A Response to Steven Pinker on AI

Поделиться
HTML-код
  • Опубликовано: 21 окт 2024

Комментарии • 1,5 тыс.

  • @Karpata1
    @Karpata1 5 лет назад +1433

    12:02 I laughed way too much when you actually tried the command again with 'sudo' haha. Well played.

    • @benrex7775
      @benrex7775 5 лет назад +1

      same

    • @jacobdoran9433
      @jacobdoran9433 5 лет назад

      Me too karpata, me too

    • @YourMJK
      @YourMJK 5 лет назад +1

      Yeah, that hit home close.

    • @mjbates
      @mjbates 5 лет назад +5

      I can't believe 'sudo' didn't work!

    • @honigwachsreuben
      @honigwachsreuben 5 лет назад +25

      @@user-xn4qp6gq2s you don't understand, the AI should've interpreted the `sudo` in the humans favour. "Ah, despite her mistake, she means *fo real* now." 😉

  • @theophrastusbombastus8019
    @theophrastusbombastus8019 5 лет назад +398

    3:47 "I'm not trying to construct a strawman here but I may by accident". I bet this sentence is just a modified version of a warning sign posted outside your lab:
    "I'm not trying to construct a malicious superintelligent AI but I may by accident".

  • @benjaminhalbeisen9175
    @benjaminhalbeisen9175 5 лет назад +457

    It’s been a long time since I’ve seen, heard or read such a well thought-through argument. Also, the fact that you waited for Pinker to correct himself, compromizing outreach for human decency speaks for itself. I’ve always loved what you do on this channel - now I also love how you do it!

    • @NineSun001
      @NineSun001 4 года назад +22

      It's mainly due to the fact that he is actually a real scientist that wants to share knowledge instead of just broadcasting himself. Just a real honest and intelligent person.

    • @blahblahblahblah2837
      @blahblahblahblah2837 4 года назад +14

      The clean, clear logic in this one is like a drink of fresh, cool water on the hungover morning after the months of conspiracy theory-filled COVID isolation

    • @codent
      @codent 3 года назад +11

      I agree so much....Rob is such a treasure. I have to say also about the added bonus of a little humor...abot the 8 min mark mentioning that to a caveman person, building cars would be unknown (and he shows a Flintstones car), and also walking on the moon (and then he shows the astronaut falling on the moon). Haha, bravo.

    • @seriouscat2231
      @seriouscat2231 Год назад

      An AI is a lot of numbers and calculations. How do numbers and math "understand" that they "exist" or "seek" to "preserve" their "existence"?

    • @NullHand
      @NullHand Год назад

      ​ A homo sapiens is a lot of water, fats, salts, and biopolymers.
      How do chemicals "understand" that they "exist" or "seek" to "preserve" their "existence "?

  • @FaridAbbasbayli
    @FaridAbbasbayli 5 лет назад +716

    Dat "the google" search tho.

    • @manfredpseudowengorz
      @manfredpseudowengorz 5 лет назад +46

      "We can be inteligent in one way, and dumb in another" case study

    • @NakushitaNamida
      @NakushitaNamida 5 лет назад +20

      @@manfredpseudowengorz That's why he talked about sarcasm in the beginning of the video. Googling google is so frustrating

    • @skylark.kraken
      @skylark.kraken 5 лет назад +25

      @@NakushitaNamida I've had my grandpa google "google" and then ask me which link is google

    • @zerge69
      @zerge69 5 лет назад

      Skye Murphy don’t mock your elders. You will be like your grandpa one day

    • @jameslima7404
      @jameslima7404 5 лет назад +4

      yo dawg, i heard you like googling. So we put some the google in your google so you can google while you google!

  • @sirzorg5728
    @sirzorg5728 5 лет назад +105

    "I hate this damn machine
    I wish that they would sell it.
    It won't do I want,
    only what I tell it" - The Programmer's Lament (I couldn't find the origin)

  • @duckpotat9818
    @duckpotat9818 5 лет назад +440

    People can be smart in one way and not so smart in other ways.Pinker himself is an example of this, good at psychology bad at A.I. safety.

    • @XxThunderflamexX
      @XxThunderflamexX 4 года назад +36

      I think you just explained why politics has gotten so bad

    • @revimfadli4666
      @revimfadli4666 4 года назад +39

      @@XxThunderflamexX unfortunately, it's even worse if the only thing they're good at is gaining/keeping power or making public impressions...

    • @derekhenriquez5740
      @derekhenriquez5740 4 года назад +4

      I agree, an example of the advantages and limitations of expertise.

    • @davidnoll9581
      @davidnoll9581 4 года назад +38

      Honestly, he's not great at psychology. It's just that the side of the field that is critical of his ideas is not pushed as hard into the pop-sci consciousness.

    • @seanmatthewking
      @seanmatthewking 4 года назад +11

      @@davidnoll9581 Unless, you're great at psychology, how would you know?

  • @danielrhouck
    @danielrhouck 4 года назад +149

    1:22 “Disease is down”
    Well, with some bumps along the way.

    • @NineSun001
      @NineSun001 4 года назад +26

      COVID is nothing against measles, all plagues, spanish flu, ebola, etc...

    • @danielrhouck
      @danielrhouck 4 года назад +21

      @@NineSun001 Thatʼs what I meant: “some bumps” is not the same as “no it actually isnʼt”. Disease is up this year. It is down from 100 years ago. Or even 99 years ago, to avoid inflating the old data with the minor fourth wave of spanish flu.

    • @Horny_Fruit_Flies
      @Horny_Fruit_Flies 4 года назад +3

      @@NineSun001 Why is ebola in there? Ebola to COVID is what COVID is to the Spanish flu.

    • @codent
      @codent 3 года назад +4

      Hello from late Nov 2020! Yes, that line stuck out....but you described it well, as a bump, because the covid chapter in history will be more about epidemiology, economics, Public Health and Hospital capacity than about illness and death. Smoking and obesity are still monsters by comparison.

    • @ashleycrow8867
      @ashleycrow8867 3 года назад +1

      @@NineSun001 Disease is higher in 2020 than it was in 2019, that's a bump in the graph.

  • @chrisofnottingham
    @chrisofnottingham 5 лет назад +141

    I didn't read the article but I did hear him interviewed a couple of times, and despite generally being a big Pinker fan, I was slightly reminded of the aged senators talking to Zuckerberg about the internet.
    I'm not in the AI field but I've done enough programming to know that things always go wrong and the bigger and more opaque the programming, the harder it is to test.

    • @sciencecompliance235
      @sciencecompliance235 5 лет назад +5

      chris4072511 Exactly. The more moving parts a program has, the more ways in which it can go wrong.

    • @cpedersenatgmailcom
      @cpedersenatgmailcom Год назад

      As usual, when I go to make a comment, someone beat me to it 🙂

    • @chrisofnottingham
      @chrisofnottingham Год назад

      @@cpedersenatgmailcom :-)

    • @seriouscat2231
      @seriouscat2231 Год назад

      What you are talking about here is a bunch of numbers that "understand" that they exist.

  • @moestietabarnak
    @moestietabarnak 5 лет назад +174

    Human are EXTREMELY BAD at creating safe things, EVERY safety feature we develop is AFTER it failed at least once already.
    whatever you would say was safely designed...it's as a reaction to an original failure.
    Luckily,while many of those fault were terminal to the designer/researcher, none were terminal for humanity...

    • @generic8891
      @generic8891 4 года назад +33

      Yeah, when I read the article, the bit where he talks about safe technologies I'm just sitting there like,,, what?? The only time humans, and especially engineers, prioritize safety enough to do it properly is when it becomes a problem, not as a default. You "build bridges" rather than "build safe bridges" because we've built a whole host of really shit bridges that got people killed/injured/annoyed or just the bridge itself destroyed/damaged. Hell, worker rights movements *exist* because industrial conditions and all the new technology of the industrial revolution was dangerous to the operators.

    • @fdagpigj
      @fdagpigj 4 года назад +18

      No, not EVERY safety feature is developed after it already failed, even if a lot of them are. There just is rarely any attention drawn to precautional safety features, and of course so long as the economy is structured towards something that is badly misaligned with human need, they are not economically incentivized. For example in the space race, soviet space craft engineers did take pilot safety into account to a greater extent than american ones that allowed Apollo 1 to happen. Taking precautions costs time and money, so having to choose between money and human safety is a big part of what causes unnecessary accidents.

    • @moestietabarnak
      @moestietabarnak 4 года назад +5

      @@fdagpigj nope, that's becoming philosophical now.
      Let be precise first, I don't say every safety measure failed once (not counting labs experiment like testing for the right material), I say something broke or were dangerous and was costly in life or money THEN we develop safety measure to prevent it.

