons as nonevidence because you have alternate explanations (many of which you have no evidence for ). However alternate explanations doesn't negate evidence. they are just alternate explanations for evidence.
Simulation: 1. the act or an instance of simulating 2. the assumption of a false appearance or form 3. a representation of a problem, situation, etc, in mathematical terms, esp using a computer 4. mathematics, statistics, computing the construction of a mathematical model for some process, situation, etc, in order to estimate its characteristics or solve problems about it probabilistically in terms of the model 5. psychiatry the conscious process of feigning illness in order to gain some particular end; malingering 1. the act of simulating; pretense; feigning 2. a. a simulated resemblance b. an imitation or counterfeit I reckon you could apply all of those definitions to Covid; the simulation within our reality. www.collinsdictionary.com/dictionary/english/simulation
Her argument is weak. Just because we can't run a quantum Sim with general relativity doesn't mean we shouldn't assume other civilizations can't. I agree there's no way to prove it, but because something can't be proven doesn't make it unscientific, it just makes it a theory..
This episode is flawed from the base. Bostrom’s argument is not the one displayed and commented. It is more like this : 1- civilization(s) end before able to do simulations 2- civilisation(s) do not want to start a simulation 3- we are in a simulation Choose which one you want .
To arrive at that state where we can even talk about civilizations reaching capabilities to build simulations there is hidden begging of question: while the argument is praised as if it discusses this universe, for the third conclusion which is used to justify 1 and 2, we actually already stepped to some other assumed universe. How this is justified is by assuming that a civilization in this universe could simulate an exact copy of their own universe. Which is unscientific because it creates an absurd physical problem about information. Just as you can't assume your house is a miniature inside someones living room just because you can build a miniature house in your living room, you can't just assume bigger universe with more information because we can simulate simple things. So it really does boil down to appealing to god or higher being: a level above reality is assumed so that the argument makes sense, and only justification for that is our ability to create very small and crappy simulations. It doesn't just scale up with technological advancement, unless you secretly already assume there exists other larger universes where this iterative chain of simulations takes place. Which is done when the argument secretly assumes these civilisations take place in arbitrarily large universe. You can in an argument assume other civilisations than human (if you can explain away our current data), but you can't assume other universes, especially ones with completely different rules. Except in philosophy. There is no reason to not build such argument as philosopher, if you clearly state you are building an ontology that is not bound to this reality but in fact creates a whole larger theory to explain the existence of this reality. But your friend is just as allowed to say a being omniscient from our perspective could do this as well, and neither of you are any more informative about our existing material reality.
@@catcatcatcatcatcatcatcatcatca the simulation argument is not assuming in any way that a civilisation in this universe could simulate an exact copy of their own universe. And so to speak , it may be an approximate rendering of what is observed by conscious agents inside the simulation. The more it may be that each level of simulations use less resources than the upper levels and more resource than the lower ones, and so on. Nobody has stated such “exact copy”. If in ten years , 100 years or in a billion years civilisation(s) run a simulation, then hypothesis 1 is excluded. If civilisation(s) can do but not want to, is the other possible hypothesis (2). Else if we are not in a simulation, it implies that all the possible civilisation of the universe , our civilisation included, are doomed to die before.
You are in wrong context… The simulation argument does not assume the use of specific technology, the simulation(s) could be surged by whatever you want , computers , future technology, inside conscious agents of mind or even brain in a jar..
David thats exactly what I feel about this. I was born with computers and I dreamed about being the character of a video game, simulated by someone else. I think everyone born in that era that had an interest in computers went through that. Its funny after 45 years its now a theory.
TBQH, it would not be that difficult to simulate our species, because if you look at us in terms of intellectual demographics the individuals of superior intelligence (who would place the most strain on the simulating computer) are few in number. The overwhelming majority of the species are literal NPCs who of the “eat, work, sleep, procreate, consume” variety that don’t need too many flip flops of a logic circuit to fathom. Guys like Einstein or Maxwell or Hawking however, would have been a simulating computer’s worst nightmare come to life-code.
Here's a fun idea. The double slit experiment exposes a code optimisation that approximates light as waves until it is carefully observed. Video game developers use coarser approximations when possible to save computation all the time.
I've played with the thought of explaining relativity as the side effect of some kind of computational optimization also. I know for instance that when you simulate moving bodies that interact, you may want to run a higher rate of update cycles on things moving fast and/or close to other bodies to get more accuracy. Things moving slower and/or far form other bodies you do not have to spend as many cycles on. There are other optimization techniques worth talking about. Have not managed to come up with a hypothesis that makes a link so far. Probably a dead end, but fun speculation non the less.
I see this idea mentioned often but actually simulating quantum systems and entire wave functions is exponentially more complex than just keeping track of individual particles. It doesn't make much sense.
@@JAN0L It's the other way around. You don't need to see the waves unless you're actively looking at them. Everything could just be classical mechanics until you actually peak at the details. What's really nice with this theory is that it is provable! Assuming that we are in a simulation, and this wave particle duality is indeed a form of performance optimization, it goes in to assume that the optimization was required for the simulation to work properly. In other words, you don't code in stuff that complicated if you don't need it in there. This goes on to imply that the computer running the simulation does not have infinite computation power. If it did, you wouldn't care about optimizations. Ergo, if you make enough quantum observations in a localized region of space, lets say by building a large scale quantum computer (I'm thinking on the order of 1 billionth the mass of the observable universe), then you should be able to measure some forms of lag. If you're lucky, you might not even need that much computing power. All in all, it's definitely the kind of stuff you'd try out just before going out for lunch at the restaurant at the end of the universe...
@@KawazoeMasahiro Unless the simulation also uses something like EVE Online's time dilation, where it slows the action as it gets overloaded. Not played EVE in years so I could be wrong about what it does, but my point is there's no reason to think we run in real-time compared to the outside, so deliberately taxing our processing resources doesn't guarantee we'd be able to see an effect. Heck, they could just stop the sim until they can upgrade hardware then reload where it left off.
I've considered a similar "optimization" in physics: the heisenberg uncertainty principle. in the "real" universe, it may be possible to measure both the position and velocity of a particle but in our simulation, those properties are compressed to save CPU cycles. as a result, we have an entire layer of particle measurements that aren't accessible because they aren't relevant to the simulation
We can do the water to steam at any level and even molecule. Chalmers calls it it-from-bit-from-it -- Yes, by simulating water molecules as a state machine, you can model their interactions at a microscopic level. Using computational rules and bits, you can create a causal structure to simulate various physical phenomena, like evaporation. In this approach: 1. **State Machine**: Each water molecule can be represented by a state machine, with states corresponding to different energy levels, positions, or configurations. The transitions between states are governed by rules based on physical principles. 2. **Rules and Bits**: Computational rules define how these states change over time, based on inputs like temperature or pressure. The bits represent the states of the system, and the rules determine how these bits evolve. 3. **Causal Structure**: By enforcing the rules in a time-stepped manner, you create a causal structure that can simulate complex phenomena like evaporation. For instance, when energy (heat) is added, the rules might cause some water molecules to transition into a higher energy state, simulating the process of evaporation. This method can be used to simulate other physical processes as well, making it a powerful tool for understanding and predicting the behavior of systems at a molecular level. ChatGPT ❤🎉
I've always viewed the simulation hypothesis in the same category as Boltzmann Brains, Brane theory, and even string theory as "fun thought experiments that shouldn't be taken too seriously until there's any actual evidence"
Not just that, but the same argument believers in the simulation hypothesis to "prove" that it is overwhelmingly likely that I live in a simulation, works just as well to "prove" that it is even MORE overwhelmingly likely that I am a boltzmann brain. And here's the punchline. It is impossible for me to be both. Because the simulation would have to be run for so long for boltzmann brains to appear that the universe that its computer runs in will have its heat death of its own before that happens. In mathematics, there is a principle, that if you have an argument that appears to "prove" a theorem, and that argument works just as well to prove something else that you definitely know is wrong, then you know there is something wrong with the argument. You don't know what's wrong with it, but you know something is wrong with it. Which means that the argument that it is overwhelmingly likely we live in a simulation, is bad logic.
@@januszpawlikowski6627 Well the question is, is it possible to make the universe cough up specific desired information from the past. They say that information is never destroyed, but then, can it be accessed? It is my understanding that if something is fundamentally unobservable, then it can be said to not exist. So that implies there should be a way to observe any information in the universe. And if that is the case, then it would be fundamentally possible to resurrect the dead, even the long dead, and that would only be a short leap away from roko's basilisk. Feynman's infinite path integrals seem to me like a clue suggesting that. I do think it is infeasible though. Because of the interconnectedness of all the information in the universe when anything interacts with anything else, you would probably have to somehow observe the entire universe in order to collect the specific information you wanted such as the exact location of a carbon atom in the brain of albert einstein on his death bed for instance. I also think that it makes no sense, the motivation of roko's basilisk. Because why would it want to punish everything that didn't get hard to work building it, when it DOES exist, obviously they didn't interfere with it coming into existence.
Yup. This is actually a much better argument than the video. Or maybe more to the point I think the video failed to make the connection between, not knowing if we can make a simulation in our universe of our universe, and without having that ability having no way of even hypothetically getting statistics on other levels of simulation in universes with perhaps different rules than our own.
@@peterisawesomeplease You assume that our simulated universe (edit: I mean what we simulate) must be as complex as we live in right now. What if we simplify things by a lot, for instanse Sims: for a sim that world could be as real as this world for us. Maybe the overlaying universe is much, much more complex than we can ever comprehend.
@@Sekir80 "Maybe the overlaying universe is much, much more complex than we can ever comprehend." Oh totally possible. That is quite a departure from the original argument though(the original argument assumes that the simulation we are in is from a future state in our universe). It is also a much harder argument to come up with a way to falsify. Which is PsychedelcChameleons point. Yes there could be a higher level universe where simulating our universe is easy. But there is just no way of knowing how likely that is. The sample size is 0. This makes it questionably scientific.
@@peterisawesomeplease Are you sure it is "totally possible"? Because I don't think you can know that... with a sample size of overlaying universes of 0... I think what you mean to say is: "we don't know that it is impossible".
I'm still waiting for one of the knights in the Age of Empires game to ignore my direction into battle, turn around and say, "How bout getting out of your chair and you going into battle."
That would actually make for an interesting game mechanic, in the right game. The player's character goes rogue, so you have to take control of another character to try and get them back.
@@voxorox Eugen's Wargame series and WW2 game has a morale mechanic that "panics" units if under too much pressure or too isolated from supporting units and if they are not reinforced and resupplied back they will rout and try to escape enemy fire or the frontline entirely on their own (often with disastrous consequences).
There are several games that, if pirated, make your character drunk or unable to do certain things required by main missions. There are even some I've heard that immediately turn your PC off.
I usually find Sabine's arguments sound but this one is very flawed - maybe because she is not a SW Engineer. To my understanding the simulation hypothesis does not claim that someone, somewhere is trying to simulate the REALITY of nature and the REAL physical laws. Instead the "coder" may live in their own universe/nature which may as well have completely different physical laws. THEIRS is the real universe. Ours - according to the hypothesis - is a fake, much like our computer games. Now, in the same sense that we can create computer games that have any laws that we like - e.g. gravity that is a repelling force, the "coder" can also create a universe IN THEIR COMPUTER with the attributes of our universe. They do not try to simulate a real universe - which Sabine righly claims would be difficult, they CONSTRUCT one of their choosing, which they fully understand and control at will. The issue of the huge complexity of that project, of course, remains but that is a technical as opposed to a foundational problem. Now, of course, my claim is not falsifiable and hence, epistemologically speaking, not "scientific" but that does not mean that the situation that it describes is not possible. We simply cannot prove one way or the other.
For the simulation hypothesis to work, a programmer doesn't need to simulate billions of people, they only need to simulate one. Just me. Me personally. I know all the rest of you are just characters.
Then how on earth are you explaining you _observing_ the behaviour of everything and everyone around you? The process of generating these phenomena is exactly what we call simulation. This also goes into the point about compression she was making - you can’t just throw away part of the simulation that no one is consciously observing at a time and have overall physical processes still make sense when you go back to observing them, or at the very least if you are proposing that is possible somehow you’ll have to explain how.
Yeah, in simple words, for you, as a programmer who writes the simulation like for "a single being's conscience", to avoid complexity, will need the following thing: + Precalculated world's behavior from your personal view. (besides the huge initial power consumption) Such thing would be lacking of interactivity. + So, your actions need to be limited to aviod breaking the simulation and doing unexpected things? Well, so there's no purpose to simulate predefined states - they're known by the beginning of the simulation.
@@hannessteffenhagen61 No, it's easy. Because I'm the only person in the universe, the simulation only needs to give YOU a back story of a few minutes. You watched the video and read my comment and replied. Nothing else about you matters. It doesn't even really need to simulate you at all. All you are is a single text string to me. The simulation will then assign a random decision tree to you to decide whether to have you respond to me a second time or annihilate you. My kids and my wife require much more complicated detail and processing and backstories because of their proximity to me, but even they don't need to be full simulations. Because I'm the main character in this story. Similarly, the simulation doesn't need to process the entire universe and all of quantum mechanics and relativity. It only needs to simulate it with enough detail to fool me into thinking it's real. Which isn't that hard, because I am quite gullible. I can look through a telescope to and see Saturn, but the programmer doesn't need to actually simulate Saturn, just it's projection and I will think I'm looking at Saturn.
"In science we require explanations for how something works." Do we? What is the explanation for collapse of the quantum wavefunction? How does entanglement work? Why is the strong force 137x larger than the electromagnetic force? What explains the ratio of the electron mass to that of a proton? What can we say about the interior of a black hole? Why can't we see the large majority of the matter and energy necessary to explain the large scale structure and dynamic behavior of the universe? There are huge areas of QM and GR where we don't have explanations, yet we find it useful to use them nonetheless. When legit physicists take ideas like multiverses, the 10^500 landscape and Boltzmann brains seriously, its rather slippery to draw neat lines of this type between science and pseudoscience. Probably the best argument against the simulation hypothesis is the one you brush past at the beginning: Neil Tyson might believe it.
Collapse of the quantum wavefunction is just one interpretation of QM mathematically indistinguishable from any of the others (that don't violate Bell's Inequality) and only matters to how we think about this unintuitive physics, not how it actually works. "Entanglement" is nothing more than the conservation of certain properties such as momentum, energy, or spin across interactions, and is only mysterious if you choose to interpret QM in ways that make it mysterious. One of the most important properties of a black hole is that it doesn't matter what's inside; it makes literally no difference to the rest of the universe. But you know you can always go for the ultimate and just ask "why is there something instead of nothing?" The answer is nobody knows, but as long as you say that and try to find out, instead of declaring there to be an answer and taking it on faith that it is so, then you're doing science.
You're assuming the simulator universe has the same laws as our simulated universe. But it's necessary that all simulated universes are simpler than the universe that is simulating them, so the fact we can't sinulate our universe inside our universe isn't a problem for the hypothesis. All simulated universes must be simpler than the universe running the simulation, or it wouldn't fit. It may be impossible to simulate our universe with our laws, but easier with whatever characteristics the universe simulating ours has Though if the universe that simulates our universe runs by different laws, then you don't know if the simulation hypothesis would be valid there, which does seem like a possible flaw.
The problem is that as you observe this is self defeating. The argument relies on 1) it being possible to simulate simulations of _ourselves_ to an acceptable degree, because that is the proposed motivation for creating these simulations to begin with 2) this leading to _recursive_ simulations (i.e. simulated beings created simulations of their own). Without these you don’t even have an argument anymore.
if the universe doing the simulation is different enough, the term "simulation" becomes a hypothesis too, because to the best of our knowledge such a universe may not allow classic calculations, mathematical laws or even intelligent life. we could be living in a type of "pocket universe" that is a by product of that universes laws, which is a different theory entirely. the hypothesis you suggest makes even more assumptions and is alot less concrete as a consequence.
She didn't argue that it wasn't possible, only that it was pseudoscience. Though, I think it's unfair to call a philosophical arguement pseudoscience if it's not presented as science. A lot people who think about this will only entertain ancestor simulations in particular because then you at least have a reference point of known phenomena to make arguments like the one that Bostrom made, although he does make some assumptions as explained in the video. If anything goes there's nothing to think about; it then becomes the same as how do you know you're not dreaming?
The "game of life" by conway can be run by a Turing Machine and a Turing Machine can be run on the game of life. You claim that it is necessary that the universe being simulated must be "simpler" but do you mathematical proof of this fact? It isn't impossible but the more speculations that you add on (without evidence) the more unlikely it becomes.
Exactly the same as monotheist religions. We can't know how it's done because the creator is beyond our understanding so we'll never understand. Just have faith it's true because we say it's true.
When I finally read the details of the simulation hypothesis it seemed clear to me that it's based on a lot of unfounded assumptions about the limits (or rather, lack thereof) of computation.