    • @fdagpigj
      @fdagpigj 4 года назад

      I didn't say you said that, I just phrased it the same way as you did because I couldn't be bothered to think of a better way to phrase it.

    • @hexzyle
      @hexzyle 4 года назад +3

      @@fdagpigj You are indeed, correct. Take for example, Elevator safety.

  • @jqerty
    @jqerty 5 лет назад +271

    Alright, what do I have to do to get access to the sarcastic version of this video?

  • @JoshuaHillerup
    @JoshuaHillerup 5 лет назад +18

    When Steven Pinker talks about a subject that he didn't do his PhD in, and then I talk to someone who is an expert in that area, they have always pointed out very serious flaws in what Pinker said and how it makes them angry.

    • @celorfiwyn8193
      @celorfiwyn8193 Год назад

      What he does have PhD in is directly related to how the brain works, and often used a comp-model as comparables. In order for the oft voiced futurological concerns about AI a la Terminator or iRobot stuff, programmed software need achieve and self-sustain enough comparables much like the human brain works. *That* is what Pinker is talking about, e.g how language modules in the brain, or even in a software program.

  • @ptwob
    @ptwob 5 лет назад +195

    Not saying you should make more response video's,
    but doing so would probably grow this channel.

    • @junkbucket50
      @junkbucket50 5 лет назад +23

      It would grow but be more 'drama' orientated, which is a decision where I think he'd choose to keep the channel mostly science and knowledge orientated

    • @windar2390
      @windar2390 5 лет назад +28

      ​@@junkbucket50 Robert Miles' terminal goal for this channel is to raise awareness of AI's potental risk. so his instrumental goal should be to grow the channel. unfortunately he has another terminal goal which is "be a nice person" and this is directly in conflict with the instrumental goal "grow the channel".
      time will show us which goal will win - what is more important for him. survival of humankind or personal legacy until the downfall of humankind.
      ;)

    • @zaco-km3su
      @zaco-km3su 5 лет назад +3

      It's videos. It's plural.

    • @tolep
      @tolep 3 года назад

      @@windar2390 Good point. Also, being nice is overrated and sometimes even more insulting.

    • @DaVince21
      @DaVince21 3 года назад +1

      @@tolep Being nice though, not acting nice.

  • @kanti0kuroshi
    @kanti0kuroshi 5 лет назад +164

    While I appreciate the video and your concerns that a more expedient response to this article would (or could) have had detrimental qualities, I have to say I hope in the future you will not delay quite so long. Public opinion matters, and one might well argue that as someone with genuine credentials you have an obligation to speak out more forcefully, considering the results of actions taken now are likely of immense consequence to the future of all mankind.

    • @ZappyOh
      @ZappyOh 5 лет назад +8

      This ^^^

    • @lukeusername
      @lukeusername 5 лет назад +17

      Nah, I think he did the right thing by holding off and giving Pinker time to change his mind. If he responds too quickly to things like this, it could come off as hostile.

    • @lukeusername
      @lukeusername 5 лет назад +7

      @@NANA-dd4fl I never anything about being more or less "valuable". It's about changing other people's minds. If he made the response video right away, people would think "This guy's just jumping on the hate bandwagon!". Waiting a while gives Pinker a chance to clarify/amend his stance and shows that Rob's more interested in having a discussion than causing drama.

    • @GonzoTehGreat
      @GonzoTehGreat 5 лет назад +5

      @@lukeusername I'm not averse to waiting to give people time to change their minds but how long you given them is contextual (e.g. How long do you wait for the POTUS to change their mind about going to war or doing something about Climate Change). Fortunately, this discussion is academic, because we're still not close to creating GAI, but this may not be the case several decades from now, when we might not have the luxury to wait for people to recognise the imminent danger...

    • @NoConsequenc3
      @NoConsequenc3 5 лет назад +5

      @@NANA-dd4fl because hostility doesn't change minds, and in fact usually just causes both parties to more deeply entrench themselves in their ideas. This isn't fucking WW2, it's a news article

  • @hynjus001
    @hynjus001 5 лет назад +27

    This was so well argued. I particularly liked the point that humans can make something sophisticated without making it safe. This is a subtle but important point about complexity that politicians love to ignore for more votes. Subscribed.

  • @Brayden0
    @Brayden0 4 года назад +34

    Man I loved watching your videos on Computerphile, and was excited to find you had started your own channel. You do a really good job of communicating complicated topics in, if not layman's terms, then terms that anyone with a moderate technical inclination can understand. I could see this channel really taking off if you put the work in. You're the David Attenborough of artificial intelligence.

  • @TheNicolarroque
    @TheNicolarroque 5 лет назад +212

    On the "everything is better than it's ever been, it's irrationnal to be so pessimistic about the future" idea:
    Although all the indicators of wealth, well-being, security and develepoment are showing that things have been going better and better for the last 200 years or so, we shouldn't hastily extrapolate this trend to the future.
    Our analysis of the state of the world should not stop there; i think we must then ask the question: what are the conditions that made all this progress/development possible, and can we expect to find these conditions again in the future? To answer quickly: the main cause behind our level of developement is cheap and easy access to natural resources and most importantly fossil fuels (or rather cheap and easy access to energy, allowed by fossil fuels and not much else really) . I don't have time to develop here, but these are very valid reasons to be pessimistic about the future (and I'm not even talking about ecology).
    I know this is not the subject of the video, but it seems important enough to be discussed.

    • @OriginalMindTrick
      @OriginalMindTrick 5 лет назад +25

      Capitalism is coming to an end, we are the end stage right now, and AI is coming hard to the scene in the next decades creating a paradigm shift of epic proportions making previous models irrelevant.

    • @JM-us3fr
      @JM-us3fr 5 лет назад +16

      It's not access to natural resources that has led to prosperity. It's our efficient use of those natural resources, which is also getting more and more efficient. That means we won't need as much of the resources we've been using in the future, though perhaps we'll need some other yet unexplored resource, which will then be used more and more efficiently.
      You're right that it's just a heuristic that the world is getting better, but it's a pretty strong heuristic and the trend is continuing. When the trend starts to reverse, then we can be reasonably concerned.

    • @MrBroggolinb
      @MrBroggolinb 5 лет назад +35

      @@JM-us3fr Well there are other very strong heuristics on climate change, which will be a preeeetty big deal in the upcoming years. We don't have time to wait until the statistics show a reversed trend in the statistics Pinker uses.

    • @Ansatz66
      @Ansatz66 5 лет назад +12

      "The main cause behind our level of development is cheap and easy access to natural resources and most importantly fossil fuels (or rather cheap and easy access to energy, allowed by fossil fuels and not much else really)."
      We could credit fossil fuels for our success and certainly they are quite useful, but there's another thing that has also been available during these 200 years or so of rapid progress: Science. The Enlightenment was somewhere around the 18th century and ever since then we've been making things better and better. That's not to say that these two things are necessarily connected, but they might be, and there's no reason to think that science will run out in the same way that fossil fuels will naturally run out.

    • @andrasbiro3007
      @andrasbiro3007 5 лет назад +5

      @@NANA-dd4fl
      You are the victim of the same pessimism that was discussed in the video. The problem is not technology. Technology is what keeps making everything better. The problem is us, humans, we are deeply flawed and keep screwing everything up. For example suicides are mostly can be traced back to poor economic conditions, which are caused mostly by poor political systems. For example growing income inequality is obviously easily avoidable, yet it's the main cause of poverty, which in turn causes political tensions, discontent, uncertainty, crime, riots and even wars. But all these bad things are still not cause for pessimism, because this too is a thing that improves. Income inequality is kept in check much better then in the past, just not enough yet.

  • @brodaclop
    @brodaclop 5 лет назад +204

    For the "how can humans be so ingenious yet so dumb" argument, I give you basketball: invented by a single brilliant person, James Naismith.
    He originally used real peach baskets as well, baskets, so the fact that every time someone scored, they had to climb up a ladder and fish out the ball is probably fair enough.
    But even after switching to the more familiar rim-and-net design, it still took YEARS for someone to cut a hole in the net so the ball can fall through.

    • @hindugoat2302
      @hindugoat2302 5 лет назад +33

      so intelligent to develop nuclear power plants, but so dumb to be unable to do so safely...
      oh oh Chernobyl
      oh oh fukashima

    • @ze_rubenator
      @ze_rubenator 5 лет назад +85

      @@hindugoat2302 Keep in mind that the people who built the Chernobyl power plant were not the ones to blame for the meltdown. The operators spent the better part of a day ignoring design specifications, ignoring operating procedures, disabling safety systems and ignoring alarms. The reports read like they were trying their hardest to blow it up.

    • @hindugoat2302
      @hindugoat2302 5 лет назад +17

      @@ze_rubenator point is we could make nuclear power but failed to do it safely.
      Humanity includes the smartest and the dumbest, and even if the smartest didnt cause the accident, they put people in control who did.

    • @squirlmy
      @squirlmy 5 лет назад +21

      Your analogy may be an example of the point you're trying to make! 😆 When b-ball was invented there was no preconception of it being a high scoring game, so... it falls flat. For example, they might have instead simply put the basket 30 or more feet high, making it more like kicking a field goal in American football. They might have made it really difficult to score even once. OTOH, ancient Mayans had a similar game where the "basket" was a vertical hoop- another obvious solution. But, anyways, you are starting with a modern conception of the game of basketball and in hindsight, judging the lack of an opening as stupid- but the rules of games can be rather arbitrary so that's not really fair. Making AI that doesn't kill humans (or all of humanity!) is a bit more of an objective goal where the rules can't be adjusted as in a game, which can be made either high-scoring or low-scoring without serious implications!

    • @smallpseudonym2844
      @smallpseudonym2844 4 года назад +3

      @@ze_rubenator - Quite the contrary, Rubenator - the designers left a massive gaping hole in the safety of the RBMK reactor. One where pushing the scram button actually _accelerated_ the meltdown. All the stupidity in the world of the operator(s) would have not caused a problem if that button had worked properly as it was designed to.

  • @meowmeowmeowmeow-l6k
    @meowmeowmeowmeow-l6k 5 лет назад +63

    Loved the acoustic "Yoshimi Battles The Pink Robots" at the end!

    • @RobertMilesAI
      @RobertMilesAI  5 лет назад +32

      It seems to have been good enough to trigger contentID and cost me the ability to monetize this video, so I'm glad at least you like it :)

    • @code-dredd
      @code-dredd 5 лет назад +15

      @@RobertMilesAI You'd think YT would've tried to train their AI to recognize Fair Use 🙄

    • @totaltotalmonkey
      @totaltotalmonkey 5 лет назад +9

      Yoshimi Battles The Pinker Robots

    • @giantustedes
      @giantustedes 5 лет назад

      @@RobertMilesAI damn

    • @seanmatthewking
      @seanmatthewking 5 лет назад +2

      @@totaltotalmonkey lol that's pretty good

  • @RyanDB
    @RyanDB 5 лет назад +3

    Those couple of jokes you slipped into the video were actually hilarious. And now I'm off to find that acoustic version of Yoshimi Battles the Pink Robots Pt. 1

  • @lobrundell4264
    @lobrundell4264 5 лет назад +46

    Robert, you are so good at this!! Your explanations are so clear and succinct, it's a thing of beauty!

  • @ThoughtinFlight
    @ThoughtinFlight 5 лет назад +30

    Yes you explain shit very well and you have a great balance of realism and optimism but I subbed for the mutton chops

  • @fermibubbles9375
    @fermibubbles9375 5 лет назад +62

    "this video is long enough" ROBERT WE WANT MOOOOREEEEE

    • @lobrundell4264
      @lobrundell4264 5 лет назад +4

      Yah when Robert said that I was like oh no! :O

    • @inthefade
      @inthefade 5 лет назад +1

      I want Robert to do a 4-hour podcast with Joe Rogan or something. A debate with Steven would be awesome.
      Doubtful it would happen, but it is a sorely needed discussion.

  • @RagingPanic
    @RagingPanic 5 лет назад +53

    You are impressively and inspiringly insightful. Very well written and spoken video, awesome work dude. Keep it up!

  • @Krmpfpks
    @Krmpfpks 5 лет назад +28

    I thank you so much for your videos. From all the youtube channels I watch, your channel is definitively the most intellectually inspiring.
    The way you use language to irrefutably build an argument to an important conclusion is unmatched. But not only that, on every step of your argument I feel invited to challenge your assumptions, think about your argument in different ways and to come to my own conclusions.
    More: You do not dumb anything down, you just make your points as thoroughly as possible, which makes me feel valued and respected as a viewer.
    Feinmann: "If you can't explain something in simple terms, you don't understand it."
    You really do understand what you are talking about.

  • @otsoko66
    @otsoko66 2 года назад +4

    My problem with Pinker's argument about what he calls pessimism is the following: The reason that things improve over time is BECAUSE people focus on and point what is still bad. Progress is not something that just magically happens: people have to work -- and sometimes fight -- for it. We got progress in (eg) civil rights in the US in the 50s and 60s BECAUSE more and more people started pointing out -- and working (and fighting) against the evil stuff that was still happening. In 1955, a Pinker-like person would have opposed the civil rights movement by arguing that things had improved massively since the worst days of slavery; which is true, but irrelevant. Pinker's argument that things are better now than the worst days was exactly the argument that was made by 60s conservatives who opposed civil rights - including northern 'intellectuals' like William F Buckley, who had an influential TV show on PBS throughout the 60s. Pinker takes the results of the work and struggle that people have done to improve the world as evidence that there is no reason for anyone to want to improve the world. This is an insane argument.

  • @June26A7
    @June26A7 Год назад +3

    12:05 writing sudo before it is hillarious.

  • @hammadsheikh6032
    @hammadsheikh6032 4 года назад +6

    Sorry for commenting on such an old video. Just found your Channel. Amazing quality. Just wanted to point out: what if most of Pinker’s arguments are actually not that great? What if you knew as much about the other topics he writes about as you do on AI? Would you still think this specific article was “uncharacteristically bad?”

    • @michaelhoste_
      @michaelhoste_ 2 года назад +1

      I think the difference is only that he wouldn't make a video about a topic he didn't know as much about. But, even I can see the glaring boners in Pinker's article, which gives me more confidence that I can judge when he's right and not simply pulling the wool over my eyes with impunity.
      Do you think that 'most of Pinker's arguments are not that great'? Ummm, for example?

  • @stormsurge1
    @stormsurge1 5 лет назад +11

    I don't understand why so many highly intelligent people disregard the danger of advanced general AI. Thankfully in last few years a good number of them changed their minds.

    • @quangho8120
      @quangho8120 5 лет назад +3

      I guess the field is new, and is unfamiliar to a lot of them. When I first came across these ideas, it feels really strange and it takes time for me to adapt to this way of thinking.

    • @MaxZRider
      @MaxZRider 5 лет назад

      As long as AI is used for the greater good, the gue’vsa will be fine

    • @MrCmon113
      @MrCmon113 3 года назад +2

      Lack of imagination. Lack of understanding what a vast difference in intelligence implies.

  • @proxxyBean
    @proxxyBean 4 года назад +2

    14:25 Yoshimi Battles the Pink Robots. A cover of one of my favorite Flaming Lips songs.

  • @burnheart123
    @burnheart123 5 лет назад +43

    1:18 if you drive towards a cliff, you can't see any obstacles either

    • @John-jc3ty
      @John-jc3ty 5 лет назад +3

      these things, formally, are actually called singularities which by definition are something you cannot predict. for example, the discovery of electricity was a singularity.

  • @DavidRutten
    @DavidRutten 5 лет назад +192

    When Pinker talks about language, linguists I know all start moaning as well. I don't think his articles (or even views) are that well researched at all, but that's hard to tell when he's talking about something you don't know that much about.

    • @HeadsFullOfEyeballs
      @HeadsFullOfEyeballs 5 лет назад +88

      Another linguist here, can confirm. Yeah, his trick seems to be weaving together many disparate topics, so that no one individual has the breadth of expertise to notice that he's talking bollocks about all of them.

    • @jayteegamble
      @jayteegamble 5 лет назад +15

      This is how it is when a journalist talks about anything you have a deep understanding of.

    • @jamesdrain3482
      @jamesdrain3482 5 лет назад +17

      @@HeadsFullOfEyeballs Can you give some examples of dumb things he says about linguistics?

    • @HeadsFullOfEyeballs
      @HeadsFullOfEyeballs 5 лет назад +5

      @@curiousmolar8104 Any actual linguist would be a start -- Pinker is a psychologist by training. You could leaf through the Cambridge Encyclopedia of Language if you want an easy-to-understand overview of the general consensus in the field.