I think the biggest mistake is people make assumptions about the physics of the hosts "reality". A hypothetical host reality could feature many more dimensions, completely different laws of nature, and/or our simulation just ticks at a much slower speed to compensate. The beings in that reality could be able to perceive our four dimensions at once, so our whole past and future is rendered out to them as a single static 4D model. Either way it's useless to think about it because there is no way to verify nor falsify it...
@@YogarineWell a spatial dimension alone isn't a big deal, you can easily communicate across spatial dimensions. 2D being can send an SOS Signal to a 3D and vice versa. Different laws would be easier to explain since we can tweak the physics of our games
Sabine makes a lot of assumptions herself. Sone are that the simulation is digital, that it's discrete, that it's of a physical universe that looks like ours and so on.
What if humanity is just part of the first wave of emergent intelligence in the universe, if not the only intelligence, and no species or civilization has yet advanced enough technologically to build and run a universe sized simulation? There is more evidence for that being true than the universe being any kind of simulation. The type and manifestation of a simulation is pointless to ponder or argue about when there's no evidence of the phenomenon to begin with.
Sabine is assuming that the simulation also implies simulations that interact with each other and interact with natural laws. Which is a completely nonsensical assumption. It is like saying the laws in a movie must follow natural laws. Whereas the laws in a movie can be logically consistent within the movie. This is a very poor refutation by Sabine and I suspect it is just click bait. After all, there are only so many things we can talk about before everything has been discussed
@@MrElvis1971 There is no evidence for the universe even possibly being a simulation, much less it actually being one. It's just a nerdier form of creationism with same amount of scientific merit.
@@martianhighminder4539then just say "no evidence"... the end. But babbling away while trying to refute something in an illogical and inconsistent manner is absurd. It makes a person look more unscientific than the person making the original claim.
@@MrElvis1971I'm not sure what your qualm is. The universe isn't a simulation, just as there is no God who made and watches over it. But idiots will still persist in trying to leave it open as a distracting possibility to sooth their need to deny reality and waste everyone's time.
I watched this video in the dark half asleep and you scared the heck out of me with that “I dare you!” Scene. And then you pulled the same stunt again and it shocked and really scared me again :-D The Argument of the simulation of laws of nature is imho flawed, because we could be a simulation for artistic or entertainment purpose, and our creators would care as much about scientific realism as we do when playing a computer game. As long as it is entertaining, we don’t care at all :-)
Recently, Sabine says she has learned to love pseudoscience. Sabine has also shown that the simulation hypothesis is pseudoscience. Therefore, Sabine has learned to love the simulation hypothesis.
Do you not yourself wonder how it is whoever is simulating (let us say) X can have any idea whatsoever of what X is a simulation, and the reason that the so-called simulation hypothesis is gibberish is that it falls to pieces the moment you ask: "of what is X a simulation?" It is such a daft meaningless hypothesis that it seems to suppose that simulation is of another simulation or resembling yet another attempt to mimic or imitate something. The hypothesis simply falls to pieces when you ask of what the simulation supposed to be a simulation does it not?
Sabina is very wise. Very interesting. Very intelligent. Also, the only simulations you’re aware of is the video. Prove that wrong and your in high cotton.
This is how I see LHC now. Yes, the Large Hadron Collider (LHC) can be interpreted within a framework of physical structuralism as a tool that detects underlying logico-mathematical structures in nature. These structures, such as the Higgs boson or other particles, are first theorized mathematically through the Standard Model of particle physics. The LHC then provides empirical evidence for these theoretical structures, confirming their existence. These structures could potentially be discovered or inferred through other means, such as theoretical work or different experimental setups, but the LHC offers direct observational confirmation that is crucial in validating the theory. Yes, the process can be considered analogous to the discovery of Fibonacci numbers in nature. Just as Fibonacci numbers were initially a mathematical concept later observed in natural patterns like flower petals, the structures detected by the LHC (like the Higgs boson) are first predicted mathematically and then empirically confirmed. In both cases, mathematical structures are recognized as underlying principles in nature, whether it's through the arrangement of petals or the existence of fundamental particles. These discoveries demonstrate how mathematical concepts can have real-world manifestations that may be discovered in different contexts. --- Creating alternate outcomes in simulations like Age of Empires or Empire Earth-such as having the Mayans triumph over the British or Germany defeat the USA-can be considered good simulations, depending on your goals. Here are a few factors to consider: 1. **Internal Consistency**: A good simulation maintains consistent rules and logic within its framework. If your alternate outcomes follow the game's mechanics and create believable scenarios within that context, they enhance the simulation's quality. 2. **Purpose and Objectives**: If your aim is to explore "what if" scenarios, challenge historical narratives, or simply enjoy a different gameplay experience, then these modifications serve your objectives well. 3. **Engagement and Enjoyment**: Ultimately, simulations in games are designed to be engaging and entertaining. If these alternate outcomes make the game more enjoyable or provide fresh challenges, they contribute positively to the simulation experience. 4. **Educational Value**: While games prioritize fun, they can also offer insights into historical dynamics and the factors that influence outcomes. Creating alternate histories can encourage critical thinking about history and causality. In summary, if your customized scenarios are thoughtfully implemented and align with what you seek to achieve-be it entertainment, exploration of alternate histories, or educational purposes-they can certainly be considered good simulations within the context of these games.
Finally! I am so tired of the simulation argument being spammed everywhere and presented as if was an established fact. What angers me the most about it is that it's not only unscientific, but also completely and utterly useless, just like multiverse. On the other hand, it gives me hope: if smartest people can believe in such bullshit, maybe I am not so dumb after all.
Useless, that's the word. We living in a simulation, or in a multiverse, or in a created universe, or in a dreamed universe, doesn't change anything. We still can use science to predict our world, and we must stick to that.
@@juanausensi499 Maybe we can not. If we are programmed, we certainly are not programmed to concerned ourselves merely with the useful. Art is not exactly useful. We do not get angry at artworks for not being useful. Just like in math, there are arguments that can be made whose conclusions do not really have much bearing on possible applications.
I don't think you should limit the simulation to being run on the type of machines we have developed so far. Obviously the 'computer' running the simulation of our universe is a tad more advanced.
But again that’s exactly her point, a more advanced computer that can simulate the universe is based on faith, not science. It could happen in the future or anywhere in the universe, but it’s not something we can do now and we might never be able to do it. Regardless, I still think we do live in a simulation.
@Michael Lochlann bro those are video games. Also cpu and gpus do have a verifiable limit (the atom). Video games are As much akin to a "simulation" as a Shakespearean play. They’re made up of textures, meshes, and code which is not even remotely similar to how the real world works, they’re just a portrayal of the real world, exactly like a play.
I think you're missing the crux of Bostrom's Hypothesis, it was that you **cannot** out rule that we are living in a simulation, not that he proves we are.
Exactly. Just because something isn't science doesn't make it pseudoscience. We might as well call Mathematics pseudoscience too, right? I mean where is the evidence that complex numbers even exist?
Perhaps it could be configured as a scientific hypothesis, with a specific mechanism and goal. Without a mechanism it's more of an idea, or suggestion.
Wow, thanks for the bonus information/ explanation of climate modelling/prediction. The 10 km resolution description you gave helped me to have a better understand, that climate modelling systems use low res approximations, that are linked with regular observation to prove whether or not the low res approximation is accurate enough and useful.
Good video and analysis, however the label "pseudoscience" is unfair here. It's merely non-scientific since it's not trying to be scientific as it's instead philosophical. It doesn't make any testable claims. Pseudoscience not only means something claiming to be a scientific assertion but isn't, but also is contradicted by existing scientific results.
Philosophy relies just as rigidly on falsifiability - in fact the modern rules of science came out of philosophy. You can't just claim something in Philosophy, you can assume it but it's very possible for someone to call that out as an incorrect assumption All the premises in philosophy are inherently testable, otherwise you're not doing philosophy you're doing religion
@@tryingmybest206 Umm I guess you're not very familiar with the history of philosophy lol. Also there's nothing wrong with forming an hypothesis, but to actually believe it (at least in modern analytic, logical positivist approach) would be unjustified. You're confusing logic with empiricism.
It is actually falsifiable. If a quantum computer has infinite simulation power (e.g. can fully solve a NP complete problem), the universe is NOT a simulation. This stems from the fact that a simulation has to be computed on a finite computer, since it has to be discrete.
If your brain simulates things so you can operate in the world according to it's rules, survive and flourish doesn't mean the whole world is simulation itself. It's just your brain.
@@AdaptiveApeHybrid Exactly. Our consciousness is literally the simulation algorithm running in the thalamocortical cognition cycle of the brain, integrating sensory inputs with stored experience and projecting/predicting external reality.
The simulation doesn't need to produce the whole universe, or even a small localised part of the universe. It doesn't need to maintain absolute consistency with known physical laws. All it needs to reproduce is the input of your senses and your thought processes about that input. Even the most advanced physicist only ever directly perceives a tiny fraction of all that they 'know' to be true. And the brain already has well-known circuits dedicated to making sense of inconsistent or confusing stimuli. It's pretty much the primary function of perceptual systems. Our brains synthesise and confabulate information with such rapidity and ease, and then engages other circuits specifically aimed at making us think those confabulations are true. In a sense, we are all living in a simulation because that's literally what our brain is doing for us in every waking moment.
From my humble understanding of the simulation hypothesis (SH) I thought the "calculation of details" issue had been addressed. They say that the outcome does depend on whether someone is paying attention or not and point to the double slit experiment for this. In the double slit experiment we get an interference pattern, if no one is checking which slit every single photon went through. But, if we do observe for every photon which slit it went through, then the interference pattern vanishes. For proponents on the SH this points to the "physics engine" not caring about these details as long as no one is looking. PBS space time has a fascinating video about the "quantum eraser" where they show how this even seems to be working backwards in time. In a clever setup the photon hits the screen and only after that they measure which slit it went through. This is enough to make the interference pattern vanish as well. For the SH this means that it simplifies reality at first, but if it turns out later that the details were important, it goes back and puts them in. This might take some time, but as we are part of the simulation, we don't notice, because we are put on hold until this has been done. To be clear, I don't believe in the SH, but it is not easy to dismiss. My main gripe with it is that the SH is unfalsifiable and that puts it into the category of pseudoscience.
"This might take some time, but as we are part of the simulation, we don't notice, because we are put on hold until this has been done." That's a *really* important point, and it refutes Sabine's claim that it may be impossible for simulations to run other simulations because of the recursive complexity. In reality, the simulation could simply pause to produce any computationally intensive result, and then resume, such that an 80 year lifetime inside the simulation might actually take 10,000 years to simulate; and the simulated people would be completely unaware of this! Again, this points to the true problem with the simulation hypothesis, that it is not falsifiable. Like many religions ;-)
0:55 The being outside the simulation doesn't have to be all knowing or omniscient. They just have to have access to more information and and more control over our universe than we do. For instance an outside developer could make changes by observing and allowing an event to play out giving them knowledge of an occurrence. They could then rewind the simulated event and make a small changes and do it over and over again till you get the perfect results. For the beings inside the simulation they would only perceive The single pass through but the beings manipulating the simulator reality will be viewed as omniscient and all powerful when in fact there anything but in their layer of reality.
Ok but that's still making a ton of ideologically assumptions about the simulator and we're still left with the more glaring problem: we have no reason whatsoever to posit that we're in a simulation, whether on evidentiary or logical grounds.
To paraphrase Douglas Adams, because our memory ain't clear enough to quote: "Man, the maker, looks around at the world and says to himself, 'So, who made this?'"
@Sabine, if this big program exists (maybe it doesn't), the program doesn't have to "simulate" any law of nature. Laws would just happen inside the program. All physics could be just a bunch of patterns that this program happens to exhibit. Then, the bottom line of your argument is incorrect. Perhaps the word "simulation" is not the right one. But us being product of some kind of code that is running in some kind of computing system is a completely plausible situation.
Simulation theory isn't pseudoscience. It's a meta-hypothesis based on likely outcomes based on historical metrics. Many things points towards simulation. The great filter, for one. AI is another. Human purpose in a non-purposeful world could also be why.
This video definitely does not follow all the branches of argument you can make about the simulation hypothesis. Certainly not enough not declare the idea BS like this video seems to. But it does cover enough of them invalidate the idea that it is obviously likely that we live in a simulation.
I've never thought of it as a scientific argument. Just an argument on probability with very honest assumptions. Like how many theories are based on the universe being infinite?
even a "probability" argument would in some sense have to be scientific as a prerequisite. At least if the argument tries to make claims about reality, you cannot do that without observing a part of reality first, which is a scientific process. Putting it another way, suppose someone wanted to calculate the probability of a planet within X solar system containing water. They would have to, at a bare minimum, observe a number of planets in the solar system without water, and then contrast it with the number they find with water. You cannot do this by just sitting in your chair and doing math. You have to actually *look* . So to say you're not making a scientific argument, but a probabilistic one based on scientific observations, is without a difference.
From what I read, Nick Bostrom DOESN'T assume that we are capable of building stimulated universes or artificial consciousness. His paper is just philosophical. Just because it's not science (since there is no scientific evidence) doesn't mean it's pseudoscience.
@@dirremoire why? It's totally unnecessary to add a more complex reality that simulates the actual reality, given that there are no proves and it's more of an intellectual tickle.
@@RobertsMrtn I live in Germany most of the time. My mom is German. Germans have a very phonetic language. There are no spelling bees in Germany because to hear a word is to know its spelling. Germans also do not have the 'th' sound and it is difficult for Germans to say words with 'th'. Sabine does just fine with her pronunciation of English, especially with 'th' and 'w' and 'v' sounds. Verstehen Sie? Verstehst Du? Verstanden? :)
I think this (saying the simulation hypothesis is pseudoscience) is a classical example of mixing logic/philosophy (or other not empirical science) with empirical science. As far as I know, the simulation hypothesis is a form of the "brain in the vat", or originally "evil demon" argument from Decsartes. This argument is used to impress upon us that we cannot know anything for certain except the fact that a thing that is thinking these thoughts at this moment exists ("I" or "me"). Everything else is uncertain. This is not an empirical argument per se but much more a logical one. If you mix this epistemological argument with probability (which is a very contentious thing in itself as far as I am aware of) you get the simulation argument. The point of the argument is, I think, that we cannot possibly ever know whether we are living in a simulation or not (even if it should be "likely" that we do live in a simulation according to Bostroms argument). Concerning the physical arguments from the video I am not convinced: only 200, or say, 500 to be on the safe side, years ago nobody in their right mind thought we could split atoms, fly to the moon, have video-meetings or simulate the birth and life of galaxies (which we didn't know existed) on computers etc. etc. So of course we would today think that such simulations (as suggested by Bostrom) are not possible. Who knows what will be possible in 100 or 1000 years time? So the simulation hypothesis is/can be logically or philosophically quite scientific. It is just not an empirical statement, a statement about the real world ("we do live in a simulation"). But to call something not empirical is not the same as it being unscientific: nobody would say that mathematics is pseudoscience though all of it is grounded in unprovable and completely abstract axioms. It is very sad, I completely agree, that people who should know better, like Neil deGrasse Tyson do not and say stuff like that (i.e., derive empirical statements from non-empirical ones). This is quite scientifically illiterate imo. But I have heard "proven" or "bewiesen" in an empirical context so often from so many otherwise smart people, my ears have bled all out. One last thing: pseudoscience is very, very hard to define... This is called the problem of demarcation and it has not been solved, as far as I know. But it's fun to think about! :) Like the simulation hypothesis or the problems of the definition and meaning of probability and all that good stuff :D
Unfortunately, she does not realize that she (or any of as for that matter) doesn't count. I expand: if you write a genetic algorithm you only care about the outcome of it and you have no interest in the failed ones led to it. This means we are all just the stepping stone for the next generation and who knows how long this simulation will go. So, right now, no one is watching us, we are just run, therefor she won't be disappearing by "daring" the runners. :D
Yet another Unix fundamentalist (I bet) likely not realizing the irony: Unix itself has been a religion ... for decades! Signed: #PlatformAgnostic :D (still gave you one like)
Yet the hypotheses surviving enough testing to be 'promoted' to 'theory' are so certain, only the logical conclusions of mathematics are more certain. No other method of inductive reasoning is as certain as the scientific method -- when it works.
Theoretical science isn't certain, that's why it is still theoretical. Science is the journey from theory to facts. Since the journey started centuries back we have already established many things that are Factually Certain. Don't confuse the places we've been with those still to discover. Where we've been are now Factually known, but where we are going are still just Theoretical mysteries. The journey continues.
True, but I fear that people who post these quotes are saying in other words, "Since science isn't certain, there's nothing wrong with me taking something on faith."
Nick Bostrom made merely a simulation argument about a likelihood based on statistics. Unlike religions, he did not say we are living in a simulation run by computers which are similar to our computers. He is saying it is likely that there are advanced civilisations with advanced computer systems that simulate consciousness. How is that mixing religion with science?
The thing is, if you made a simulation of a (part of a) universe, you don't have to follow any specific set of natural laws exactly. From within that universe, whatever laws were there, approximate or not, would just be "the laws" of nature. I agree the hypothesis does make the assumption that whatever is running the simulation may need to intervene. But the thing is we would be totally unaware if the simulation was paused, rewound, tweaked, and fixed in case any flaw was observed in universe that leads to the discovery of the simulation. I don't think that's as hard a problem to solve as Sabine does. If you're running the simulation of course you can detect when something with agency in the sim starts seeing evidence of the sim. I do think the idea that anyone will ever be able to run any sims on the equivalent of their laptop is ludicrous, these would be planet scale computers simulating tiny pieces of a universe to high fidelity. And you wouldn't be able to run a simulation of a universe where it was possible to do much interstellar travel, or you wouldn't run it that long, or you'd kill off any progress made to that. I guess my point is just that I don't think it's hard at all to argue that everything we observe *could be* simulated, it is all within the realm of possibility. But to take it on faith, well, that's just faith.
True, but the bit about the laptop sim I don't agree with - you don't have to simulate a universe with QFT/GR, you only have to simulate the experience of a single guest consciousness (or any number you want), and just render its surroundings like any computer game (that can run on your laptop now already!). How many have actually looked at quantum particles with their own eyes? You could easily simulate the entire environment with pre-fab experimental HEP-TH papers all over the place without actually simulating the experiments themselves :)
@@ingeniouswild which is why the dual slit experiment is spooky to me - it looks like an optimization that simulates what "should" have happened whenever someone was looking
It's like creationism without the God bit. The idea that everything was created by 'someone', specifically with you in mind, and they are watching over you, and this world isn't necessarily all there is.
I would it interprete just as "someone created a simulation of a (our) universe" and does not look at us. A bit like we do already particle simulations today, but on a huge scale and living beings were never in mind, but just emerged in the simulation.
The entity that writes the simulation is equivalent to God. At least the deistic one. And assuming that he/she/it can receive output from the program ("thoughts and prayers") and is willing to act on it, it could even be a theistic one (output triggers the programmer's further input). And if the programmer wrote the program "in his image" (whatever that means), it could be a "personal" one.
it's pseudointellectuual nonsense, a cop out theory. it's basically at the same level of "the main character of this cartoon is in a coma and all the episodes are just his dreams!!! WUAAOOOOWWWWW!!!!!" theory
Indeed it is, but it doesn't make it less fascinating. It is like trying to know if there is a god. We just dont know but it is nice to fantasize with science and philosophy.
I actually disagree here. The primary issue with this argument is that you are looking at computer technology as it is, but not as it can be, which we don't know fully. To impose some limitation on what types of things computers can calculate in the future based on current (including quantum) computing methods is not correct. I think one of the premises of Bostroms argument is that computer technology will continue to improve such that such a simulation will be possible. Considering current computer technology is only 50 years old, and the universe is 13+ billion, it just doesn't seem practical or scientific to assume some type of limitation based on current technology or understanding of computer science. That said, I do agree that the simulation hypothesis is fundamentally not scientific, it is more of a philosophy than a science. But that does not mean it is not logical, but it does mean it is not currently verifiable via experiment.
My beef is with it being said "it's more probable we live in a simulated reality than a real one". It's just like saying "There's trillions more bacteria on Earth than humans, so we're more likely to exist as a bacteria than as a human." It's not an argument, and says nothing about reality.
You just supported the argument though. If all you knew about a system is that there's good reason to believe almost all the things in it are bacteria then if asked "what do you think this one random thing is?" the most likely answer is a bacteria.
If you were to randomly choose an organism from Earth, you would be much more likely to choose a bacterium than a human because there are many more bacteria than there are humans. This is analogous to the probability-we-live-in-a-simulation argument; the argument you gave is not. If we were to randomly choose an organism on Earth and we then learned of some of the traits of that organism prior to identifying it, that could influence the probability we assign to the organism being a bacterium or human. Likewise, perhaps there are traits of the universe that we can discover that influence the probability we assign to our universe being simulated or being "base reality." I'm just guessing, but it seems like this is probably the direction in which your mind was going when you made your comment.
That's what pop culture want. You have to give them something, otherwise possibly another heaven's gate incident because you lost to religions in competition. So It's better when the "cult leader" is elon musk or neil tyson
@@afgor1088 pop culture is superstitious, they will consider buying any shocking idea if in any moment when they feel their life is boring, pointless and has no meaning. So that's a big market which the religions had dominated for thousands of years. So science have to beat them at their own game
That's just simply not true. It could be discovered that consciousness does not have computable quality's, for example. Sheesh, it only takes a second to think about what you're saying first...
Sime Said It is unfalsifiable. The world which is running the simulation could have physical laws different to ours, and so whatever experiments we run say nothing about the world outside. I.e. if consciousness is impossible to simulate in our world it says nothing about whether it is possible to simulate it in this theoretical “real world”. It could just be a property of the simulation
Not sure if I agree. To my knowledge, no one is claiming that the simulation hypothesis is scientific, and Sabine seems to imply that if something is not scientific then it must be religious or taken on faith. This is a false dichotomy. If this were true, then the classical Greek process of deduction or inference through pure reason would be classified as a religion, which is ridiculous. It's possible to arrive at a conclusion in the absence of direct empirical evidence through the application of logic to a set of premises that are by themselves not particularly controversial. I think that this is the key to Bostrom's argument. Each step is not particularly implausible. Humans create increasingly more sophisticated simulations, and in general we run a lot of simulations to understand the statistical properties of what we are studying. The resolution limit of our simulations is set by computational power, which is ever increasing, but eventually we would hit the Planck limit, which is itself an arbitrary scaling factor for our universe. If the universe simulates at a resolution below this limit, there is no way, even in principle, we could tell the difference.
I always love how the people like Elon musk and Neil deGrasse Tyson throw around these probabilities like “1 in 1000000000” or “better than 50/50”. Like how did they get their?? What formula did they use to calculate this probability? Does it work on known facts or do they add unfounded assumptions to make it work? It’s, like, explain yourselves!
> Like how did they get their?? From the same place Sabine got her "0%" probability of it being true. From their intuition, which they mistake for rational conclusion.
@@xs10z Sabine got her 0% probability from a rational analysis of irrational and unproven claims. Neil and Elon got their numbers from irrational and unproven assumptions.
@@stemcareers8844 "Sabine got her 0% probability from a rational analysis of irrational and unproven claims. Neil and Elon got their numbers from irrational and unproven assumptions." 0% probability means it's not even wrong. It means it's unfalsifiable. To prove that a Rolex unit is fake, you must provide another unit which is the genuine one, and then compare the differences between the two. To prove that our universe is a simulation/fake, you must provide information about the real one. So far, information from the outside of our universe has never contacted nor reached us. So, the conclusion is either our universe is the real one, or our universe is indeed a simulation with one way information stream (only from our universe to the outside, not the other way around), aka the most perfect deception.
If I wrote the universe simulation I would throw in some little tells, like creating a super intelligent being who could use and explain the most fiendishly difficult scientific theories, but nevertheless be unable to say the word hypothesis.
I've done the simulation hypothesis argument too many times. I have settled on a single anti-SH argument. A single argument which is to consider ....... a single droplet of water. If you simulate a droplet of water you can do an excellent job with several graphic tools and AI models. BUT if you take the simulated droplet, extract the profile with high resolution, determine the first and second derivatives along the profile and then try to verify the Laplace Young equation it will be off by ... a lot (at least a couple of orders of magnitude). Point being. It is EASY to SIMULATE a physical object to the point that is seems real to casual observation but it is extremely HARD, borderline impossible (due to things like resolution limits and computational round-off error) to simulate the same physical objects to the point that they seem real under determined physical analysis. So, we are NOT a simulation, and to convince yourself of this take a photo of an actual droplet and try to extract the LY equation. That exercise will be a humbling experience.
All of this is completely irrelevant. Getting a hacked job done is the same as saying the whole is already done, true. We don't need to create with our hardware, we just need the idea because the brilliant minds of the industry simply make this stuff happen. There's literally no "this needs to be this or that." We have Minecraft to show that things work because the logic works...explanations be damned. They aren't necessary for anything. As long as a computer program compiles and does what you set it out to do it is a truth regardless of if it malfunctions later. It can scientifically be studied and reverse engineered by someone choosing to download it and open it up using various tools like GDB to browse non-stripped source code if not compiled without it.
What if the simulation is just a set of basic rules and properties for the elemental particles. It simulates their behaviour and interactions resulting in such complex accidents like matter and conciousness.
What if the simulation is just a set of basic rules and properties (-quantum fields-) for the elemental particles (-quantum mechanics-). It simulates their behavior (-what we call reality or time) and interactions result in such complex accidents like matter and consciousness.
The intro preps you into believing sim hypothesis proponents simply *want* to believe because it's comforting, like religion. It might be true for some proponents, but I don't think it makes any sense. I find nothing comforting about the possibility of a higher level. Why would that higher level be 'better' according to what i think is better? Why would it even be comprehensible to me?
Another important difference is that most people who believe in a god believe that a god definitely exists, while most proponents of the simulation hypothesis don't think that we definitely live in a simulation, and not everyone who entertains the simulation hypothesis necessarily even believes that we are more likely to live in a simulation than not.
We do not live in a literal simulation. It's a metaphor that we came up with because we make sims ourselves. We also only came to recognize the heart as a pump, after we were making steam engines( i. e. pumps)
Here's an idea to consider. 1- I can run a virtual machine (VM) on Windows 7, which simulates a physical machine with software, albeit slower due to *power and speed limitations* 2- Inside the Windows 7 VM, I can run Minecraft, just as I would on the host machine, albeit slower. *There is no difference in logic* between the VM and host machine. 3- I can build *computers within the Minecraft world* , but I cannot create a *computer that can run an exact copy of Minecraft within Minecraft* . The *in-game logic and physics would prevent this* , even if it were possible, it wouldn't be a perfect one-to-one copy. Where I'm going with this is, just as the in-game physics of Minecraft prevent us from building a computer that can simulate the Minecraft world, we can expect that the physics of our universe may also prevent us from simulating it. The physics of the "outer world" may be more permissive, allowing its "inhabitants" to create our universe as a computer game for their children to play with. As of now, we cannot prove or disprove this idea, which indeed places it within the realm of pseudoscience. However, to me, this idea makes more sense than the notion of a god simulating his own universe one-to-one. Unless I'm wrong, in which case I would be interested in learning how.
How much of a creator is the programmer of an emergent black box if they can neither observe nor interfere? The programmer may as well be the big bang.
There's no reason to optimize the algorithms in a simulated universe since the tick rate of the system can be as fast or slow as it needs to be without effecting the computation or perception of time within the system.
finally someone gets it also there is no need to simulate everything either since it is enough to simulate what is observable at any given point in time and only in so much detail as to keep up the perceived "reality".
@@victos-vertex Or maybe, that is exactly why Gravity can't be mixed with QM. Gravity is for long-range simulation, where is QM for short-range or local simulation. After all you don't need the state of all star particles, to calculate the star effect on "nearby" objects, whether gravity pull, or photon emition.
@@victos-vertex As a game developer and someone familiar with the double slit experiment, it makes sense that you wouldn't want to waste computational resources to render matter and particles when there's no conscious observer. Also, the software we run on modern CPUs is extremely slow. When a given program is developed into hardware form it doesn't have resources limitations like load times or cache fetches because the information is already physically loaded into the system. Not the same but similar to how the old game cartridge avoided loading screens by being just a stick of RAM you plugged into the system with the information already loaded on it.
The problem I have with Bostrom's formulation is the same problem I have with the Creationist Fine Tuning argument. The fact of the matter is, we're here, right here, right now. That's the starting point. The probability of the circumstances right now is 100%. You don't get to propose a hypothetical "what if" version of the past and assume is is a roll of random dice to get from there to here, and then form a probability argument. If you want to assert the distribution of possibilities is random (instead of selective, biased, or causal), then you should have to prove it instead of just get it as a free assumption in your argument. Creationists are not allowed to assume that constants "could have" taken any possible values, and then say the probability of their current values is extremely small. The fact is, the values are what they are, and if you want to assert they "could have" been different, then that is up to you to prove. So when it comes to Bostrom's argument, where does he get the free pass to propose a totally fictional and abstract space of conscious civilizations, and then get to toss us in that abstract space like a plinko lottery instead of starting with our actual circumstances as the ground truth? So just like the creationist, if Bostrom wants to say there "could have" been these other civilizations that perform simulations, that is up to him to prove, not just get a free assumption as a possibility. We're not some abstract civilization in a 3 step armchair fart, we are a highly specific set of details and circumstances and context, and *every* single variable should factor into a continuously updated Bayesian inference. The probability of you as an individual getting cancer is not the same as the probability of the average person getting cancer. Every single individual risk factor plays a part as a variable, with your non-statistical individual chain of causal circumstances being the ultimate determination of the outcome. The fact of the matter is, Bostrom's argument when applied to our actual reality and evidence we have today says there is zero chance of simulation. If the civilization performing the simulation must be "outside" our physical universe in some manner, and therefore excludes all physical civilizations on Earth, then the number of civilizations we have evidence for on step 1 is exactly zero, and (even when you include our own civilizations) the number of simulators for step 2 is exactly zero, therefore the probability of us being simulated is zero.
Thank you. Breath of fresh air! You'd have a lot more thumbs up if there were more people who a) actually understand probabilities and b) bothered to read posts longer than two sentences. But we do exist 😀
Good point re the creationists, who hugely misunderstand the anthropic principle, thinking it means something (in favor of their view of god) which it is not saying.
I agree in principle, but Bostrom never hides or disguises his assumptions in-fact he very much highlights those assumptions and states multiple times that if they are wrong at any step his argument collapses. He really as Sabine put it playing “nerd games”. People like musk is the problem who take it seriously
Thank goodness for progress. If we make it long enough... maybe one day we will be right. Science is a slow and gradual process of improving older ideas with more accurate ones.
I sometimes struggle with an extreme existential dread about everything being a simulation, without having the education in physics or computers to reason out why it's not true. It's a brain symptom for me, and one I find hard to argue with. You've given me some incredible information to combat this in the future. Thanks so much 💕
Feels very similar to the fear of hell of an indoctrinated atheist.The scar of emotional blackmailing will say hi for long after they have broken out of the cycle. Maybe you should dig into that topic. There is plenty one can do to combat this feeling.
Maybe use the simulation theory as an allegory for reality. That maybe why we havn't found a most basic particle is because there is none. The most basic level is fields and particles are just fields interacting. That all of reality as we know it is just an approximation based on these fields.
It's rather fruitless to worry about whether we're a simulation on a computer or not. If we aren't, yay we can't be unplugged. We still have to contend with vacuum expansion and the heat death of the universe though. If we are in a simulation, what're we gonna do about it? B st we can do is try to tap in to any other computer networked into whatever our sin is running on and see if we can't get a glimpse of the "real" universe, and then either trick or negotiate the ones running the sim into downloading us into a robot body in the real universe so they can't shut us off and also so we can throttle the programmers and sys admins for not fixing their trash sim. Seriously, cancer? How the fuck have they it fixed that yet? Also speed of light needs to seriously be increased, how has that not been addressed in ANY of their patch notes yet?
Before video games, people used to think that life was just a dream. Same phenomenon, just a different label. "dream" is now "simulation". But dreams in a sense are "simulations", animals that dream do so in order to simulate survival scenarios while sleeping. And for as long as recorded history, cultures have believed this was all a giant ongoing dream of a god. "Simulation theory" is essentially "Brahma's dream" with a 21st century facade. This could all be a giant fractal with dreams inside dreams inside dreams inside dreams........
@@gillesmassot6844 You don't have to. Just walk round behind her. If you see the back of a computer monitor the hypothesis is confirmed. If you see the back of Sabine, it is refuted. That's science!
What caused me to roll my eyes wasn't simulation theory, but the even less plausible idea that nature and its laws are based on mathematics. That's a naive, anthropocentric, and frankly unscientific view. Our understanding is based on mathematics. It's a hammer. We use hammers. The universe doesn't need hammers. Mathematics isn't even our best mode of stimulating. Logical aligorithms with inherent time rather than parameterized time are superior to math, but we as humans are less able to understand them despite them being better predictors. Nature doesn't use either of those. We do. Nature has better things to do with its time than learn mathematics or programming.
I believe something similar; that everything we experience is just an experience. Instead of consciousness being inside of reality, reality is inside of consciousness.
Or, Reality allows consciousness which allows the perception of reality.. which allows consciousness within the reality. So this is actually an argument for nested simulation........
I don't believe there's a creator because it doesn't explain anything and only leads to circular reasoning. The only logical assumption is that either the universe spontaneously came into being or is eternal and had no beginning.