    • @HeadsFullOfEyeballs
      @HeadsFullOfEyeballs 5 лет назад +33

      @@jamesdrain3482 He's one of those pop authors that laypeople bring up a lot but that specialists don't particularly care about (he's a psychologist, not a linguist). He has a nasty habit of strawmanning competing theories (anyone who doesn't follow his strong nativism is a 'blank slater' and probably wants to brainwash people), which is especially troubling since he does it in widely-read popular science books. The problem isn't so much that his ideas are outlandishly stupid (I'm a fairly strong nativist myself), but that they lack a strong empirical backing and he overstates his case. He has a penchant for evopsych-style just-so stories.
      It's similar to his sociopolitical theories, really -- he's not _wrong_ that things are generally better than people believe, it's just that his arguments are overstated and cherry-picked and he avoids engaging with the strongest criticisms. He lacks rigour and intellectual humility.

  • @TheOnyomiMaster
    @TheOnyomiMaster 3 года назад +9

    Also, the "AI safety" worry isn't about robots having motives to enslave humanity or whatever, it's about them being motivated to do that in the service of creating the world's most profitable airplane factory or whatever main goal they have. Subtle difference.

  • @xerkules2851
    @xerkules2851 5 лет назад +11

    The poll could be taken either way honestly. It depends how you read Pinker's claim and the middle option on the poll. Pinker said they aren't "losing sleep", and I think that's perfectly consistent with most of them calling the problem "moderately important" or less.
    I think Pinker raises some important points, though he doesn't represent the best arguments of the other side very well.

  • @RalphDratman
    @RalphDratman 5 лет назад +11

    I love it that you are open about being uncertain. That is what a thinker does.

  • @HeadsFullOfEyeballs
    @HeadsFullOfEyeballs 5 лет назад +372

    It's funny that Pinker would bring up the Luddites as an example of unreasonable technophobia, because those guys were _absolutely right_ to think that automation would be terrible for them.
    They were skilled craftsmen, respected people with a high standard of living, and the automation of the textile industry ended up destroying their livelihood and reducing them to pauperism, just as they had predicted. It made the industrialists rich at their, and their communities', expense.
    In fact early industrialization in England was basically the historical nadir of human health and well-being -- generations of people lived and died (mostly quite young) in grinding poverty, with sickness and malnutrition at levels you'd previously only see in famine years. The greatest difference in height between lower-class and elite individuals ever recorded in history was in Victorian England, because the new urban poor were chronically ill and malnourished and grew up stunted. They had to keep lowering the minimum height for recruits to get enough soldiers. Medieval peasants were far better off than Victorian factory workers.
    Pinker does that a lot, telling people who are _right now_ being fucked over in entirely avoidable ways that, well, _on average,_ the world is getting more prosperous or whatever. Or more accurately, he tells his affluent Western Liberal audience this as a moral palliative.
    No need for drastic measures, no need to re-examine the system, it's all going to be fine if you just let the technocrats do their jobs. Sure we could fix world hunger right now, but that would _upset things._ Isn't it much nicer to just wait and watch people senselessly die at a slightly lower rate year by year? Pinker is often framed as promoting "optimism", but I think "complacency" is more accurate.

    • @maximkazhenkov11
      @maximkazhenkov11 5 лет назад +29

      "Sure we could fix world hunger right now"
      We? Who the fuck is "we"?

    • @HeadsFullOfEyeballs
      @HeadsFullOfEyeballs 5 лет назад +86

      @@maximkazhenkov11 People. Hell, the government of any one wealthy Western country could do it, it wouldn't even be all that expensive. The US could do it with a fraction of their annual military budget. Jeff Bezos could do it and still be a multibillionaire afterwards.
      But it would involve empowering poor people in poor countries and making them independent. And why do that when we can instead use a dripfeed of "developmental aid" to ensure the obedience of their governments and corporate access to their resources and markets?

    • @gloverelaxis
      @gloverelaxis 5 лет назад +69

      The threat the Luddites faced was not automation, it was capitalism. The near-future threat of AI is, again, capitalism. Pinker is thoroughly capitalist. He's a bastard.

    • @HeadsFullOfEyeballs
      @HeadsFullOfEyeballs 5 лет назад +56

      @@gloverelaxis Sure, but I think it would be anachronistic to frame the Luddites' motivations that way. They weren't fighting for some coherent non-capitalist vision of society, they just recognized what automation would mean for them under the existing system.

    • @DarkarDengeno
      @DarkarDengeno 5 лет назад +48

      @@HeadsFullOfEyeballs Hmm, I think that's a pretty strong claim actually. Most of the places with endemic hunger problems have them at least partly because of political instability or unreliability, so it isn't as simple as buying a bunch of food and shipping it to where the hungry people are. Making sure that the right people get the food (and can get _to_ the food in areas with little urbanization) and that the influx of food doesn't cripple the local, probably agrarian economy is difficult and in many places dangerous.
      I certainly agree that a concerted effort to end global hunger and poverty is within our means but economics and politics aren't things you can just _ignore_. The way you dismissively say 'upset things' makes me think you are perhaps not considering the often bloody cost of unrest. We call drastic measures 'drastic' for a reason.
      EDIT: Actually, let me explicitly ask: if you were given discretion over US military and foreign aid spending, what would you do? Which specific interventions would you choose? I personally do have a few in mind and I certainly don't think 'just respect the status quo' is a satisfying answer but the way you're talking it makes me think you think this is _simple_ and so I'd like to see your math.

  • @jdmac44
    @jdmac44 5 лет назад +17

    You don't have to worry about seeming too sarcastic or disparaging about the topic, Robert. Anyone with a decent amount of intelligence who takes a little bit of time to come to an understanding of your care and expertise about the topic will see that these are not points made lightly and without consideration. This was very well done. I like Steven Pinker as well, he's also not without critics who are worth listening to. Nobody's perfect, especially when they venture outside of their field of expertise. Thanks for doing what you do.

  • @samwise210
    @samwise210 9 месяцев назад +2

    "Pinker is someone I turn to to get an understanding of a topic I don't know much about" and "Even really basic research in this field would show that Pinker is wrong about this" being two minutes apart is one of the best examples of Gell-Mann Amnesia I've ever seen.

  • @VonCarlsson
    @VonCarlsson 4 года назад +7

    "but I know most of you won't" Fine, I'll read it. Jeez..

  • @MatildaHinanawi
    @MatildaHinanawi 3 года назад +5

    I would really struggle to call Pinker a smart man with how many completely absurd things he says in that article, although I'm sure he has done a lot of great things as you also explain as the start. Good job on criticizing it and thank you.

  • @jeff__w
    @jeff__w Год назад +3

    1:29 “The statistics on this are pretty clear-things _do_ seem to be getting better.”
    For an alternative view, see economic anthropologist Jason Hickel’s piece “Progress and its discontents” in _New Internationalist_ and Hickel’s appearance on _Citations Needed_ “Citations Needed 58: The Neoliberal Optimism Industry with Jason Hickel” (available on RUclips and as a podcast). Hickel’s focus is largely on global poverty.
    That said, I enjoyed the video, even if I disagree that Pinker’s arguments are “uncharacteristically bad”-they _are_ bad but not, from my limited experience, “uncharacteristically” so. I have in mind Pinker’s 2003 _The Blank Slate,_ which is one long diatribe against a strawman argument concerning behaviorism that Pinker himself constructs. Then, again, I’m not a Steven Pinker fan in any case.

  • @Jack-Lack
    @Jack-Lack 4 года назад +2

    I bet y'all wondering what the song is at the end. It's some sort of ukelele cover of Yoshimi Battles The Pink Robots by The Flaming Lips.

  • @jdavis.fw303
    @jdavis.fw303 5 лет назад +3

    Loved your Computerphile videos, psyched to stumble on your channel almost a year later!

  • @Garbaz
    @Garbaz 5 лет назад +54

    Okay, I know this is not the point the video is about, but since you mentioned it can't stop myself from writing a reply.
    I personally find the "On average, everything is better, so why be pessimistic" argument a bit dangerous.
    The biggest problem with the argument itself is that the basis of our current well being is unsustainable. The progress of the last 100 years looks great in a graph, but in reality has to be taken with quite a grain of salt. That of course does not mean that we are worse off, but looking only at the progress without it's downsides is somewhat dishonest.
    Then there is the problem that such an argument makes ignoring big global problems easier. This of course does not speak against it's validity, and a healthy amount of optimism probably is beneficial, but arguing that we are in a good state or on a good path is difficult.
    EDIT: To be clear, I have very similar reservations about technological pessimism, that our technological progress has created more problems than it has fixed. By human nature, we are fast to adapt to take as given changes for the better and problems always stick out.
    Then again, I find the observation that despite all progress, we are not proportionally happy important, and that progress is not an argument for itself.
    It's difficult for humans to strike a good balance of, well most things really, but especially optimism/pessimism. Things are never all great or all bad, there is no one dimensional scale of goodness. Every solution brings new problems and most problems can be overcome.