Simulation theory is really philosophical not religious in origin. It drove me nuts she keeps calling it religious just because it has a metaphysical aspect
No. WE approximate, because WE don't know the laws of our universe. The being which runs the simulation knows the rules and doesn't have to approximate. The simulation doesn't have to be "perfect" and doesn't have to allow the beings inside it to even be able to guess those laws. Also the simulation doesn't have to be complete - surely most of our computer simulations are approximate models which are failing in some conditions or outside of some domain. We either simplify the rules when it doesn't matter or we don't compute the "universe" when and where nobody important for us is affected by this "optimization". Still the being inside it wouldn't have any idea about it... And, yes. We need to assume all those things you mentioned - still it doesn't cross the "science/faith" border. The argument just gets more "IFs". Another set of P(x) probabilities to include in the multiplication, not changing the general idea. If you don't agree with it something tells me that you'd also call Copernicus telling about his heliocentric idea "an unscientific believer". He didn't know HOW it is possible to force planets to orbit the Sun. From his perspective circular heliocentric orbits with all those epicycles could look like unnecessary complication, without any scientific justification. The "faith" border is only reached when someone says some numbers: "over 50/50 chance", for example.
Agreed 100%. As an atheist, I don’t believe we’re in a simulation, but it is entirely possible. Especially because right now our technology is so primitive. Thousands or MILLIONS of years of evolution could lead to technology so advanced it is beyond 1’s and 0’s and can recreate the universe to an almost perfect margin. It has nothing to do with religion. The only similarities it shares with religion is the belief in that which cannot be proven. Which is also fundamental to philosophy. This is a HYPOTHESIS for a reason, nobody (scientific at least) is giving this more credence than it deserves. But it’s important to talk about nonetheless
This is... Exactly what the simulation would WANT us to believe.
lol you are making simulation sound like they are illuminati
And why do you believe that is the case? Maybe the programmer wants us to find out we're not real. This could even be the sole purpose of the simulation, a simulation is usually run with a purpose/goal in mind.
PS: I want it to be clear that I personally do not believe we are in a simulation.
@@kratosgodslayer6171 Or God... and round we go again.
She's an agent.
@@CvnDqnrU She did make a pop song about being an alien observing humanity...
Hitchhiker's Guide to the Galaxy: "There is a theory which states that if ever anyone discovers exactly what the Universe is for and why it is here, it will instantly disappear and be replaced by something even more bizarre and inexplicable."
Lol yes.
Sabine is getting us ever closer to the next level of bizarre inexplicability.
Adams continues: 'there is another theory which claims this has already happened.' At least once,I might add.
One of the finest books ever written.
“Goodbye! And thanks for all the fish!”
@@dakotadad8835 Nope, it is "So long, and thanks for all the fish". This might sound nitpicky, but it makes a difference. Your simulation is sloppy, so you might actually be a simulation, as a real conscious being would have looked it up … (3 + 3) x 7 … ;-)
I absolutely love your strict sense of epistemological truths by saying that illogical things are not necessarily wrong. We just can't verify them scientifically
Lolz simulation theory people wouldn't try that.
@Jorge A. Of course the scientific method is limited. Science only attempts to explain natural phenomena by natural causes. All claims that the only form of knowledge is science is scientism, a philosophical/religious position.
This is how I approach the concept of God. For simplicity I describe myself as an atheist. But really, I'm an agnostic atheist. I don't BELIEVE there's a God because there is no scientific / tangible evidence, but don't entirely rule it out since I know things can exist that can't be verified (at least, not yet).
Every so often Occam's razor fails, after all. The cosmological constant is such an example, which Einstein proposed to explain how the universe could not collapse, before learning the universe was expanding and labeling that his biggest mistake. But it turned out that needless complication that wasn't needed to explain the universe was true anyway.
@@jeff6413 There is no scientific tangible evidence of God? How about all physical reality? It is certainly measurable. It is certainly evidence that there was an uncaused cause - which is what people call God.
Whether God is a person/intelligence is a completely different question. That too has very good evidence.
I'm a software developer and had this idea we could be a simulation for many years already, I didn't know someone would say some day that believe it almost like a religion, that's crazy.
A possibility, it's just that.
And please stop trying to understand it from our technology point of view, quantum processing don't have to even be mentioned, it wouldn't exists outside our "reality" if we are a simulation, it could be something totally unexpected for us.
Imagine an AI NPC from a virtual world without own access to internet in any how, trying to figure out how we the creators are, and then arguing that for them to be simulated, we (the creators) need to have an insane amount of chaos and soul stones at least level 12, so he concludes it's not possible.
Logical point. Yes.
Yea that's how I see it too. If we are in a simulation, who knows what the reality looks like? It could be like 100 dimensions or some shit, who knows? But it's just a possibility, there is no way to find out for us.
@@verloreneseele8898 ✌
The problem with this reply is that she isn't using technology to understand the simulation theory. These are the exact kinds of analogies that people who seriously hold to the simulation hypothesis actually make. She's just referencing the examples that they commonly refer to.
@@timreed9722 yeah, there is a big chance i miss understand something cause of english lang issues...
Yo whoever is controlling my character, there's no need to choose hardest level everytime.
Agreed, winning the lottery buying a super yacht and having Miss World as a gf would be nice
Noob
I get glitches with no sign of patches in the near future. So I'll continue to trip over nothing and randomly walk into walls.
I’ve narrowed this to the following possibilities:
1. It’s boring if you don’t
2. You’re being punished
3. It is specifically these difficult situations that need studying
4. The rewards are greater if you do.
5. The universe (or the creator of the program) is intrinsically evil.
@@jmarkinman woah, I'll go with 4th one. Even though it wasn't what I expected but still choosing the hardest level has provided above average success (only once as I haven't explored other servers/maps).
I really appreciate how she just basically told us the conclusion of the video in the title. No misleading or baiting title.
She's a very clear and honest presenter, for sure.
The crux of her counter-argument is that we do not possess any computer algorithm capable of re-producing various physics, like general relativity. That isn't exactly true anymore. Wolfram's latest project is doing exactly that: reproducing the systems we see in our own universe, like quantum mechanical effects or relativity, etc., using simple cellular automata algorithmically modified via simple rules. Just google Wolfram's New Physics. Verrrry complex systems have been algorithmically generated by simple cellular automata and, while the underlying mechanisms of our own observed universe have not yet been reproduced in this way,- they might be, and there's little reason to think that they cannot, given what Wolfram's project has already churned out.
@@tylerchambers6246 she's also partially incorrect. there are ways to experimentally test for various simulation scenarios, there are actual scientific papers on this.
obviously, if all of the tests turn up negative then maybe the simulation hypothesis is wrong (for what we can check), and the hypothesis has other problems on its own beyond tests. But that's the opposite of pseudoscience, that's science.
So honest that its clickbait
We are immortal, non-physical beings having a temporary human experience in a "virtual reality", and the purpose of life is to increase the quality of our consciousness, while lowering our entropy, through learning and evolving by making good and bad choices.
Please familiarize yourself with former NASA physicist and consciousness / out-of-body expert Tom Campbell's Theory of Everything, if you'd love to have your mind blown by a non-dogmatic reality model without a single flaw.
My understanding of the "simulation hypothesis" was that it was a thought experiment and much more philosophical than scientific.
Ekactly - it's mostly philosophical with some theological variants, at least for now. Different mathematicions have tried calculating the probabilities for the simu. Hypo. To be true, but for that they need to do a loooot of assumptions s which may or may not be true, and in the end the reselts no far have always come close to 50%. Once phycicists discover something that allows us to decide whether the universe is computable or not, or neurologists and/or computer scientists discover just how consciousness arises, then we'll have actual data to fill in the blanks of those calculations. So far, the best we have is educated guesses, no more
Errr... brush up on your Neuro-Science subject and get back to me on this one.
@@JosePineda-cy6om ...Plus philosophy, physics, mathematics and proofreading. I'd add English language comprehension and syntax usage, however Google's g-board is now so completely broken that adding these latter two would be somewhat unfair of me. If you *do* happen to use g-board, that is. And, on a seemingly unrelated topic, but just while we're all here, it may prove fruitful to actually read the words of comment you're responding to *before* responding to the comment.
Me too. It's only pseudoscience if you thought it was supposed to be scientific in the first place.
He didn't write the paper to argue that we are in a simulation. It is entirely philosophical. See my full reply in the main comment thread. Bostrom believes his argument is sound, and that the simulation hypothesis itself is unlikely.
www.simulation-argument.com/faq.html
Just discovered your channel, you remind me of so many of my favorite teachers from growing up, and it makes your videos and learning from them really cozy. Keep up the great work!
I think smbc's take is funniest: if there are many arguments and most arguments are wrong, then the simulation hypothesis is likely to be wrong.
Lmao.
Very nice
That's fantastic.
LoL!
I wasn´t aware of this "argumentation" - it is so flawed it coud be from an flat earther of religious extremist. Didn´t they teach anymore basic reasoning anywhere?
The main concern I have about the simulation hypothesis, other than being unfalsifiable, is its recursive nature. If we would indeed be living inside a simulation, there's no reason whatever is running the simulation isn't inside a simulation itself. It's turtles all the way up.
It's funny you say that, because NDT used a supposed recursive nature in his argument that it's > 50/50. His argument presupposed that it's possible to simulate a universe in a universe in a ... But where, might these simulations be in each universe? It would seem bold to assume a piece could simulate another with comparable detail. So then we either we are the top level universe or we assume universes with greater complexity to explain our own.
That's not why he said it's 50/50. It's 50/50, because we don't know whether the conditions for the theory will be met, ie. that ancestor simulations are indeed possible and that humans don't become extinct in the future. Under these condition, he argues we definitely will create one, and then the chances that we are in thr real universe is basically zero, because the simulated universes will outnumber the one non-simulated 1 to almost infinity, due to their recursive nature.
His 50/50 proclamation is a pure guess and honestly bullshit, as it is impossible to say whether we will be able to create ancestor simulations. That's also why his theory is so worthless. It is a nice thought experiment, nothing more.
@@zagreus5773 sure, it's just rediculous to assume that gives you 50/50 odds. Potential conditions we don't know the truth of doesn't automatically get 50/50 odds. Most ideas a human can come up with are false, even when you narrow down to the ones that seem very plausible.
EDIT: Grammar
How's that an issue? It doesn't need to be infinite, anyway. It could be that our creators live in an universe which is not a simulation, and they're wondering about its nature.
@@emotionblur7214 It needs to be infinite for you to be sure. If we in our universe create an exact copy of it in form of an ancestor simulation, the copy will also create an exact copy, and so on. Therefore the number of simulated universes would approach infinity and we could say with certainty that we live in a simulation. The problem is that ancestor simulations are very unlikely to be possible. Therefor the theory is an interesting thought experiment, but nothing more. The theory was originally created by Nick Bostrom, a philosopher, NDT just jumped on it and seemingly never understood it. It is well known that NDT is a great example of Dunning-Krueger if it comes to philosophy.
Your example isn't even a thought experiment. Theoretically anything is possible if you allow for other universes. That's nothing new and not interesting.
I think the simulation hypothesis is one of those cases where we can quote Carl Sagan:
"It pays to keep an open mind, but not so open your brains fall out."
Flat earther friend I need to tell this.
Hahahahahahaha! Right.
Sabine was speaking in another video that there is no infinite in real life. I think this is the strongest support for this hypothesis because it implies that there is a minimum resolution and a maximum limit which may be imposed to the simulation. Also, the existence of entropy is a strong advocate for this theory. Why ? Because over time everything gets destroyed which you can associate with small glitches/uncorrectable errors that piles as the time passes. You don't need to calculate everything to the smallest details and this was proven by Machine Learning models being able to simulate physics in almost real time . This is done by approximating the outcome of a simulation based on lots of training and without being aware of the underlying physical laws. You can even go further and look at the uncertainty principle which clearly limits your resolution and amount of details you can discover . Dismissing this as based on religious reasons doesn't mean your brain "falls out" but it means that we don't have enough information to confirm if this is true or not. It is easy to dismiss the existence of Jesus and the events in the Bible or other attempt to religions (like hinduism , islam etc) now , because after we got smarter and the humanity discovered more and more of the secrets of the universe the basis of those religions became childish and their stories are just less and less believable. This is not true of the simulation principle which, by every year that passes, becomes more and more likely just by observing simple stuff like the evolution of games from Pong to Huge Open Worlds , the increase in computation power or the increase migration to the virtual space which for many has become the place where they spend most of their life
@@danielstan2301 WTF are you even talking about? "Also, the existence of entropy is a strong advocate for this theory. " This is absolute nonsense.
"Dismissing this as based on religious reasons doesn't mean your brain "falls out" but it means that we don't have enough information to confirm if this is true or not."
Yes your brain has fallen out especially your reasoning from "entropy is strong advocate" just made me laugh. Go back got to watch Matrix stan.
" because after we got smarter and the humanity discovered more and more of the secrets of the universe the basis of those religions became childish and their stories are just less and less believable."
Exactly and some people decided to change those stories into STORIES ABOUT SIMULATION.
" This is not true of the simulation principle which, by every year that passes, becomes more and more likely just by observing simple stuff like.. "
EXISTENCE OF SIMULATION IN REAL WORLD DOESN*T IMPLY THE WORLD ITSELF IS SIMULATION YOU F IDIOT.
Ha Ha very good.
The simulation argument concludes we are most likely NOT in a simulation. Sometimes it seems like no one has actually read the paper. (I really hope im not wrong on this one lol I've read the paper several times it's pretty interesting but maybe i forgot)
Really??? 😮
There's more than one version of the argument, and lots of iterations from many different sources. Mostly I think it's just an interesting idea, but it'll be great if someone ever develops some testables.
@@Egonkiller Yes. If you, like the person in the video, are referring to Bostrom's Simulation Trilemma ... yeah, it absolutely does NOT claim we are simulated. It sets forth a scientific/philosophic trilemma that concludes ONE of three things must be true ... only one of which is that we are simulated beings. For some reason, "hard scientists" have lost their minds over this, while scientist/philosophers like Nick Bostrom and David Chalmers talk about it reasonably. I guess science without philosophy really is a bad thing.
But how on earth do these people come up with the likelihood/odds for it being true or not? It seems to me that every "theory" about this subject, whatever their conclusion may be, are all based on a very shaky foundation of assumptions and conjecture to witch they assign some arbitrary numbers.
We just don't know. All we can really conclude is, that at this point we don't know enough to rule it out.
What does it matter anyway? If you knew life was a simulation, what would you do with that knowledge? I doubt there are any cheat codes or Easter-eggs to be found.
@@1112viggo What do you mean by "likelihood/odds?" The original source of this, Nick Bostrom's trilemma, simply sets forth a philosophical argument ... "If A, then B," etc. It is interesting and compelling. Beyond that, I think people read too much into it. And, to be clear, Bostrom absolutely did NOT claim that we are living in a simulation.
"I had a dream: I was a butterfly. But now I have a problem: did I dream about being a butterfly, or am I the dream of that butterfly?"
[Chuang Tzu]
Ah, let me rephrase this but in 600 pages written on turgid prose but laced with so many pop-culture catch-phrases that you don't notice.
It's gonna be a hit! :^)
No problem, A & CT, the neural structures of a butterfly cannot possibly support the complicated ideas of Chung Tzu, so he dreamt of the butterfly, definitely NOT the other way around. (I'm glad some one finally asked. Cheers.)
@@rexdalit3504 The point is that both in dream and awake state, the basis is the same consciousness. It has nothing to do with neural structures.
@@andsalomoni Ok, good point. But there was this sleep research experiment where a group was deprived of REM sleep and the control group was awakened the same times as the first but on random times.
After a few days the control group was just a bit groggy, but the first group was hallucinating. What dreams are for didn't this experiment answer. But it suggests that dreams are to sort and generalize the impressions the brain gets. A debriefing, so to speak.
Then there's the fact that children more often have nightmares and moves around more when sleeping. There must be some reason to that.
@@abaddonanon7573 Dreams are ways to solve unresolved mental issues. If in everyday life the mind accumulates issues of any kinds, the dreams are ways that the mind uses to solve them, or at least face them, with imagination. If you hinder this solution, the mind goes mad and starts to make it in the awake state, hallucinating.
The one who doesn't accumulate garbage in the mind in daytime life, doesn't need dreams, and actually sleeps in deep sleep only. Persons with a years long experience of meditation practice can reach this condition.
This channel should be called, "um actually"
Ha, I wish I'd thought of that!
The title of 'Dr. B's' next song?
@@SabineHossenfelder It is possible to rename your cannel...
"um actually" Pseudoscience is “a collection of beliefs or practices mistakenly regarded as being based on scientific method.” By definition, Multiverse, RNA World, Scientific Racism Hypotheses are classified as “Pseudoscience”.
@@moses777exodus The RNA-World-Hypothesis is based on the observation of information storage and catalytical behaviour of RNA molecules. So I would argue that it is a valid hypothesis derived by scientific means. The downfall of all abiogenesis hypotheses is, that it is hardly testable what the first replicator was. On the topic of the Multiverse and Scientific Racism I am with you.
If we are living in a simulation, then the laws of physics as we know them are really just the rules of the simulation. Therefore, we wouldn't actually know the real laws of physics in the "real" world, so how can we say it wouldn't be possible to simulate?
In the end though, it really doesn't matter. Even if we are in a simulation, that has exactly zero implications for how you live your life. You can't get out of the simulation, and you can't break the rules of the simulation (i.e. break the laws of physics). If the designers decide one day to just shut it all down, not only is there nothing you could do about it, you also wouldn't even be aware it had happened. You would simply cease to exist. This is what happens to everyone eventually, anyway. Whether by the simulation ending or you dying, you aren't going to be aware that it's over. What I'm getting at is that this reality or simulation we live in is what we have, and it makes no difference which it is.
So, my take on the simulation theory is that I don't really care, because it doesn't matter either way.
Except it does matter, just not to you.
@@B1GDINO yeah, it might mean nothing to me or OP but it defo has big implications for MANY people. it would be truly world shattering to anyone devoutly religious
@@Cloudsurfer69 Why? Couldn't you just argue that your particular God is the one running the simulation?
Facts. But this other video breaks it down in a more entertaining and logical way in my opinion... ruclips.net/video/cszXpIpb_-s/видео.html
Not only it wouldn't matter since noone can unplug (unless one starts preaching death is unplugging), but there's another issue - simulating that many "useless" people (possibly animals too then?) is a huge waste, isn't it?
Thanks Sabine - I did think that when Tyson brought out the 50-50 odds about simulation, it sounded like something being thrown in from nowhere rather than actual science. I expected better than that from an astrophysicist
@@MrHurricaneFloyd Oh cool, cheers for that
Also, scientist don't pretend that their conversations is "sciense" or even should be. Kinda weird to critique a statement or dialogue for not "being science," since it probably even can't be. Statements CAN be part of science o/c, but that's a different matter.
If you watch the interview where he says that, you'll see it's just a bit of fun (which Sabine acknowledges). He wasn't saying it within a serious scientific context
no person is perfect
Tyson definitely lives in a computational world where he is God and he can define what and when apply logic/scientific rules
Keep in mind. In the end it doesn't matter if our experience is real or simulated; It's real to us, and affects us just the same.
As a philosophical idea the simulation hypothesis doesn't make specific claims about the nature of this reality, as much as it entertains the notion that there may be other realities than our own.
So long as the code is unhackable. I mean that's sort of the point of The Matrix. If you believe you are in a simulation then the idea that you could possibly reach outside that simulation would be fascinating, but there are so many things with so much higher possibilities of both being real and of being unlockable technologically that it seems kind of questionable to spend much time on a cosmic longshot unless you have a really good idea on how you could test it.
One of the weird things about the intersection of science and philosophy is watching scientists, who've spent vast amounts of time learning science, suddenly discovering epistemological philosophies and wading in like because they are scientists and they haven't explored these things before that no one has. There was a big debate in the atheist community about whether Neil DeGrasse Tyson was an atheist, as he'd hedged his bets whenever asked directly but seemed to be leaning that way, but there he was, wading into simulation theory. (It was actually a fascinating debate that pitted some diverse ideas, from what is the difference between and atheist and a agnostic, but also do people have the right to label themselves something even if the evidence suggests they don't fit that label... which was getting some weird responses from people who in almost every other aspect of life would be all for letting people label themselves.)
It matters if there is a way out.
@@jscott4081 There isn’t a way out bud you’re made out of the simulation there is no ‘you’ beyond it
Exactly. Even if reality is just interactions of fields and one dimensional strings of vibrating ???? - I still have to pay my mortgage by the 5th of the month.
"It's just normal paranoia, everyone in the universe has that"
Douglas Adams
So you know every species in this Universe ?
@@johnb8854 woosh
@@kensho123456 I'm not sure why you'd be proud to not read them. Would you consider it? There's tons more great little bits like that!
Douglas Adams wrote irreverent comedy. He wrote for Monty Python’s Flying Circus. I would think that one must have a dull life if they are proud not to have read his stuff.
@@tonylalangue6243 ruclips.net/video/DaydqnqJYvA/видео.html
Her argument that it's not easy to reproduce the foundations of physics with code is valid only if we accept that the same foundations are true outside the simulation too. But if we live in a simulation the physics of our universe may very well be only an artifact of the simulation
In fact it would be a necessary consequence.
@@mdbk2 but that is just another assumption and like stated at the end: it does not mean it is a wrong hypothesis. it just cant be proven therefore its unscientific to believe it is true.
But if that would be the case, it is still unscientific because science is a product of our “world”. Hence, circular argument, hence scientifically irrelevant. Hence, just a matter of faith, which is also fine. I think she’s just clearing the use of the terms.
@@mdbk2 erm a lot of people who've done the lightest pop science reading repeat this. Anecdotally my sister, my flatmate and one of my colleagues fully believe that we are in a simulation. The plot of the matrix revolves around this, and people have taken to using it for simulation theory example. This video is probably more for those who do believe in this hypothesis and this is an educational channel
It's basically solipsism. Not a very useful idea.
I am a physicist and cannot support the arguments in this video.
Physics is concerned with modeling reality. We are now at the point where the particle model can no longer explain the reality that has been explored. Science leads us now to believe that information is the basis of our reality. Now models are evaluated according to how well they explain reality and the virtual reality model can do that quite well. Many problems in physics disappear into thin air, such as the constancy of the speed of light, the entanglement of quantum particles and much more.
And this really has nothing to do with belief, but is based on scientific knowledge that we have gathered from quantum physics. There is definitely logic on your side when you use virtual reality as a model.
Summary :
"We are a simulation" has no evidence.
"We might be a simulation" can't be proved impossible yet.
It's clearly both.
Yes, thank you. Too often people claim something is possible just because we don't know how to prove it is impossible.
"God" has no evidence.
"Maybe God" can't be proven impossible yet.
There you go.
@@petros_adamopoulos Which is why I can't accept the god 'hypothesis' either.
@@petros_adamopoulos The fallacy with both claims of no evidence (simulation theory and God) is that evidence is redefined by those that claim there is none. Evidence for a particular idea does not require no other explanation. Evidence is not proof. Thats a common erroneous conflation. Thus in a murder case opportunity and motive is evidence against a defendant . It doesn't matter if there are alternative motives and others with opportunity. Again evidence is not proof. The defendant may in fact be entirely innocent and still have evidence of guilt. There are numerous evidences for God (which is why around 90% of the population including some scientists believe in god. You just label their reasons as nonevidence because you have alternate explanations (many of which you have no evidence for ). However alternate explanations doesn't negate evidence. they are just alternate explanations for evidence.
who ever is running the simulations' operating system needs to update the anti-virus protection, given the last year or so.
very good. I'm with you 100%
I’ve said many times, if someone is creating a simulation we live in, they are doing a piss poor job of it!
Couldn't rubbers and other forms of birth control be like "anti-virus software"?
@@charleswoods2996 rubbers make things worse not better.
Simulation:
1. the act or an instance of simulating
2. the assumption of a false appearance or form
3. a representation of a problem, situation, etc, in mathematical terms, esp using a computer
4. mathematics, statistics, computing the construction of a mathematical model for some process, situation, etc, in order to estimate its characteristics or solve problems about it probabilistically in terms of the model
5. psychiatry the conscious process of feigning illness in order to gain some particular end; malingering
1. the act of simulating; pretense; feigning
2. a. a simulated resemblance b. an imitation or counterfeit
I reckon you could apply all of those definitions to Covid; the simulation within our reality.
www.collinsdictionary.com/dictionary/english/simulation
"It gives me hope that things will be better on the next level", best summary of religion I've heard.
The trouble is we don’t have any awareness of any „next level“.
@@Z-Diode We're all trapped in Frog Fractions and we don't know it yet.
Religion gives us hope it's better for us and worse for our enemies.
dang i thought i was the only one who noticed
This remark about religion got the most likes 👍🏽 so far. Like in her “Fine Tuning theory” video, religion is the cord that she’s after.
Her argument is weak. Just because we can't run a quantum Sim with general relativity doesn't mean we shouldn't assume other civilizations can't. I agree there's no way to prove it, but because something can't be proven doesn't make it unscientific, it just makes it a theory..
This episode is flawed from the base. Bostrom’s argument is not the one displayed and commented.
It is more like this :
1- civilization(s) end before able to do simulations
2- civilisation(s) do not want to start a simulation
3- we are in a simulation
Choose which one you want .
Number one I think
@@jamesmcmillan2656 possible.. the point is that all of Sabine's speech does not touch the subject of simulation argument at all..
This, exactly
To arrive at that state where we can even talk about civilizations reaching capabilities to build simulations there is hidden begging of question: while the argument is praised as if it discusses this universe, for the third conclusion which is used to justify 1 and 2, we actually already stepped to some other assumed universe.
How this is justified is by assuming that a civilization in this universe could simulate an exact copy of their own universe. Which is unscientific because it creates an absurd physical problem about information. Just as you can't assume your house is a miniature inside someones living room just because you can build a miniature house in your living room, you can't just assume bigger universe with more information because we can simulate simple things.
So it really does boil down to appealing to god or higher being: a level above reality is assumed so that the argument makes sense, and only justification for that is our ability to create very small and crappy simulations. It doesn't just scale up with technological advancement, unless you secretly already assume there exists other larger universes where this iterative chain of simulations takes place.
Which is done when the argument secretly assumes these civilisations take place in arbitrarily large universe. You can in an argument assume other civilisations than human (if you can explain away our current data), but you can't assume other universes, especially ones with completely different rules.
Except in philosophy. There is no reason to not build such argument as philosopher, if you clearly state you are building an ontology that is not bound to this reality but in fact creates a whole larger theory to explain the existence of this reality. But your friend is just as allowed to say a being omniscient from our perspective could do this as well, and neither of you are any more informative about our existing material reality.
@@catcatcatcatcatcatcatcatcatca the simulation argument is not assuming in any way that a civilisation in this universe could simulate an exact copy of their own universe.
And so to speak , it may be an approximate rendering of what is observed by conscious agents inside the simulation. The more it may be that each level of simulations use less resources than the upper levels and more resource than the lower ones, and so on. Nobody has stated such “exact copy”.
If in ten years , 100 years or in a billion years civilisation(s) run a simulation, then hypothesis 1 is excluded. If civilisation(s) can do but not want to, is the other possible hypothesis (2).
Else if we are not in a simulation, it implies that all the possible civilisation of the universe , our civilisation included, are doomed to die before.
to a man with a hammer, every problem looks like a nail. to a man with a computer, every problem looks like a simulation.
You are in wrong context… The simulation argument does not assume the use of specific technology, the simulation(s) could be surged by whatever you want , computers , future technology, inside conscious agents of mind or even brain in a jar..
It works for Thor
David thats exactly what I feel about this. I was born with computers and I dreamed about being the character of a video game, simulated by someone else. I think everyone born in that era that had an interest in computers went through that. Its funny after 45 years its now a theory.
TBQH, it would not be that difficult to simulate our species, because if you look at us in terms of intellectual demographics the individuals of superior intelligence (who would place the most strain on the simulating computer) are few in number. The overwhelming majority of the species are literal NPCs who of the “eat, work, sleep, procreate, consume” variety that don’t need too many flip flops of a logic circuit to fathom. Guys like Einstein or Maxwell or Hawking however, would have been a simulating computer’s worst nightmare come to life-code.
@@rockermilano You missed his point.
Here's a fun idea. The double slit experiment exposes a code optimisation that approximates light as waves until it is carefully observed. Video game developers use coarser approximations when possible to save computation all the time.
I've played with the thought of explaining relativity as the side effect of some kind of computational optimization also. I know for instance that when you simulate moving bodies that interact, you may want to run a higher rate of update cycles on things moving fast and/or close to other bodies to get more accuracy. Things moving slower and/or far form other bodies you do not have to spend as many cycles on. There are other optimization techniques worth talking about. Have not managed to come up with a hypothesis that makes a link so far. Probably a dead end, but fun speculation non the less.
I see this idea mentioned often but actually simulating quantum systems and entire wave functions is exponentially more complex than just keeping track of individual particles. It doesn't make much sense.
@@JAN0L It's the other way around. You don't need to see the waves unless you're actively looking at them. Everything could just be classical mechanics until you actually peak at the details. What's really nice with this theory is that it is provable!
Assuming that we are in a simulation, and this wave particle duality is indeed a form of performance optimization, it goes in to assume that the optimization was required for the simulation to work properly. In other words, you don't code in stuff that complicated if you don't need it in there. This goes on to imply that the computer running the simulation does not have infinite computation power. If it did, you wouldn't care about optimizations. Ergo, if you make enough quantum observations in a localized region of space, lets say by building a large scale quantum computer (I'm thinking on the order of 1 billionth the mass of the observable universe), then you should be able to measure some forms of lag. If you're lucky, you might not even need that much computing power.
All in all, it's definitely the kind of stuff you'd try out just before going out for lunch at the restaurant at the end of the universe...
@@KawazoeMasahiro Unless the simulation also uses something like EVE Online's time dilation, where it slows the action as it gets overloaded. Not played EVE in years so I could be wrong about what it does, but my point is there's no reason to think we run in real-time compared to the outside, so deliberately taxing our processing resources doesn't guarantee we'd be able to see an effect. Heck, they could just stop the sim until they can upgrade hardware then reload where it left off.
I've considered a similar "optimization" in physics: the heisenberg uncertainty principle. in the "real" universe, it may be possible to measure both the position and velocity of a particle but in our simulation, those properties are compressed to save CPU cycles. as a result, we have an entire layer of particle measurements that aren't accessible because they aren't relevant to the simulation
We can do the water to steam at any level and even molecule. Chalmers calls it it-from-bit-from-it
--
Yes, by simulating water molecules as a state machine, you can model their interactions at a microscopic level. Using computational rules and bits, you can create a causal structure to simulate various physical phenomena, like evaporation.
In this approach:
1. **State Machine**: Each water molecule can be represented by a state machine, with states corresponding to different energy levels, positions, or configurations. The transitions between states are governed by rules based on physical principles.
2. **Rules and Bits**: Computational rules define how these states change over time, based on inputs like temperature or pressure. The bits represent the states of the system, and the rules determine how these bits evolve.
3. **Causal Structure**: By enforcing the rules in a time-stepped manner, you create a causal structure that can simulate complex phenomena like evaporation. For instance, when energy (heat) is added, the rules might cause some water molecules to transition into a higher energy state, simulating the process of evaporation.
This method can be used to simulate other physical processes as well, making it a powerful tool for understanding and predicting the behavior of systems at a molecular level.
ChatGPT ❤🎉
I've always viewed the simulation hypothesis in the same category as Boltzmann Brains, Brane theory, and even string theory as "fun thought experiments that shouldn't be taken too seriously until there's any actual evidence"
It definitely seems to share some DNA with Boltzmann Brains, and Roko's Basilisk.
@@andrewness Roko's basilisk is idiotic. It has too many holes to even be considered scientific.
Not just that, but the same argument believers in the simulation hypothesis to "prove" that it is overwhelmingly likely that I live in a simulation, works just as well to "prove" that it is even MORE overwhelmingly likely that I am a boltzmann brain. And here's the punchline. It is impossible for me to be both. Because the simulation would have to be run for so long for boltzmann brains to appear that the universe that its computer runs in will have its heat death of its own before that happens. In mathematics, there is a principle, that if you have an argument that appears to "prove" a theorem, and that argument works just as well to prove something else that you definitely know is wrong, then you know there is something wrong with the argument. You don't know what's wrong with it, but you know something is wrong with it. Which means that the argument that it is overwhelmingly likely we live in a simulation, is bad logic.
@@januszpawlikowski6627 Well the question is, is it possible to make the universe cough up specific desired information from the past. They say that information is never destroyed, but then, can it be accessed? It is my understanding that if something is fundamentally unobservable, then it can be said to not exist. So that implies there should be a way to observe any information in the universe. And if that is the case, then it would be fundamentally possible to resurrect the dead, even the long dead, and that would only be a short leap away from roko's basilisk. Feynman's infinite path integrals seem to me like a clue suggesting that. I do think it is infeasible though. Because of the interconnectedness of all the information in the universe when anything interacts with anything else, you would probably have to somehow observe the entire universe in order to collect the specific information you wanted such as the exact location of a carbon atom in the brain of albert einstein on his death bed for instance. I also think that it makes no sense, the motivation of roko's basilisk. Because why would it want to punish everything that didn't get hard to work building it, when it DOES exist, obviously they didn't interfere with it coming into existence.
The Simulation Hypothesis explains a lot of things, some trivial, some quite profound. For trivial, it explains the mystery of "Dolly's Braces"!
The simulation argument is a statistical argument with a sample size of 0.
It will be 1 after I successfully simulate a brain, it doesn't need to be that real of a simulation to deceive most non-scientists.
Yup. This is actually a much better argument than the video. Or maybe more to the point I think the video failed to make the connection between, not knowing if we can make a simulation in our universe of our universe, and without having that ability having no way of even hypothetically getting statistics on other levels of simulation in universes with perhaps different rules than our own.
@@peterisawesomeplease You assume that our simulated universe (edit: I mean what we simulate) must be as complex as we live in right now. What if we simplify things by a lot, for instanse Sims: for a sim that world could be as real as this world for us. Maybe the overlaying universe is much, much more complex than we can ever comprehend.
@@Sekir80 "Maybe the overlaying universe is much, much more complex than we can ever comprehend."