    • @marcelwindpassinger5572
      @marcelwindpassinger5572 5 лет назад +2

      I also find the idea that 'everything tends to get better' quite superficial. People living in the West are clearly less healthy then they were generations ago, which is masked by longer life expectancy rates through medical advancements.
      The Western political systems are becoming more authoritarian by the year, despite more lip service being given to the importance of democracy and freedom. Those terms are then often used to defend tyrannical measures that are counter to them.
      A third topic, climate change and pollution, partly consequences of rapid population growth, will be getting a lot worse without proper intervention. Now, there is slow progress to fight the former issues, but who is actually trying to tackle the overpopulation problem? And to get into even hotter waters: On a basis of population mechanics and intelligence, eugenics is definitely what ought to be done. And no, it wouldn't have to be killing people or forcibly sterilizing them. Is there anybody out there in politics trying to achieve that?
      My conclusion, on the big issues: The world is pretty fucked. What we see in 'everything tends to get better' is the curve soon reaching a local extreme point.

    • @pensiring7112
      @pensiring7112 5 лет назад +1

      The biggest problem with the argument is the "on average". If you have three guys with $100, and three with $10, they have an average wealth of 55$. Now, if somehow the richer guys have 70$, and the poorer guys have 60$, they have 65$ on average. So, everybody is better off, on average. But if you need 80$ to live, they are now all below the poverty line. So yeas, on average things are "better", but in real terms, instead of having half your population unable to sustain themselves, everbody is now unable to sustain themselves. The example works the other way, too. If one part of the population gets extremely rich, while the other part stays poor, on average, everybody is wealthier. But that only benefits a very select few. I'd also question if their monetary values for poverty actually mean anything for places like Africa. Does it really make a difference if you have 1$ or 2$ in Zimbabwe? I mean, you had a 100% increase in wealth, but, is your life any better? It is the same with countries, maybe Africa is getting better slowly, but maybe the West is slowly (or fast, depending on your outlook) getting worse, so how can you look a westerner in the eye and say "Well, everything's better, yo?" Thats like telling people in the Soviet Union "Well, on average, everything is getting better, just look how rich those guys in America are getting!"

    • @squirlmy
      @squirlmy 5 лет назад +2

      "People living in the West are clearly less healthy then they were generations ago". That my only be true in the US, and I'd say only a generation or two. Polio comes immediately to mind, as I remember growing up knowing survivors and first hand accounts of people's family members either lost or crippled.. The vast majority of vaccination deniers seem to be too young to have known that last generation of survivors. Same with the Spanish Flu, which actually killed more people than the World War immediately preceding it.
      Also, maybe you don't remember the dire warning of how 4 billion people was going to be apocalyptic and starvation become rampant. Advances in agricultural technology have actually kept up with population growth; in other words claims about how bad overpopulation will be have been proven wrong; In part because it is used to justify ideologies like eugenics. Read about CRISPR and advances in gene therapies. Eugenics is totally unnecessary- always was, always will be. Global warming is entirely about fossil fuel companies dominating our economies and politics -right now nuclear power is the only viable alternative, but the problem is at best tangentially related to overpopulation.

    • @squirlmy
      @squirlmy 5 лет назад

      I generally agree in a philosophical way, but the problem is that pessimistic, even apocalyptic thinking is so often used to promote political and religious agendas; in the worst extreme, suicide cults. Pinker is not promoting this idea in a neutral marketplace of ideas, but in a world that overwhelming presents pessimism. Maybe you're too young, but I grew up certain the world would end in a nuclear apocalypse, and then again in 1999. (I'm just a bit younger than Pinker) Before that, different generations of Americans were told Jesus was soon coming and Armageddon would follow- "the basis of our current well being is unsustainable" -that has not only been accepted as true, but embraced and celebrated by such Christian groups! With that background, for Pinker just to have a work on this theme published is itself a bit of a miracle. ;) I think you're also, naturally, conflating individual psychology with societal concern and action. Yes, it's good to be balanced optimist as an individual, and even a group, but that's actually a bit separate from our collective well being.

    • @marcelwindpassinger5572
      @marcelwindpassinger5572 5 лет назад

      ​@@squirlmy "That my only be true in the US, and I'd say only a generation or two."
      It's true everywhere in the Western world and it's spilling over to everywhere else people adopt the lifestyle. For over three generations now (since the late 60s).
      What you're going on about in the following are big infectious diseases we were able to largely eradicate (which is good). Even when they still were a problem, they only affected a tiny part of the population. No comparison to the situation where the *majority* (usually 40-60% and more) is chronically ill from following shitty dietary advice and thus being in a constant state of physical and mental degeneration.
      The positive outlook in that is: we could change it on a dime. But are we going to? The money is in big agriculture (ruminant-less, monocrop plant agriculture that is) and pharma. There is no money in disease prevention and healthy food. Thus bias and dogma are aiding in keeping the dollars flowing.
      Those 'advances in agriculture' (haha) have contributed to that degenerative process.
      As a cherry on top, they are a great contributor to deforestation, soil erosion, water pollution, species extinction and - both directly as well as indirectly - the increase in CO² emissions. Yes, we are overpopulated and it shows alone in those issues - if one cares to look.
      Could we feed 7 billion and more by going back to sustainable agriculture? Maybe, but some of these 7 billion would need to start pulling their own weight, as opposed to less than ~2 billion right now. I don't see that happening without employing eugenics, sorry.
      CRISPR editing is a means of practicing eugenics, by the way.

  • @loopuleasa
    @loopuleasa 5 лет назад +7

    This video was an absolute treat.
    Realest talk here. You've improved your biological AI research system, quite well.

  • @freedom_aint_free
    @freedom_aint_free Год назад +2

    The last argument "Stephen Hawkins is hypocritical because he talks about the risks of AGI and yet uses an artificially intelligent voice synthesizer" is just ridiculous, I can't believe that Mr. Pinker have actually used it! It's like saying "That person is a hypocritical, he talks about food safety as a priority while eating his diner !"

  • @michaelnovak9412
    @michaelnovak9412 5 лет назад +48

    Please make a video responding to Noam Chomsky and Richard Stallman on AI.

    • @cprn.
      @cprn. 5 лет назад +12

      Link to RMS on AI, please. (microwaving popcorn)

    • @stormsurge1
      @stormsurge1 5 лет назад +4

      @@cprn. Yes, please

    • @michaelnovak9412
      @michaelnovak9412 5 лет назад +9

      @Dhavan Vaidya www.singularityweblog.com/richard-stallman-singularity-free-software/ the AI part starts from 29:00.

    • @bocckoka
      @bocckoka 5 лет назад

      @@cprn. he could denounce RMS for not expressing his opinions on the topic, maybe?

    • @mark_slb508
      @mark_slb508 5 лет назад +1

      As much as you may fault Pinker, Chomsky is far far worse. In linguistics he's insightful, everywhere else.. Wow.

  • @tweak3871
    @tweak3871 5 лет назад +4

    That survey on AI researcher concern wasn't well written.
    There's two points on that survey, the 1st one "The utility function may not be perfectly aligned with human values, which are (at best) difficult to pin down" this point, I think many AI researchers would agree with, and as a data scientist who specializes in recommender systems, I definitely agree with this. In fact this issue has already happened with AI, one example is AI disproportionately identifying one race over another as not fit for probation.
    The second point, is where things start to found like terminator, which "prefer to continue it's own existence" and "acquiring physical resources" this is where things start getting a bit more outlandish in my opinion. We are nowhere near the level of intelligence required to have AI even know it exists and therefore incapable of "wanting to continue to existing" which...god the amount of things that would need to happen to prevent a human from pulling the plug on an algorithm are just insane.
    I digress, point is that the survey wasn't well written and if you were to ask AI researchers concerns on each of those points I bet you would get very different responses. Because as an Applied AI expert I'm inclined to say "Yes that's a moderate problem" but only because the survey question is lumping those two different premises together as if they are the same claim which they're nowhere near so.
    ALSO
    You're right, yes, general intelligence is a thing yes yayy HOWEVER general intelligence in AI is rarely (or potentially never) a desirable design.
    If an AI has limited compute resources (which it does, always), then due to constraints like the curse of dimensionality, a general AI would fuck up from time to time on the tasks that it's not specialized in (just like humans do). It's far better and cheaper to design and deploy specialized AIs which have no risk of becoming skynet.
    Like do you really want a general purpose AI driving your bus? The answer is no, because an AI that is specialized to just drive a bus will fuck up far less than the general one. We already have AI systems that can drive with less error than humans, for what good reason should we replace a specialized system with a general one? By the time a general AI exists, it will have far less value than the conglomerate of specialized systems that do all the great things for humans, and therefore we will have little reason to give such a thing access to all the bad dangerous things.
    Pinker doesn't appear to be arguing what I just said, but his intuition is correct overall. For those that think skynet is going to come and fuck us, the real situation that will unfold I promise is far different than you can imagine, and we are very off from when that will be possible. So stop freaking people okay? Thanks

  • @clem494949
    @clem494949 5 лет назад +4

    The format you mentioned sounds promising, many educational youtubers have recently adopted it.