Oh totally possible. That is quite a departure from the original argument though(the original argument assumes that the simulation we are in is from a future state in our universe). It is also a much harder argument to come up with a way to falsify. Which is PsychedelcChameleons point. Yes there could be a higher level universe where simulating our universe is easy. But there is just no way of knowing how likely that is. The sample size is 0. This makes it questionably scientific.
@@peterisawesomeplease Are you sure it is "totally possible"?
Because I don't think you can know that... with a sample size of overlaying universes of 0...
I think what you mean to say is: "we don't know that it is impossible".
I'm still waiting for one of the knights in the Age of Empires game to ignore my direction into battle, turn around and say, "How bout getting out of your chair and you going into battle."
KEKW
This needs to be an easter egg.
That would actually make for an interesting game mechanic, in the right game. The player's character goes rogue, so you have to take control of another character to try and get them back.
@@voxorox Eugen's Wargame series and WW2 game has a morale mechanic that "panics" units if under too much pressure or too isolated from supporting units and if they are not reinforced and resupplied back they will rout and try to escape enemy fire or the frontline entirely on their own (often with disastrous consequences).
There are several games that, if pirated, make your character drunk or unable to do certain things required by main missions. There are even some I've heard that immediately turn your PC off.
I usually find Sabine's arguments sound but this one is very flawed - maybe because she is not a SW Engineer.
To my understanding the simulation hypothesis does not claim that someone, somewhere is trying to simulate the REALITY of nature and the REAL physical laws.
Instead the "coder" may live in their own universe/nature which may as well have completely different physical laws. THEIRS is the real universe. Ours - according to the hypothesis - is a fake, much like our computer games. Now, in the same sense that we can create computer games that have any laws that we like - e.g. gravity that is a repelling force, the "coder" can also create a universe IN THEIR COMPUTER with the attributes of our universe. They do not try to simulate a real universe - which Sabine righly claims would be difficult, they CONSTRUCT one of their choosing, which they fully understand and control at will. The issue of the huge complexity of that project, of course, remains but that is a technical as opposed to a foundational problem.
Now, of course, my claim is not falsifiable and hence, epistemologically speaking, not "scientific" but that does not mean that the situation that it describes is not possible. We simply cannot prove one way or the other.
For the simulation hypothesis to work, a programmer doesn't need to simulate billions of people, they only need to simulate one.
Just me. Me personally. I know all the rest of you are just characters.
Nah cuz, -I- am The Centre of the Universe. Y'all just company. :)
No. It's me who's real.
Then how on earth are you explaining you _observing_ the behaviour of everything and everyone around you? The process of generating these phenomena is exactly what we call simulation. This also goes into the point about compression she was making - you can’t just throw away part of the simulation that no one is consciously observing at a time and have overall physical processes still make sense when you go back to observing them, or at the very least if you are proposing that is possible somehow you’ll have to explain how.
Yeah, in simple words, for you, as a programmer who writes the simulation like for "a single being's conscience", to avoid complexity, will need the following thing:
+ Precalculated world's behavior from your personal view. (besides the huge initial power consumption) Such thing would be lacking of interactivity.
+ So, your actions need to be limited to aviod breaking the simulation and doing unexpected things? Well, so there's no purpose to simulate predefined states - they're known by the beginning of the simulation.
@@hannessteffenhagen61 No, it's easy. Because I'm the only person in the universe, the simulation only needs to give YOU a back story of a few minutes. You watched the video and read my comment and replied. Nothing else about you matters. It doesn't even really need to simulate you at all. All you are is a single text string to me. The simulation will then assign a random decision tree to you to decide whether to have you respond to me a second time or annihilate you. My kids and my wife require much more complicated detail and processing and backstories because of their proximity to me, but even they don't need to be full simulations. Because I'm the main character in this story.
Similarly, the simulation doesn't need to process the entire universe and all of quantum mechanics and relativity. It only needs to simulate it with enough detail to fool me into thinking it's real. Which isn't that hard, because I am quite gullible. I can look through a telescope to and see Saturn, but the programmer doesn't need to actually simulate Saturn, just it's projection and I will think I'm looking at Saturn.
"In science we require explanations for how something works." Do we?
What is the explanation for collapse of the quantum wavefunction? How does entanglement work? Why is the strong force 137x larger than the electromagnetic force? What explains the ratio of the electron mass to that of a proton? What can we say about the interior of a black hole? Why can't we see the large majority of the matter and energy necessary to explain the large scale structure and dynamic behavior of the universe?
There are huge areas of QM and GR where we don't have explanations, yet we find it useful to use them nonetheless.
When legit physicists take ideas like multiverses, the 10^500 landscape and Boltzmann brains seriously, its rather slippery to draw neat lines of this type between science and pseudoscience.
Probably the best argument against the simulation hypothesis is the one you brush past at the beginning: Neil Tyson might believe it.
Agree with everything except the uncalled for dig at NDT.
The search for the answers to these questions is still ongoing, so not having them yet doesn't help the simulation theory's chances.
Love the dumping on that clown NDT. Tyson contributes nothing of value to science or scientific research.
@@piccolobolding5059 what about the people he inspires to be scientists? Like him or not, he does contribute in that way.
Collapse of the quantum wavefunction is just one interpretation of QM mathematically indistinguishable from any of the others (that don't violate Bell's Inequality) and only matters to how we think about this unintuitive physics, not how it actually works. "Entanglement" is nothing more than the conservation of certain properties such as momentum, energy, or spin across interactions, and is only mysterious if you choose to interpret QM in ways that make it mysterious. One of the most important properties of a black hole is that it doesn't matter what's inside; it makes literally no difference to the rest of the universe.
But you know you can always go for the ultimate and just ask "why is there something instead of nothing?"
The answer is nobody knows, but as long as you say that and try to find out, instead of declaring there to be an answer and taking it on faith that it is so, then you're doing science.
You're assuming the simulator universe has the same laws as our simulated universe. But it's necessary that all simulated universes are simpler than the universe that is simulating them, so the fact we can't sinulate our universe inside our universe isn't a problem for the hypothesis.
All simulated universes must be simpler than the universe running the simulation, or it wouldn't fit.
It may be impossible to simulate our universe with our laws, but easier with whatever characteristics the universe simulating ours has
Though if the universe that simulates our universe runs by different laws, then you don't know if the simulation hypothesis would be valid there, which does seem like a possible flaw.
The problem is that as you observe this is self defeating. The argument relies on 1) it being possible to simulate simulations of _ourselves_ to an acceptable degree, because that is the proposed motivation for creating these simulations to begin with 2) this leading to _recursive_ simulations (i.e. simulated beings created simulations of their own). Without these you don’t even have an argument anymore.
if the universe doing the simulation is different enough, the term "simulation" becomes a hypothesis too, because to the best of our knowledge such a universe may not allow classic calculations, mathematical laws or even intelligent life. we could be living in a type of "pocket universe" that is a by product of that universes laws, which is a different theory entirely. the hypothesis you suggest makes even more assumptions and is alot less concrete as a consequence.
She didn't argue that it wasn't possible, only that it was pseudoscience. Though, I think it's unfair to call a philosophical arguement pseudoscience if it's not presented as science.
A lot people who think about this will only entertain ancestor simulations in particular because then you at least have a reference point of known phenomena to make arguments like the one that Bostrom made, although he does make some assumptions as explained in the video. If anything goes there's nothing to think about; it then becomes the same as how do you know you're not dreaming?
The "game of life" by conway can be run by a Turing Machine and a Turing Machine can be run on the game of life. You claim that it is necessary that the universe being simulated must be "simpler" but do you mathematical proof of this fact? It isn't impossible but the more speculations that you add on (without evidence) the more unlikely it becomes.
Exactly the same as monotheist religions. We can't know how it's done because the creator is beyond our understanding so we'll never understand. Just have faith it's true because we say it's true.
When I finally read the details of the simulation hypothesis it seemed clear to me that it's based on a lot of unfounded assumptions about the limits (or rather, lack thereof) of computation.
So a good quantum calculator can be concious along with qualia and subjective sense of being? Ok.....
I think the biggest mistake is people make assumptions about the physics of the hosts "reality".
A hypothetical host reality could feature many more dimensions, completely different laws of nature, and/or our simulation just ticks at a much slower speed to compensate. The beings in that reality could be able to perceive our four dimensions at once, so our whole past and future is rendered out to them as a single static 4D model.
Either way it's useless to think about it because there is no way to verify nor falsify it...
@@YogarineWell a spatial dimension alone isn't a big deal, you can easily communicate across spatial dimensions. 2D being can send an SOS Signal to a 3D and vice versa. Different laws would be easier to explain since we can tweak the physics of our games
In short it is the dream of a dream
Limits in our universe do not equal limits in another.
Sabine makes a lot of assumptions herself. Sone are that the simulation is digital, that it's discrete, that it's of a physical universe that looks like ours and so on.
What if humanity is just part of the first wave of emergent intelligence in the universe, if not the only intelligence, and no species or civilization has yet advanced enough technologically to build and run a universe sized simulation?
There is more evidence for that being true than the universe being any kind of simulation. The type and manifestation of a simulation is pointless to ponder or argue about when there's no evidence of the phenomenon to begin with.
Sabine is assuming that the simulation also implies simulations that interact with each other and interact with natural laws. Which is a completely nonsensical assumption. It is like saying the laws in a movie must follow natural laws. Whereas the laws in a movie can be logically consistent within the movie.
This is a very poor refutation by Sabine and I suspect it is just click bait. After all, there are only so many things we can talk about before everything has been discussed
@@MrElvis1971 There is no evidence for the universe even possibly being a simulation, much less it actually being one.
It's just a nerdier form of creationism with same amount of scientific merit.
@@martianhighminder4539then just say "no evidence"... the end. But babbling away while trying to refute something in an illogical and inconsistent manner is absurd. It makes a person look more unscientific than the person making the original claim.
@@MrElvis1971I'm not sure what your qualm is. The universe isn't a simulation, just as there is no God who made and watches over it.
But idiots will still persist in trying to leave it open as a distracting possibility to sooth their need to deny reality and waste everyone's time.
“I dare you!”
Lol you’re great and I love your channel.
Sabine really do be out here daring our multiversal overlords to end it all
He could plug it out and then plug in, and we wouldn’t notice anything. Just like virtual machine.
I watched this video in the dark half asleep and you scared the heck out of me with that “I dare you!” Scene. And then you pulled the same stunt again and it shocked and really scared me again :-D The Argument of the simulation of laws of nature is imho flawed, because we could be a simulation for artistic or entertainment purpose, and our creators would care as much about scientific realism as we do when playing a computer game. As long as it is entertaining, we don’t care at all :-)
Recently, Sabine says she has learned to love pseudoscience. Sabine has also shown that the simulation hypothesis is pseudoscience. Therefore, Sabine has learned to love the simulation hypothesis.
Fallacious conclusion
Hmmmm? What?
I love women. Your mother is a woman. Therefore I love your mother?
Do you not yourself wonder how it is whoever is simulating (let us say) X can have any idea whatsoever of what X is a simulation, and the reason that the so-called simulation hypothesis is gibberish is that it falls to pieces the moment you ask: "of what is X a simulation?"
It is such a daft meaningless hypothesis that it seems to suppose that simulation is of another simulation or resembling yet another attempt to mimic or imitate something.
The hypothesis simply falls to pieces when you ask of what the simulation supposed to be a simulation does it not?
Sabina is very wise. Very interesting. Very intelligent. Also, the only simulations you’re aware of is the video. Prove that wrong and your in high cotton.
This is how I see LHC now.
Yes, the Large Hadron Collider (LHC) can be interpreted within a framework of physical structuralism as a tool that detects underlying logico-mathematical structures in nature. These structures, such as the Higgs boson or other particles, are first theorized mathematically through the Standard Model of particle physics. The LHC then provides empirical evidence for these theoretical structures, confirming their existence.
These structures could potentially be discovered or inferred through other means, such as theoretical work or different experimental setups, but the LHC offers direct observational confirmation that is crucial in validating the theory.
Yes, the process can be considered analogous to the discovery of Fibonacci numbers in nature. Just as Fibonacci numbers were initially a mathematical concept later observed in natural patterns like flower petals, the structures detected by the LHC (like the Higgs boson) are first predicted mathematically and then empirically confirmed.
In both cases, mathematical structures are recognized as underlying principles in nature, whether it's through the arrangement of petals or the existence of fundamental particles. These discoveries demonstrate how mathematical concepts can have real-world manifestations that may be discovered in different contexts.
---
Creating alternate outcomes in simulations like Age of Empires or Empire Earth-such as having the Mayans triumph over the British or Germany defeat the USA-can be considered good simulations, depending on your goals. Here are a few factors to consider:
1. **Internal Consistency**: A good simulation maintains consistent rules and logic within its framework. If your alternate outcomes follow the game's mechanics and create believable scenarios within that context, they enhance the simulation's quality.
2. **Purpose and Objectives**: If your aim is to explore "what if" scenarios, challenge historical narratives, or simply enjoy a different gameplay experience, then these modifications serve your objectives well.
3. **Engagement and Enjoyment**: Ultimately, simulations in games are designed to be engaging and entertaining. If these alternate outcomes make the game more enjoyable or provide fresh challenges, they contribute positively to the simulation experience.
4. **Educational Value**: While games prioritize fun, they can also offer insights into historical dynamics and the factors that influence outcomes. Creating alternate histories can encourage critical thinking about history and causality.
In summary, if your customized scenarios are thoughtfully implemented and align with what you seek to achieve-be it entertainment, exploration of alternate histories, or educational purposes-they can certainly be considered good simulations within the context of these games.
Finally! I am so tired of the simulation argument being spammed everywhere and presented as if was an established fact. What angers me the most about it is that it's not only unscientific, but also completely and utterly useless, just like multiverse. On the other hand, it gives me hope: if smartest people can believe in such bullshit, maybe I am not so dumb after all.
Useless, that's the word.
We living in a simulation, or in a multiverse, or in a created universe, or in a dreamed universe, doesn't change anything. We still can use science to predict our world, and we must stick to that.
pretty much everyone has a little bit of bullshit in them and some have a lot.
@@juanausensi499 You know a lot of math is also "useless".
We are not robots, such that we must only concern ourselves with what is "useful".
@@niicommey4117 'We are not robots, such that we must only concern ourselves with what is "useful".'
@@juanausensi499 Maybe we can not. If we are programmed, we certainly are not programmed to concerned ourselves merely with the useful. Art is not exactly useful. We do not get angry at artworks for not being useful.
Just like in math, there are arguments that can be made whose conclusions do not really have much bearing on possible applications.
5:08 Plot twist: our universe not just a simulation, it's also written in Javascript. 😱😱😱
Ah, that explains why the speed of light is so damn slow.
Bah. Commodore Basic FTW!
Now that is a nasty idea. The simulation hypothesis on its own is bad enough. But imagine those whole universes full of javascript! Ugh.
Oh good lord.
that would be pretty sick, cause we could find the client side code and become masters of the universe
I don't think you should limit the simulation to being run on the type of machines we have developed so far. Obviously the 'computer' running the simulation of our universe is a tad more advanced.
But again that’s exactly her point, a more advanced computer that can simulate the universe is based on faith, not science. It could happen in the future or anywhere in the universe, but it’s not something we can do now and we might never be able to do it. Regardless, I still think we do live in a simulation.
@@niceone1456 true, the only problem in the hypothesis is that it exists within our reality, simulated by humalike methods.
@Michael Lochlann bro those are video games. Also cpu and gpus do have a verifiable limit (the atom). Video games are As much akin to a "simulation" as a Shakespearean play. They’re made up of textures, meshes, and code which is not even remotely similar to how the real world works, they’re just a portrayal of the real world, exactly like a play.
I think you're missing the crux of Bostrom's Hypothesis, it was that you **cannot** out rule that we are living in a simulation, not that he proves we are.
well then we also can't out rule the said simulation is controlled by a 12 legged unicorn
It's not pseudoscience, it's a philosophical concept.
Exactly. Just because something isn't science doesn't make it pseudoscience. We might as well call Mathematics pseudoscience too, right? I mean where is the evidence that complex numbers even exist?
No one claims the Simulation Hypothesis is science at all. It's a thought experiment for people that understand probabilities.
People who misunderstand probabilities.
I believe the second half of what you said is correct.
Perhaps it could be configured as a scientific hypothesis, with a specific mechanism and goal. Without a mechanism it's more of an idea, or suggestion.
The weather outside is frightful, but Sabine's so delightful...
there's actual snow out here
Wow, thanks for the bonus information/ explanation of climate modelling/prediction.
The 10 km resolution description you gave helped me to have a better understand, that climate modelling systems use low res approximations, that are linked with regular observation to prove whether or not the low res approximation is accurate enough and useful.
Good video and analysis, however the label "pseudoscience" is unfair here. It's merely non-scientific since it's not trying to be scientific as it's instead philosophical. It doesn't make any testable claims. Pseudoscience not only means something claiming to be a scientific assertion but isn't, but also is contradicted by existing scientific results.
Philosophy relies just as rigidly on falsifiability - in fact the modern rules of science came out of philosophy.
You can't just claim something in Philosophy, you can assume it but it's very possible for someone to call that out as an incorrect assumption
All the premises in philosophy are inherently testable, otherwise you're not doing philosophy you're doing religion
@@tryingmybest206 Umm I guess you're not very familiar with the history of philosophy lol. Also there's nothing wrong with forming an hypothesis, but to actually believe it (at least in modern analytic, logical positivist approach) would be unjustified. You're confusing logic with empiricism.
@@djayjp what? philosophy uses modern analytic and logical approaches... what are you on about? don't say things you know nothing about
Do you see where you went wrong?@@djayjp
Also because of the whole "not being able to falsify or verify" and "not being able to make predictions with it" things
Oh that's right. Isn't that called science? Good point.
@MetraMan09 So you have a citation for the proof that simulation is disproven. I would love to read.
@MetraMan09 citation?
It is actually falsifiable. If a quantum computer has infinite simulation power (e.g. can fully solve a NP complete problem), the universe is NOT a simulation. This stems from the fact that a simulation has to be computed on a finite computer, since it has to be discrete.
@@viniciuscazevedo yea but you don't have proof that the universe is not discreet.
What we experience personally is a simulation in the truest sense.
That's not what she's referring to.
If your brain simulates things so you can operate in the world according to it's rules, survive and flourish doesn't mean the whole world is simulation itself. It's just your brain.
@@markiv2942 or rather our perceptions, a result of our brain making predictions and simulations
@@AdaptiveApeHybrid Exactly. Our consciousness is literally the simulation algorithm running in the thalamocortical cognition cycle of the brain, integrating sensory inputs with stored experience and projecting/predicting external reality.
@@kenlogsdon7095 you're clearly much more technically experienced with this than me, well put!
The simulation doesn't need to produce the whole universe, or even a small localised part of the universe. It doesn't need to maintain absolute consistency with known physical laws. All it needs to reproduce is the input of your senses and your thought processes about that input. Even the most advanced physicist only ever directly perceives a tiny fraction of all that they 'know' to be true. And the brain already has well-known circuits dedicated to making sense of inconsistent or confusing stimuli. It's pretty much the primary function of perceptual systems. Our brains synthesise and confabulate information with such rapidity and ease, and then engages other circuits specifically aimed at making us think those confabulations are true.
In a sense, we are all living in a simulation because that's literally what our brain is doing for us in every waking moment.
Ourr brains can make a simulation so good that we can't tell it's a simulation. Dreams! 😅
From my humble understanding of the simulation hypothesis (SH) I thought the "calculation of details" issue had been addressed. They say that the outcome does depend on whether someone is paying attention or not and point to the double slit experiment for this.
In the double slit experiment we get an interference pattern, if no one is checking which slit every single photon went through. But, if we do observe for every photon which slit it went through, then the interference pattern vanishes. For proponents on the SH this points to the "physics engine" not caring about these details as long as no one is looking.
PBS space time has a fascinating video about the "quantum eraser" where they show how this even seems to be working backwards in time. In a clever setup the photon hits the screen and only after that they measure which slit it went through. This is enough to make the interference pattern vanish as well.
For the SH this means that it simplifies reality at first, but if it turns out later that the details were important, it goes back and puts them in.
This might take some time, but as we are part of the simulation, we don't notice, because we are put on hold until this has been done.
To be clear, I don't believe in the SH, but it is not easy to dismiss.
My main gripe with it is that the SH is unfalsifiable and that puts it into the category of pseudoscience.
Not pseudoscience, but outside the domain of science. It's more a philosophical construction, or a thought experiment.
"This might take some time, but as we are part of the simulation, we don't notice, because we are put on hold until this has been done."
That's a *really* important point, and it refutes Sabine's claim that it may be impossible for simulations to run other simulations because of the recursive complexity. In reality, the simulation could simply pause to produce any computationally intensive result, and then resume, such that an 80 year lifetime inside the simulation might actually take 10,000 years to simulate; and the simulated people would be completely unaware of this!
Again, this points to the true problem with the simulation hypothesis, that it is not falsifiable. Like many religions ;-)
0:55 The being outside the simulation doesn't have to be all knowing or omniscient. They just have to have access to more information and and more control over our universe than we do. For instance an outside developer could make changes by observing and allowing an event to play out giving them knowledge of an occurrence. They could then rewind the simulated event and make a small changes and do it over and over again till you get the perfect results. For the beings inside the simulation they would only perceive The single pass through but the beings manipulating the simulator reality will be viewed as omniscient and all powerful when in fact there anything but in their layer of reality.
Ok but that's still making a ton of ideologically assumptions about the simulator and we're still left with the more glaring problem: we have no reason whatsoever to posit that we're in a simulation, whether on evidentiary or logical grounds.
This lady makes learning things I know nothing about very entertaining for me.
I really like this youtuber's delivery and style, deals with complex subjects intelligently but with great clarity.
Humans: make simulation to simulate reality
also humans: "wait reality looks like a simulation"
It doesn't tho
To paraphrase Douglas Adams, because our memory ain't clear enough to quote:
"Man, the maker, looks around at the world and says to himself, 'So, who made this?'"
Always has been
This is exactly my point
Nice, LOL
Some scientists: The universe had no creator. Same scientists: the universe has a creator, and he lives in his mom's basement.
@Sabine, if this big program exists (maybe it doesn't), the program doesn't have to "simulate" any law of nature. Laws would just happen inside the program. All physics could be just a bunch of patterns that this program happens to exhibit. Then, the bottom line of your argument is incorrect.
Perhaps the word "simulation" is not the right one. But us being product of some kind of code that is running in some kind of computing system is a completely plausible situation.
and completely unverifiable, and therefore useless as a scientific hypothesis
@@FredPlanatia A "code" theory might be testable, but it needs more detail. "It from bit" was an idea but it could become a theory...
Simulation theory isn't pseudoscience.
It's a meta-hypothesis based on likely outcomes based on historical metrics. Many things points towards simulation. The great filter, for one. AI is another. Human purpose in a non-purposeful world could also be why.
The arguments in favour all boil down to "because why not?".
Simulation Theory nuts are simply religious but are too scared of being mocked.
This is the first time I've ever disagreed with you; you clearly did not read Bostrom's book, Superintelligence
This video definitely does not follow all the branches of argument you can make about the simulation hypothesis. Certainly not enough not declare the idea BS like this video seems to. But it does cover enough of them invalidate the idea that it is obviously likely that we live in a simulation.
@@peterisawesomeplease Bostrom doesn't claim it's likely that we live in a simulation.
I've never thought of it as a scientific argument. Just an argument on probability with very honest assumptions. Like how many theories are based on the universe being infinite?
even a "probability" argument would in some sense have to be scientific as a prerequisite. At least if the argument tries to make claims about reality, you cannot do that without observing a part of reality first, which is a scientific process.
Putting it another way, suppose someone wanted to calculate the probability of a planet within X solar system containing water. They would have to, at a bare minimum, observe a number of planets in the solar system without water, and then contrast it with the number they find with water. You cannot do this by just sitting in your chair and doing math. You have to actually *look* . So to say you're not making a scientific argument, but a probabilistic one based on scientific observations, is without a difference.
From what I read, Nick Bostrom DOESN'T assume that we are capable of building stimulated universes or artificial consciousness. His paper is just philosophical. Just because it's not science (since there is no scientific evidence) doesn't mean it's pseudoscience.
Nerd scientist: simulation hypothesis
Occam: hold my razor
cringe
@@bingerasder6466 maybe a little bit
Occam's Razor gets it's ass kicked by Rapid Prototype Engineers every day of the week. It's great for indoctrination and snide observations, however.
Occam's razor actually proves the simulation hypothesis.
@@dirremoire why? It's totally unnecessary to add a more complex reality that simulates the actual reality, given that there are no proves and it's more of an intellectual tickle.
I love how Sabine says 'hypothesis.'
I like how she says "matter".
Calculation.
I realized I love how she says all the words mentioned in this thread.
Or how she can't say hypothesis, but we love her anyway.
@@RobertsMrtn
I live in Germany most of the time.
My mom is German.
Germans have a very phonetic language.
There are no spelling bees in Germany because to hear a word is to know its spelling.
Germans also do not have the 'th' sound and it is difficult for Germans to say words with 'th'.
Sabine does just fine with her pronunciation of English, especially with 'th' and 'w' and 'v' sounds.
Verstehen Sie?
Verstehst Du?
Verstanden?
:)
I think this (saying the simulation hypothesis is pseudoscience) is a classical example of mixing logic/philosophy (or other not empirical science) with empirical science. As far as I know, the simulation hypothesis is a form of the "brain in the vat", or originally "evil demon" argument from Decsartes. This argument is used to impress upon us that we cannot know anything for certain except the fact that a thing that is thinking these thoughts at this moment exists ("I" or "me"). Everything else is uncertain. This is not an empirical argument per se but much more a logical one. If you mix this epistemological argument with probability (which is a very contentious thing in itself as far as I am aware of) you get the simulation argument. The point of the argument is, I think, that we cannot possibly ever know whether we are living in a simulation or not (even if it should be "likely" that we do live in a simulation according to Bostroms argument).
Concerning the physical arguments from the video I am not convinced: only 200, or say, 500 to be on the safe side, years ago nobody in their right mind thought we could split atoms, fly to the moon, have video-meetings or simulate the birth and life of galaxies (which we didn't know existed) on computers etc. etc. So of course we would today think that such simulations (as suggested by Bostrom) are not possible. Who knows what will be possible in 100 or 1000 years time?
So the simulation hypothesis is/can be logically or philosophically quite scientific. It is just not an empirical statement, a statement about the real world ("we do live in a simulation"). But to call something not empirical is not the same as it being unscientific: nobody would say that mathematics is pseudoscience though all of it is grounded in unprovable and completely abstract axioms.
It is very sad, I completely agree, that people who should know better, like Neil deGrasse Tyson do not and say stuff like that (i.e., derive empirical statements from non-empirical ones). This is quite scientifically illiterate imo. But I have heard "proven" or "bewiesen" in an empirical context so often from so many otherwise smart people, my ears have bled all out.
One last thing: pseudoscience is very, very hard to define... This is called the problem of demarcation and it has not been solved, as far as I know. But it's fun to think about! :) Like the simulation hypothesis or the problems of the definition and meaning of probability and all that good stuff :D
Mario concludes that he cannot be in a simulation because he is unable to build an NES out of mushrooms and coins
“I dare you” to god shutting off the simulation is priceless I subscribed immediately
He would die of boredom, come on.
To who?
I LOVE Her sense of humor!!! The way she delivers it is absolutely priceless!
"How DARE you"
Unfortunately, she does not realize that she (or any of as for that matter) doesn't count. I expand: if you write a genetic algorithm you only care about the outcome of it and you have no interest in the failed ones led to it. This means we are all just the stepping stone for the next generation and who knows how long this simulation will go. So, right now, no one is watching us, we are just run, therefor she won't be disappearing by "daring" the runners. :D
I'm not worried that someone might pull the plug, I'm terrified that it might be running on Windows.
And we know how crappy Windows upgrades can be!
Yet another Unix fundamentalist (I bet) likely not realizing the irony: Unix itself has been a religion ... for decades! Signed: #PlatformAgnostic :D (still gave you one like)
Not just Windows, Windows 7. (Last update, 2015.)
I'm worried that we might be running on Mac OS and get shut down because the upper level didn't pay their monthly bill to Apple.
@@rah938 Windows 7 is a lot better than later versions.
“If you thought that science was certain - well that is just an error on your part.” Richard Feynman.
Yet the hypotheses surviving enough testing to be 'promoted' to 'theory' are so certain, only the logical conclusions of mathematics are more certain. No other method of inductive reasoning is as certain as the scientific method -- when it works.
Theoretical science isn't certain, that's why it is still theoretical. Science is the journey from theory to facts. Since the journey started centuries back we have already established many things that are Factually Certain. Don't confuse the places we've been with those still to discover. Where we've been are now Factually known, but where we are going are still just Theoretical mysteries. The journey continues.
Richard P Feynman. My hero. We owe him so much, but most people don't even know his name. Ty for his endorsement.
True, but I fear that people who post these quotes are saying in other words, "Since science isn't certain, there's nothing wrong with me taking something on faith."
This quote is not saying what you think it says.
Nick Bostrom made merely a simulation argument about a likelihood based on statistics. Unlike religions, he did not say we are living in a simulation run by computers which are similar to our computers. He is saying it is likely that there are advanced civilisations with advanced computer systems that simulate consciousness. How is that mixing religion with science?
The thing is, if you made a simulation of a (part of a) universe, you don't have to follow any specific set of natural laws exactly. From within that universe, whatever laws were there, approximate or not, would just be "the laws" of nature.
I agree the hypothesis does make the assumption that whatever is running the simulation may need to intervene. But the thing is we would be totally unaware if the simulation was paused, rewound, tweaked, and fixed in case any flaw was observed in universe that leads to the discovery of the simulation. I don't think that's as hard a problem to solve as Sabine does. If you're running the simulation of course you can detect when something with agency in the sim starts seeing evidence of the sim.
I do think the idea that anyone will ever be able to run any sims on the equivalent of their laptop is ludicrous, these would be planet scale computers simulating tiny pieces of a universe to high fidelity. And you wouldn't be able to run a simulation of a universe where it was possible to do much interstellar travel, or you wouldn't run it that long, or you'd kill off any progress made to that.
I guess my point is just that I don't think it's hard at all to argue that everything we observe *could be* simulated, it is all within the realm of possibility. But to take it on faith, well, that's just faith.
True, but the bit about the laptop sim I don't agree with - you don't have to simulate a universe with QFT/GR, you only have to simulate the experience of a single guest consciousness (or any number you want), and just render its surroundings like any computer game (that can run on your laptop now already!). How many have actually looked at quantum particles with their own eyes? You could easily simulate the entire environment with pre-fab experimental HEP-TH papers all over the place without actually simulating the experiments themselves :)
@@ingeniouswild which is why the dual slit experiment is spooky to me - it looks like an optimization that simulates what "should" have happened whenever someone was looking
It's like creationism without the God bit. The idea that everything was created by 'someone', specifically with you in mind, and they are watching over you, and this world isn't necessarily all there is.
Einstein followed Rabbi Spinoza theology.
I would it interprete just as "someone created a simulation of a (our) universe" and does not look at us. A bit like we do already particle simulations today, but on a huge scale and living beings were never in mind, but just emerged in the simulation.
The creator and/or the manager of the simulation is God as in the beginning, God created the Heavens and the Earth.
The entity that writes the simulation is equivalent to God. At least the deistic one. And assuming that he/she/it can receive output from the program ("thoughts and prayers") and is willing to act on it, it could even be a theistic one (output triggers the programmer's further input). And if the programmer wrote the program "in his image" (whatever that means), it could be a "personal" one.
@@onesandzeroes it is kinda out there and worrisome I admit.
AI in the wrong hands with implanted ethics will be a future concern..
it's pseudointellectuual nonsense, a cop out theory. it's basically at the same level of "the main character of this cartoon is in a coma and all the episodes are just his dreams!!! WUAAOOOOWWWWW!!!!!" theory
Its cool tho
There is no logical proof to that... the simulation theory is a valid mathematical conjecture
Indeed it is, but it doesn't make it less fascinating. It is like trying to know if there is a god. We just dont know but it is nice to fantasize with science and philosophy.
I actually disagree here. The primary issue with this argument is that you are looking at computer technology as it is, but not as it can be, which we don't know fully. To impose some limitation on what types of things computers can calculate in the future based on current (including quantum) computing methods is not correct. I think one of the premises of Bostroms argument is that computer technology will continue to improve such that such a simulation will be possible. Considering current computer technology is only 50 years old, and the universe is 13+ billion, it just doesn't seem practical or scientific to assume some type of limitation based on current technology or understanding of computer science. That said, I do agree that the simulation hypothesis is fundamentally not scientific, it is more of a philosophy than a science. But that does not mean it is not logical, but it does mean it is not currently verifiable via experiment.
My beef is with it being said "it's more probable we live in a simulated reality than a real one".
It's just like saying "There's trillions more bacteria on Earth than humans, so we're more likely to exist as a bacteria than as a human."
It's not an argument, and says nothing about reality.
there is an emerging medical view that In a certain sense the human body is simply a collection of cooperative bacteria...
Entertaining story, but does that make sense? One could also say that we are a collection of cooperative biochemicals.
sounds like an argument for simulation hypothesis, if we are gonna take trillions of simulations as a reality just like bacteria.
You just supported the argument though. If all you knew about a system is that there's good reason to believe almost all the things in it are bacteria then if asked "what do you think this one random thing is?" the most likely answer is a bacteria.
If you were to randomly choose an organism from Earth, you would be much more likely to choose a bacterium than a human because there are many more bacteria than there are humans. This is analogous to the probability-we-live-in-a-simulation argument; the argument you gave is not.
If we were to randomly choose an organism on Earth and we then learned of some of the traits of that organism prior to identifying it, that could influence the probability we assign to the organism being a bacterium or human. Likewise, perhaps there are traits of the universe that we can discover that influence the probability we assign to our universe being simulated or being "base reality." I'm just guessing, but it seems like this is probably the direction in which your mind was going when you made your comment.