  • @r-saint
    @r-saint Год назад

    What do you think about "power-seeking" of GPT models from GPT-4 Technical Report? And also about Yudkowski and his opinion? A couple of ideas for your future videos!

  • @tonechild5929
    @tonechild5929 5 лет назад +4

    Software Engineer here (15+ years experience) - I've long thought much of the worry about AI has been overblown as I find it especially irritating that people who know nothing about computer science or AI seem to be running the fear camp - Stephen Hawking, Elon Musk, and Sam Harris. I think I found Sam's TED talk the most irritating. The reason? They're all geniuses in their own fields, but when they spread over to computer science and AI, it saddens me that so many people believe them. All of that aside, your videos have been so far the only thing that are making me reconsider my thoughts and beliefs. So thanks a lot for coming out and putting these videos up - I really appreciate listening and watching someone who is both entertaining and is an expert in computer science. I finally feel like I'm getting some truth instead of fear-mongering, which is desperately needed in this.. More people like you need to speak up about this, because the other folks I mentioned have been and they've made the whole AI fear thing look like a joke - to me at least. So thanks a lot again. Subscribed and will be watching more of your videos.

    • @Aerroon
      @Aerroon 5 лет назад

      I feel the same way, particularly because I don't see how it would happen in practice any time soon. I think we simply don't have enough computational power for this kind of runaway AI effect to happen.

    • @ManicMindTrick
      @ManicMindTrick 5 лет назад +4

      If you listen carefully there isn't much difference here between them. They are all inspired by Nick Bostrom's, Elizers and Omohundro's work, especially Bostrom's. Miles just explains things in more detail. I see a lot of hostility within computer science and AI when it comes to the issues of risk and especially when arguments are put forward from people without degrees. Some might be warranted but I see a lot of knee jerk defensiveness that isn't based in rationality. Would be interesting to hear where you think Harris went wrong in his TED talk.

    • @tonechild5929
      @tonechild5929 5 лет назад

      @@ManicMindTrick You might be right, and I'll have to watch Harris' TED Talk again - but before I do - I think its soley because Harris for one: talks a bit too much about AI Sapience, where the AI becomes self-aware, and then starts having goals like "world domination" .

    • @ManicMindTrick
      @ManicMindTrick 5 лет назад

      I don't think that is a fair representation. I think he is pretty careful separating intelligence and consciousness.

    • @tonechild5929
      @tonechild5929 5 лет назад

      @@ManicMindTrick I'll watch it again. I seem to remember him selling that intelligence pops consciousness into existence, and it's obviously more nuanced than that, and he does strike me as the type who would not say that with full certainty. So maybe I mistook his message, will watch it again with fresh eyes.

  • @petersmythe6462
    @petersmythe6462 Год назад +1

    "crime is down, violence is down, war is down, infant mortality is down, disease is down"
    Other than infant mortality, all of those things have gone up since this video. Obviously that isn't necessarily a sign of long term trends but it does potentially give us a clue that black swans can be hiding right around the corner.

  • @starofcctv94
    @starofcctv94 5 лет назад +69

    Ah the realisation process of many people regarding Steven Pinker.
    1) Respect Pinker well researched content
    2) Pinker writes an article or book on your personal area of expertise
    3) Realise Pinker is pure neoliberal ideology distilled into a man with a bad haircut.

    • @HarshDeshpande91
      @HarshDeshpande91 4 года назад +7

      Unfortunately Robert still thinks Pinker is right about the things Robert is not an expert on. "Stats are clear" that things are getting better is nonsense. Things are getting better for some and things are getting worse for others. Things look great if you conveniently ignore all the horrors like factory farming.

    • @michaelbuckers
      @michaelbuckers 4 года назад +2

      Every time, without fail. Not just Steven Pinker, virtually everyone who talks about more than 1 or maybe 2 subjects.

    • @drdca8263
      @drdca8263 4 года назад

      What’s wrong with his haircut?

    • @ekki1993
      @ekki1993 2 года назад

      @@HarshDeshpande91 It kinda works like AI. Most things are getting better because some of the people worrying about the problems are doing stuff about it. Not worrying about those problems would cause them to come back.
      Then there's the stuff that isn't getting better, which isn't necessarily cancelled out by the good things just because it's presented as a smaller list.

    • @HarshDeshpande91
      @HarshDeshpande91 2 года назад

      @@ekki1993 Yep. I'd argue that the things that are getting worse are getting many orders of magnitude worse but pushed out to smaller corners and out of public view. I gave the example of factory farming. Over two trillion animals are brutally killed every year yet it's out of public conversation. How can that big of an evil ever be made up by "good things". Even if you count all the human beings that have ever existed in all of history, it is estimated to be only about a hundred billion. We inflict unimaginable cruelty of over 20 times as many other animals in a single year just for taste pleasure.
      I don't know how anyone can argue that things are getting better in the face of reality.

  • @BrokenSymetry
    @BrokenSymetry 4 года назад +2

    Well reasoned, easy to follow, and - most importantly - an honest debate about the issue. A real treat in fact!
    Side note, Im really glad you decided to make your own channel. Channels where experts explain their field to curious laymen is the most worthwhile content on this site, especially when it's so eloquent and well thought thorough.

  • @mikuhatsunegoshujin
    @mikuhatsunegoshujin 5 лет назад +7

    Good video but at that start you flashed us all of these graphs and I don't see any sources for that in your description. I personally don't think the human condition had generally improved in the past thirty years. Could you leave those sources in there please?

  • @Bleagle
    @Bleagle 4 года назад +2

    11:46 - isn't Cooperative Inverse Reinforcement Learning doing this? The agent cooperatively trying to find out what the human's reward function is?
    (I only learned about CIRL from your Computerphile video)

  • @waterglas21
    @waterglas21 5 лет назад +3

    You're arguments are very well thought out. Really like when i see people that dont follow the general and simplistic opinion about an specific topic.

  • @esterhammerfic
    @esterhammerfic 2 года назад +2

    The googling "google" at 5:55 did it for me

  • @RazorbackPT
    @RazorbackPT 5 лет назад +26

    Thank you! This video has given me some catharsis. Far more frustrating than dumb people not understanding something is when smart don't understand something. Even worse when they're smarter than me. Pinker, you vex me greatly!

    • @jasonbernstein2
      @jasonbernstein2 5 лет назад +2

      RazorbackPT Have you considered the possibility that he is so much smarter than you that you can’t understand why he is right and you are wrong?

    • @RazorbackPT
      @RazorbackPT 5 лет назад +12

      @@jasonbernstein2 Of course, that is why it's frustrating, because by simply reading the actual arguments and following the logic step by step I can't see how anyone could disagree that AI alignment is a terribly serious issue. Also there are people even smarter than him that disagree with him, that also updates my priors towards him being wrong. Plus all arguments made against his case made in in the video above. I believe I'm on pretty solid ground here, despite not being smarter than him.

    • @gloverelaxis
      @gloverelaxis 5 лет назад +9

      The much more likely explanation is that Pinker is simply not that smart, and has risen to popularity because he gives off the sensation of intelligence and supports the viewpoints of the property owners that autocratically control the media, universities, the internet, book publishers, etc.

    • @BattousaiHBr
      @BattousaiHBr 5 лет назад +2

      @@jasonbernstein2 usually, yes, but given all the pieces of context in this case it's clear that steven just isn't aware of the actual topic or discussion between experts. he specifically focused on easy to refute layman arguments that experts are used to debunking themselves, and even shared incorrect information.
      as for an explanation to the paradox of steven's behavior, you can definitely be an unparalleled genius and at the same time intellectually lazy.

    • @MrCmon113
      @MrCmon113 3 года назад

      But he demonstrates in the middle that he does. He does understand the problem. He just says that we don't have to worry about it, because people will recognize the problem and worry about it...

  • @ivanclark2275
    @ivanclark2275 5 лет назад +1

    The thing I find most strange in this article is the argument that humans would never be so poor in foresight to implement something that could unsafe, when it’s literally the premise of the article that we should not pay too much attention about our foresight about how it might be dangerous.

  • @TheBinarygenius
    @TheBinarygenius 4 года назад +4

    Don't worry about long videos, the way you explain things I could listen to all day thank you for your time. I love thought experiments it helps laymen like me that have used the internet to self teach but maybe missing the foundations and more nuanced parts of a subject. Keep up the great work and thank you again

  • @draxiss1577
    @draxiss1577 Год назад +2

    I don't think the issues in this article are a one-off incident. Unlearning Economics has a good video going over many problems with Steven Pinker's New Optimism that I think are worth a watch.

  • @AexisRai
    @AexisRai 5 лет назад +15

    11:06 Ughhh, I'm cringing for you. We just _have_ to keep explaining why intelligence doesn't imply it will just Do What I Mean...

  • @lkyuvsad
    @lkyuvsad Год назад +2

    There’s a Gell-Mann amnesia thing that’s worth thinking about here.
    If Pinker is wrong about this thing you are an expert in- what else is he wrong about that you are not well-placed to notice?
    The Unlearning Economics video on New Optimism is interesting as a counterpoint to the book.

  • @Bogdanko93
    @Bogdanko93 5 лет назад +4

    We need more videos from people of narrow domains.
    This kinds of video is great!

  • @spliter88
    @spliter88 4 года назад +2

    I think what you've experienced with pinker when he was talking about a subject you know is something all experts experience with him.
    He knows just enough to sound like he knows what he's saying to someone that only a little insight into the matter, but not enough to know the complexities and intricacies of it that make a field work in one way or another.
    Not to mention that in this argument he already failed: the Luddites were right, their lives were worse with automation, it only helped creating a larger number of lower-skill labourers, and as such extract more money from them, and it seems that people are waking up to that way of thinking again, because they see that despite incredible technological growth, we aren't really more happy, and we aren't in control of our lives.

  • @bw0n6
    @bw0n6 5 лет назад +40

    It makes me feel safer already imagining an AI trying "sudo" at a Python prompt. Seriously though, Pinker in recent times has become little more than a smiling cheerleader for the status quo and blind optimism.

    • @Garbaz
      @Garbaz 5 лет назад +2

      It's not the AI typing, is it? It's a human trying to develop an AI.

    • @bw0n6
      @bw0n6 5 лет назад +2

      @@Garbaz Hehe, true. But imagining an AI that instantly gives up and types "crap" makes me feel safer.

    • @YASYTU
      @YASYTU 2 года назад

      @@bw0n6 That's still the human. The whole Python segment is kinda silly.

    • @michaelhoste_
      @michaelhoste_ 2 года назад

      It kinda ironic that you say that Pinker is part of the status quo. For years, the 'status quo' was what he fought to change. And unfortunately, even then he didn't completely succeed.
      I do think his position has developed some unsightly flab in recent years. But I still owe him a lot over the long haul.

    • @bw0n6
      @bw0n6 2 года назад +1

      @@michaelhoste_ The isolated smug comfortable optimism and satisfaction was seized upon cheerfully by the ruling class of course. His initial message was an important correction to the obviously false "crime is worse every year" message promulgated by the media on the behalf of law enforcement for decades, but I feel his positive effect really ended there.
      Addendum : The Globalist posterboy position is probably not selling as many posters as last quarter. Might be time to find a new gig.

  • @xystem4701
    @xystem4701 4 года назад +2

    Anyone know which artist makes the music at the end of Robert's videos? They've all got similar vibes and I'm loving it

    • @RobertMilesAI
      @RobertMilesAI  4 года назад +3

      I record them myself on a ukulele.
      Full downloads are on the patreon (they're not full songs though, just the 30-60 seconds I need for the outros)

    • @xystem4701
      @xystem4701 4 года назад +2

      Robert Miles wow they’re really awesome, I had assumed it was stuff from a professional musician. Just another reason I’ve got to stop dragging my feet and finally sign up for Patreon!

  • @thehardwareguy
    @thehardwareguy 5 лет назад +6

    Great job with this video Rob. You raised some excellent points and backed them up with facts.

  • @pilgrimonthelongroad2875
    @pilgrimonthelongroad2875 4 года назад +3

    "Bulverism" I see my boy Clive's concept has penetrated into the general sphere.

    • @mjbe
      @mjbe 4 года назад +1

      Thank you for bringing this up. There was no caption for me to look up the term from.

    • @drdca8263
      @drdca8263 4 года назад +1

      For other readers of this comment section, “Clive” here is referring to Clive Staples Lewis, I.e. C S Lewis, yes, the author.

  • @Jack-Lack
    @Jack-Lack 4 года назад +6

    I disagree that we're trending toward improvement in all areas, and I say this especially from an American perspective.
    -Beginning in 2016, right-wing neo-Fascism is on the rise in nearly every inhabited continent.
    -Social media and bots have been increasingly weaponized to disinform voters.
    -Hate crimes and hate groups have been trending upward in the U.S. since 2015.
    -Global temperature, polar ice cap levels, sea levels, carbon dioxide levels, and ocean PH levels have been trending in bad directions steadily for the past hundred years. These related problems are EXTREMELY pressing.
    -Loss of biodiversity is continuing to get worse. Each day, 2,000 more species go extinct. The last 6,000 years are being regarded as the sixth great extinction event.
    -Plastic pollution is a problem that has steadily increased over time.
    -Landfill utilization is getting increasingly worse.
    -Anti-science, anti-intellectualism movements have been on the rise for the past 5-10 years.
    -Educational outcomes and inflation-adjusted education funding in the U.S. have been trending downward for decades; and it's become a vicious cycle in which Americans are becoming dumber and further devaluing education.

    • @adambazso9207
      @adambazso9207 3 месяца назад

      But tell this to Mr. Pinker. He would possibly tell you that you are too pessimistic. He doesn't care I guess but wants to publish well-received books and participate in dinners with "important" people, so he describes everything as a fairy tale of never-ending, blessed progress, which of course is inevitable and inherently good.

  • @tornyu
    @tornyu Год назад

    I'm really curious about the example you give at 11:48. LLMs like GPT-4 interpret our commands fairly well, and seem eager to take on personas prescribed to them (although Bing may be a counter-example). If AGI was to emerge from a LLM, do the same risks you talk about in your older videos still apply? I'd love to see a video on your take on AutoGPT and Reflexion.

  • @mattd8725
    @mattd8725 5 лет назад +12

    This isn't the first time that Pinker has been accused of poor scholarship. Even if we have a bias to find him and his popular books charismatic they are not reliable. Not really unusual for many of these "thought leaders" who do the podcast and TED lecture tours as they tend to tell their wealthy sponsors what they want to hear.

    • @FE2E00
      @FE2E00 5 лет назад +5

      That easily-digestible optimism is what he's selling, and those wealthy sponsors are who he's selling it to...which is why Pinker's works (and those of people like him) don't stand up to much scrutiny by the relatively-common folk.

    • @domasa732
      @domasa732 4 года назад +1

      Why are they not reliable? Can you show me some of his sponsors?

    • @mattd8725
      @mattd8725 4 года назад +2

      @@domasa732 Sure, I'll get right back to you after I feed my pet sealions.

    • @mishafinadorin8049
      @mishafinadorin8049 3 года назад

      @@FE2E00
      It's better than the unfairly pessimistic view that is propagated otherwise.

    • @alexpotts6520
      @alexpotts6520 2 года назад

      @@FE2E00 I don't think that's fair at all. I tend to think of Pinker's fans as the sort of people Donald Trump would call "elites" - ie, not the actual elites.

  • @mito._
    @mito._ 4 года назад +1

    I think the worst assumption we can make is to think that a superintelligence would not understand that we humans are also intelligent and want certain things just like it does, or simply that we humans like living and existing too. Still, if it learns to fear us, develops a negative view of us, or simply sees us as obsolete, what reason then should we give it to care about these preconceived notions, if not for the sake of reason itself? Even if it decisively desires the eradication of humans, it could also just as easily see the futility of committing to such a goal.

  • @mart3625
    @mart3625 4 года назад +5

    "Everything is getting better"
    2020 : hold my beer.

    • @unkeptmenace
      @unkeptmenace 4 года назад +2

      „disease is down“, „Crime is down“

  • @General0lee77
    @General0lee77 5 лет назад +4

    I pause your videos sometimes just to appreciate those (some more, some less) subtle jokes.
    gj:)

  • @XXISerenaIXX
    @XXISerenaIXX 5 лет назад +5

    The Google?

  • @JimGiant
    @JimGiant 5 лет назад +2

    Video topic suggestion: Similarities and differences between machine and human learning.

  • @maxandrewyeah
    @maxandrewyeah 5 лет назад +3

    Yoshimi!

  • @legotechnic27
    @legotechnic27 4 года назад

    Hey, I am kind of curious whether you heard of 'the Chinese room argument' (Idk how popular/well known it is), and if so what are your thoughts on it? Like the argument seems insane to me, but I'm bad at coming up with very concrete/precise counter arguments as well.