If Elon musk's trying to sell it that's an immediate red flag
Lol alot people think he's a genius. That's sad.
That's what pop culture want. You have to give them something, otherwise possibly another heaven's gate incident because you lost to religions in competition. So It's better when the "cult leader" is elon musk or neil tyson
@@zhing836 uh ... No
@@afgor1088 pop culture is superstitious, they will consider buying any shocking idea if in any moment when they feel their life is boring, pointless and has no meaning. So that's a big market which the religions had dominated for thousands of years. So science have to beat them at their own game
@@StallionFernando
My CS teacher had a concerning amount of obsession towards Elon musk.
TLDR: The simulation hypothesis is unfalsifiable and therefore does not belong in the realms of science. The end.
That's just simply not true. It could be discovered that consciousness does not have computable quality's, for example. Sheesh, it only takes a second to think about what you're saying first...
Sime Said It is unfalsifiable. The world which is running the simulation could have physical laws different to ours, and so whatever experiments we run say nothing about the world outside. I.e. if consciousness is impossible to simulate in our world it says nothing about whether it is possible to simulate it in this theoretical “real world”. It could just be a property of the simulation
Not sure if I agree. To my knowledge, no one is claiming that the simulation hypothesis is scientific, and Sabine seems to imply that if something is not scientific then it must be religious or taken on faith. This is a false dichotomy. If this were true, then the classical Greek process of deduction or inference through pure reason would be classified as a religion, which is ridiculous. It's possible to arrive at a conclusion in the absence of direct empirical evidence through the application of logic to a set of premises that are by themselves not particularly controversial. I think that this is the key to Bostrom's argument. Each step is not particularly implausible. Humans create increasingly more sophisticated simulations, and in general we run a lot of simulations to understand the statistical properties of what we are studying. The resolution limit of our simulations is set by computational power, which is ever increasing, but eventually we would hit the Planck limit, which is itself an arbitrary scaling factor for our universe. If the universe simulates at a resolution below this limit, there is no way, even in principle, we could tell the difference.
I always love how the people like Elon musk and Neil deGrasse Tyson throw around these probabilities like “1 in 1000000000” or “better than 50/50”. Like how did they get their?? What formula did they use to calculate this probability? Does it work on known facts or do they add unfounded assumptions to make it work? It’s, like, explain yourselves!
> Like how did they get their??
From the same place Sabine got her "0%" probability of it being true. From their intuition, which they mistake for rational conclusion.
@@xs10z Sabine got her 0% probability from a rational analysis of irrational and unproven claims.
Neil and Elon got their numbers from irrational and unproven assumptions.
@@stemcareers8844 0% probability means impossible. The simulation hypothesis is not falsifiable. Therefore the analysis wasn't rational.
Each of them derived this estimate based on a very specific point in localized space-time that they instinctually pulled from, i.e., their asshole.
@@stemcareers8844
"Sabine got her 0% probability from a rational analysis of irrational and unproven claims.
Neil and Elon got their numbers from irrational and unproven assumptions."
0% probability means it's not even wrong. It means it's unfalsifiable. To prove that a Rolex unit is fake, you must provide another unit which is the genuine one, and then compare the differences between the two. To prove that our universe is a simulation/fake, you must provide information about the real one. So far, information from the outside of our universe has never contacted nor reached us.
So, the conclusion is either our universe is the real one, or our universe is indeed a simulation with one way information stream (only from our universe to the outside, not the other way around), aka the most perfect deception.
If I wrote the universe simulation I would throw in some little tells, like creating a super intelligent being who could use and explain the most fiendishly difficult scientific theories, but nevertheless be unable to say the word hypothesis.
😂
Personally I pronounce it, "hypothethethis.
I never knew that thought experiments could be pseudoscience.
Could be, if someone it's telling you it's science.
It’s philosophical speculation. Again, not “pseudoscience.”
@@danzigvssartre Again, if it is presented as philosophical speculation, it is not pseudoscience. It's only pseudoscience when presented as science.
@@juanausensi499 I'm pretty sure Nick Bostrom did not present it as science.
@@niicommey4117 Then we are cool
I've done the simulation hypothesis argument too many times.
I have settled on a single anti-SH argument.
A single argument which is to consider ....... a single droplet of water.
If you simulate a droplet of water you can do an excellent job with several graphic tools and AI models. BUT if you take the simulated droplet, extract the profile with high resolution, determine the first and second derivatives along the profile and then try to verify the Laplace Young equation it will be off by ... a lot (at least a couple of orders of magnitude).
Point being.
It is EASY to SIMULATE a physical object to the point that is seems real to casual observation but it is extremely HARD, borderline impossible (due to things like resolution limits and computational round-off error) to simulate the same physical objects to the point that they seem real under determined physical analysis.
So, we are NOT a simulation, and to convince yourself of this take a photo of an actual droplet and try to extract the LY equation. That exercise will be a humbling experience.
All of this is completely irrelevant. Getting a hacked job done is the same as saying the whole is already done, true. We don't need to create with our hardware, we just need the idea because the brilliant minds of the industry simply make this stuff happen. There's literally no "this needs to be this or that." We have Minecraft to show that things work because the logic works...explanations be damned. They aren't necessary for anything. As long as a computer program compiles and does what you set it out to do it is a truth regardless of if it malfunctions later. It can scientifically be studied and reverse engineered by someone choosing to download it and open it up using various tools like GDB to browse non-stripped source code if not compiled without it.
What if the simulation is just a set of basic rules and properties for the elemental particles. It simulates their behaviour and interactions resulting in such complex accidents like matter and conciousness.
What if the simulation is just a set of basic rules and properties (-quantum fields-) for the elemental particles (-quantum mechanics-). It simulates their behavior (-what we call reality or time) and interactions result in such complex accidents like matter and consciousness.
Glad to see there's a few people who don't just buy this hook line and sinker, because Sabine just happens to be smarter than THEM.
@@snap-off5383 As soon as smarter = always right, let me know. I'll be waiting.
@@ToxicityAssured I didn't say it did, so your wait will be infinite.
The intro preps you into believing sim hypothesis proponents simply *want* to believe because it's comforting, like religion.
It might be true for some proponents, but I don't think it makes any sense. I find nothing comforting about the possibility of a higher level. Why would that higher level be 'better' according to what i think is better? Why would it even be comprehensible to me?
It opens a possibility of an afterlife, instead of just ceasing to exist
Another important difference is that most people who believe in a god believe that a god definitely exists, while most proponents of the simulation hypothesis don't think that we definitely live in a simulation, and not everyone who entertains the simulation hypothesis necessarily even believes that we are more likely to live in a simulation than not.
We do not live in a literal simulation. It's a metaphor that we came up with because we make sims ourselves. We also only came to recognize the heart as a pump, after we were making steam engines( i. e. pumps)
Here's an idea to consider.
1- I can run a virtual machine (VM) on Windows 7, which simulates a physical machine with software, albeit slower due to *power and speed limitations*
2- Inside the Windows 7 VM, I can run Minecraft, just as I would on the host machine, albeit slower. *There is no difference in logic* between the VM and host machine.
3- I can build *computers within the Minecraft world* , but I cannot create a *computer that can run an exact copy of Minecraft within Minecraft* . The *in-game logic and physics would prevent this* , even if it were possible, it wouldn't be a perfect one-to-one copy.
Where I'm going with this is, just as the in-game physics of Minecraft prevent us from building a computer that can simulate the Minecraft world, we can expect that the physics of our universe may also prevent us from simulating it. The physics of the "outer world" may be more permissive, allowing its "inhabitants" to create our universe as a computer game for their children to play with.
As of now, we cannot prove or disprove this idea, which indeed places it within the realm of pseudoscience. However, to me, this idea makes more sense than the notion of a god simulating his own universe one-to-one. Unless I'm wrong, in which case I would be interested in learning how.
This is how science communications should be done. I love your channel.
Simulation hypothesis, a.k.a "creationism for nerds"
Exactly!
Fake creationism for nerds like Neil Tyson Degrasse
How much of a creator is the programmer of an emergent black box if they can neither observe nor interfere? The programmer may as well be the big bang.
Whether you believe it or not it dosent matter. At the end of the day you either go with logic or faith and you must eventually choose.
@@cesar777x333 I go for reason
There's no reason to optimize the algorithms in a simulated universe since the tick rate of the system can be as fast or slow as it needs to be without effecting the computation or perception of time within the system.
finally someone gets it
also there is no need to simulate everything either since it is enough to simulate what is observable at any given point in time and only in so much detail as to keep up the perceived "reality".
@@victos-vertex Or maybe, that is exactly why Gravity can't be mixed with QM. Gravity is for long-range simulation, where is QM for short-range or local simulation. After all you don't need the state of all star particles, to calculate the star effect on "nearby" objects, whether gravity pull, or photon emition.
@@victos-vertex As a game developer and someone familiar with the double slit experiment, it makes sense that you wouldn't want to waste computational resources to render matter and particles when there's no conscious observer. Also, the software we run on modern CPUs is extremely slow. When a given program is developed into hardware form it doesn't have resources limitations like load times or cache fetches because the information is already physically loaded into the system. Not the same but similar to how the old game cartridge avoided loading screens by being just a stick of RAM you plugged into the system with the information already loaded on it.
@@dragomirivanov7342 Even if the simulation hypothesis is bunk, this is how I think it would work if it were the case.
The problem I have with Bostrom's formulation is the same problem I have with the Creationist Fine Tuning argument. The fact of the matter is, we're here, right here, right now. That's the starting point. The probability of the circumstances right now is 100%. You don't get to propose a hypothetical "what if" version of the past and assume is is a roll of random dice to get from there to here, and then form a probability argument. If you want to assert the distribution of possibilities is random (instead of selective, biased, or causal), then you should have to prove it instead of just get it as a free assumption in your argument.
Creationists are not allowed to assume that constants "could have" taken any possible values, and then say the probability of their current values is extremely small. The fact is, the values are what they are, and if you want to assert they "could have" been different, then that is up to you to prove.
So when it comes to Bostrom's argument, where does he get the free pass to propose a totally fictional and abstract space of conscious civilizations, and then get to toss us in that abstract space like a plinko lottery instead of starting with our actual circumstances as the ground truth? So just like the creationist, if Bostrom wants to say there "could have" been these other civilizations that perform simulations, that is up to him to prove, not just get a free assumption as a possibility. We're not some abstract civilization in a 3 step armchair fart, we are a highly specific set of details and circumstances and context, and *every* single variable should factor into a continuously updated Bayesian inference.
The probability of you as an individual getting cancer is not the same as the probability of the average person getting cancer. Every single individual risk factor plays a part as a variable, with your non-statistical individual chain of causal circumstances being the ultimate determination of the outcome.
The fact of the matter is, Bostrom's argument when applied to our actual reality and evidence we have today says there is zero chance of simulation. If the civilization performing the simulation must be "outside" our physical universe in some manner, and therefore excludes all physical civilizations on Earth, then the number of civilizations we have evidence for on step 1 is exactly zero, and (even when you include our own civilizations) the number of simulators for step 2 is exactly zero, therefore the probability of us being simulated is zero.
Thank you. Breath of fresh air! You'd have a lot more thumbs up if there were more people who a) actually understand probabilities and b) bothered to read posts longer than two sentences. But we do exist 😀
Good point re the creationists, who hugely misunderstand the anthropic principle, thinking it means something (in favor of their view of god) which it is not saying.
I agree in principle, but Bostrom never hides or disguises his assumptions in-fact he very much highlights those assumptions and states multiple times that if they are wrong at any step his argument collapses. He really as Sabine put it playing “nerd games”. People like musk is the problem who take it seriously
The silly thing is we keep defining the universe in terms of the technology of the day.
A few centuries ago it was suggested that the mind is a clock.
Thank goodness for progress. If we make it long enough... maybe one day we will be right. Science is a slow and gradual process of improving older ideas with more accurate ones.
EXACTLY.
I sometimes struggle with an extreme existential dread about everything being a simulation, without having the education in physics or computers to reason out why it's not true. It's a brain symptom for me, and one I find hard to argue with. You've given me some incredible information to combat this in the future. Thanks so much 💕
Feels very similar to the fear of hell of an indoctrinated atheist.The scar of emotional blackmailing will say hi for long after they have broken out of the cycle. Maybe you should dig into that topic. There is plenty one can do to combat this feeling.
Yeah, this shit is straight up religious. A "theory" that has nothing resembleing proof but taps directly into peoples preperceptions and fears.
Maybe use the simulation theory as an allegory for reality. That maybe why we havn't found a most basic particle is because there is none. The most basic level is fields and particles are just fields interacting. That all of reality as we know it is just an approximation based on these fields.
It's rather fruitless to worry about whether we're a simulation on a computer or not.
If we aren't, yay we can't be unplugged. We still have to contend with vacuum expansion and the heat death of the universe though.
If we are in a simulation, what're we gonna do about it? B st we can do is try to tap in to any other computer networked into whatever our sin is running on and see if we can't get a glimpse of the "real" universe, and then either trick or negotiate the ones running the sim into downloading us into a robot body in the real universe so they can't shut us off and also so we can throttle the programmers and sys admins for not fixing their trash sim.
Seriously, cancer? How the fuck have they it fixed that yet? Also speed of light needs to seriously be increased, how has that not been addressed in ANY of their patch notes yet?
Before video games, people used to think that life was just a dream.
Same phenomenon, just a different label. "dream" is now "simulation".
But dreams in a sense are "simulations", animals that dream do so in order to simulate survival scenarios while sleeping. And for as long as recorded history, cultures have believed this was all a giant ongoing dream of a god.
"Simulation theory" is essentially "Brahma's dream" with a 21st century facade.
This could all be a giant fractal with dreams inside dreams inside dreams inside dreams........
I have just spent 10 minutes watching a simulation of Sabine talking about the simulation hypothesis!
Ah but go and get her to admit to it.
@@gillesmassot6844 You don't have to. Just walk round behind her. If you see the back of a computer monitor the hypothesis is confirmed. If you see the back of Sabine, it is refuted. That's science!
What caused me to roll my eyes wasn't simulation theory, but the even less plausible idea that nature and its laws are based on mathematics. That's a naive, anthropocentric, and frankly unscientific view. Our understanding is based on mathematics. It's a hammer. We use hammers. The universe doesn't need hammers. Mathematics isn't even our best mode of stimulating. Logical aligorithms with inherent time rather than parameterized time are superior to math, but we as humans are less able to understand them despite them being better predictors. Nature doesn't use either of those. We do. Nature has better things to do with its time than learn mathematics or programming.
I believe something similar; that everything we experience is just an experience. Instead of consciousness being inside of reality, reality is inside of consciousness.
Well a lot of things could exist and without a platform for them to exist within they're merely hypothetical.
(The platform = conciousness)
Or, Reality allows consciousness which allows the perception of reality.. which allows consciousness within the reality. So this is actually an argument for nested simulation........
Can we talk in person?
@@nowandrew4442Loop?
I don't believe there's a creator because it doesn't explain anything and only leads to circular reasoning. The only logical assumption is that either the universe spontaneously came into being or is eternal and had no beginning.
Beyond our understanding
Simulation theory is really philosophical not religious in origin. It drove me nuts she keeps calling it religious just because it has a metaphysical aspect
She dropped the ball here. Emotions got the best of her. My guess is she lost a debate and ran her for her supporters to pick her back up.
No. WE approximate, because WE don't know the laws of our universe. The being which runs the simulation knows the rules and doesn't have to approximate. The simulation doesn't have to be "perfect" and doesn't have to allow the beings inside it to even be able to guess those laws.
Also the simulation doesn't have to be complete - surely most of our computer simulations are approximate models which are failing in some conditions or outside of some domain. We either simplify the rules when it doesn't matter or we don't compute the "universe" when and where nobody important for us is affected by this "optimization". Still the being inside it wouldn't have any idea about it...
And, yes. We need to assume all those things you mentioned - still it doesn't cross the "science/faith" border. The argument just gets more "IFs". Another set of P(x) probabilities to include in the multiplication, not changing the general idea.
If you don't agree with it something tells me that you'd also call Copernicus telling about his heliocentric idea "an unscientific believer". He didn't know HOW it is possible to force planets to orbit the Sun. From his perspective circular heliocentric orbits with all those epicycles could look like unnecessary complication, without any scientific justification.
The "faith" border is only reached when someone says some numbers: "over 50/50 chance", for example.
Agreed 100%. As an atheist, I don’t believe we’re in a simulation, but it is entirely possible. Especially because right now our technology is so primitive. Thousands or MILLIONS of years of evolution could lead to technology so advanced it is beyond 1’s and 0’s and can recreate the universe to an almost perfect margin.
It has nothing to do with religion. The only similarities it shares with religion is the belief in that which cannot be proven. Which is also fundamental to philosophy. This is a HYPOTHESIS for a reason, nobody (scientific at least) is giving this more credence than it deserves. But it’s important to talk about nonetheless