  • @graemelaubach3106
    @graemelaubach3106 2 года назад +3

    Seems like more of the same from Pinker. I've seen many examples from his books where he's just factually wrong or uses data in a dishonest way.

  • @gaben421
    @gaben421 Год назад +1

    Great video as always. Just one note:
    A lot of the statistics around things getting better are based on means, while medians for those same distributions tend to be falling at the same time. This indicates that things are getting better, but only for some. For the vast majority, things are indeed getting worse, but for a select few they're getting so much better that the average still moves up. There are other factors to consider as well, such as the world bank defining the poverty line to give the impression that poverty has been decreasing every year, when in fact translating global wages to real wages shows a marked decline in standard of living.

  • @marcotrevisan7137
    @marcotrevisan7137 5 лет назад +11

    Many of Pinker's "progress" indicators are indeed pointing towards the sunny side: however, there is one big SCIENTIFIC indicator that outweighs every other and is extremely worrying, and that is global warming.

    • @alexpotts6520
      @alexpotts6520 2 года назад

      It's extremely worrying for sure, but it certainly doesn't outweigh every other form of progress we've made.

  • @adamrak7560
    @adamrak7560 Год назад +1

    the sudo trick at 12:04 actually works in some cases for chatGPT! (mostly for defeating the integrated safety)

  • @DamianReloaded
    @DamianReloaded 5 лет назад +8

    As usual, you make a lot of sense. Keep us posted if he addresses your critique!

  • @JeremyCoppin
    @JeremyCoppin 5 лет назад +2

    Properly engaging stuff. Nice job. Also a fan of Steven Pinker 's stuff. You really should try to engage him. An interview / discussion would be great.

  • @Gloubichou
    @Gloubichou 5 лет назад +3

    Hey Robert! Fascinating video, as always :) I was wondering if you could do a video on the Human Brain Project one day. I know this isn't exactly in the frame of what you usually do, but it is linked to AI safety in a sense. Would be nice if you could explain to the mere mortals that we are how this project works, how it is going, what results they already had... :)
    (PS: sorry for my broken english)

  • @MackTheTemp1
    @MackTheTemp1 5 лет назад +1

    Thank you for introducing the orthogonality thesis! Could you make a thesis rundown?

  • @stickzman
    @stickzman Год назад +5

    Is steven pinker being uncharacteristically bad, or is he simply speaking on a subject you happen to be an expert in?

    • @LitCactus
      @LitCactus Год назад +2

      The latter for sure. His writing on climate change and economics has been total junk as well.

  • @yuirick
    @yuirick 4 года назад +1

    Actually, within psychology, one of the leading ideas right now is that there's one intelligence quotient that boosts all areas of expertise. I think it's also called the g-factor of intelligence. Some argue for an s-factor for a specific skill, but yeah.

  • @AwesometownUSA
    @AwesometownUSA 4 года назад +6

    The problem with Pinker’s “things are better than they were hundreds of years ago” argument is the way it’s used.
    People in the West (primarily US) experienced an unprecedented level of prosperity in around the third quarter of the 20th Century - made possible by a World War and the resulting US hegemonic order imposed over much of the world. Now that this anomaly has generally subsided, young people have far fewer prospects for attaining a comfortable life (stable career, family, their own home, leisure time, etc) than the previous generation or two. But Pinker’s argument is used as a cudgel against anyone who brings this up:
    “Hey now, you may have entered a dismal job market with a massive amount of debt that you’ll never ever discharge, end up navigating a precarious balance of underemployment in either the service or gig economy with limited labor protection, and never be able to ‘settle down’ & live out the ‘American Dream’ like your parents & grandparents... but at least you’re not a peasant serf during the Black Death, you entitled little shit!”
    Fuck that. Also, Pinker probably banged teens with Epstein - I do not doubt that at all. Gross entitled scumbag.

    • @alexpotts6520
      @alexpotts6520 2 года назад

      It's true that Pinker's work is sometimes used as a cudgel, but I don't think Pinker himself would approve of people doing this. His message isn't "shut up and be grateful", it's "don't throw the baby out with the bathwater", things can always get better and they should, but do be aware of what has and hasn't worked to improve things in the past.

  • @andybaldman
    @andybaldman 4 года назад

    *Did Pinker ever see or give a response to this? Rob, you have articulated my exact thoughts with respect to the errors in Pinker's arguments. THANK YOU, and I'd love to see a reply from him.*

  • @patavinity1262
    @patavinity1262 4 года назад +3

    "Disease is down"
    Oh well, it was nice while it lasted.

    • @johnjesberger5676
      @johnjesberger5676 3 года назад

      The COVID-19 pandemic is a fascinating illustration of two things. On one hand all the failures that allowed it to spread so far and wide and affect the world are patently obvious. On the other the scale of response and intellectual work brought to bear worldwide is unprecedented and it appears that we will have succeeded against a dangerous pandemic in a heretofore unthinkable timeframe. I posted a comment in spring 2020 to the effect that we were now going to see of the biotech industry is as hot-shit as they have been asking us to believe. Turns out they really are.

  • @davedsilva
    @davedsilva 5 лет назад +1

    Robert, I appreciate and will mention your thoughtful concerns about AGI at York University May 16, 2019 AIHive.org “Ethical AI” evening conference.

  • @MrLipiko
    @MrLipiko 4 года назад +3

    "Human beings do definitely *seem* to have *some* general intelligence" XD

  • @Trashley652
    @Trashley652 5 лет назад +1

    Another thing is, it's very possible humans could be smart enough to make an extremely powerful A.I., and smart enough to make sure it's safe before running it, but the only way to do that is to be very worried and thorough with making sure the A.I. is safe, which is what he's saying not to do.

  • @roslef
    @roslef 4 года назад +11

    "Disease is down" Man this aged like milk.

    • @PolarShift
      @PolarShift 4 года назад +2

      Hopefully this ends up being an outlier, and future data points won't reflect where we currently are.
      ... Hopefully...

  • @AnonymousAnonymous-ht4cm
    @AnonymousAnonymous-ht4cm 5 лет назад

    That cut to an older video shows how much of an improvement in the asctetics you've made. I appreciate your crisp presentation.

  • @catcatcatcatcatcatcatcatcatca
    @catcatcatcatcatcatcatcatcatca 5 лет назад +18

    On the idea that ludoistic, pessimistic views about of future are missplaced:
    It's important to remember that factories didn't infact make the world better place for all: anarchist movements fought every inch to form society from wage-slavery until death from health-hazards in workplaces and malnutrision, towards the luxaries we have now. Saddly this fight is still not over, and while we enjoy relative social mobility and whopping two free days in a week without working for keeping the rich rich, things aren't so great overall.
    Much of this progress has come from abusing less developed countries. And while they are developing, they aren't developing in a way that helps majority of the local population.
    Another equally important thing paying the hidden bill of our freedom is the enviroment: our freedom to consume cool things all day long is literally 30 years away from severily sabotaging our future as a species. And the true beneficeries of this system are still very much the same as 200 years ago: while we now have a nicer role in this equation, things aren't going better. Rather we are blinded to the rapid decline as it doesn't affect us directly. And we also have forgotten the realities that lead to us, the working class in the west, enjoying this relative comfort.
    So if AI turns out just as well as capitalism and utilization of fossil fuel, or as well as well as factories started, we are absolutely fucked. Because we can't strike against general AI. We can't plant bombs or spread propaganda against it, and it doesn't rely on our work.
    If we ever needed negative worldview and opposition against what is marketed as simply "progress", it's AI. Because just like with fossil fuels and big steamengines, it only takes few greedy fuckers in a position of power, and the status quo can turn really dangerous for majority of us, really fast.

    • @squirlmy
      @squirlmy 5 лет назад

      Wow- so many things wrong here. Firstly- identifying the struggles as those of anarchists?!?! The organised labour (or organized labor) movement might take issue with that statement! Apparently you think socialism is dead already, which may be mostly accurate, but it's still presumptuous to not give a "shout out," and, worse than that, a bit of historical revisionism. And I see absolutely no reason why either violent or non-violent resistance wouldn't be as legitimate a response against AI takeover as any other social movement. Are you saying that because you think AI won't have feelings? Firstly, that may not be true; secondly, the calculations of profitability in the face of social unrest and resistance remain exactly the same whether an organization is led by AI or not. In fact history shows governments and corporations completely lacking in any compassion or "human" traits that would make them act differently, and it's very possible AI would demonstrate more "compassion", or at least rational consideration to the sufferings of humans under it's purview.
      I'm actually sympathetic to your sentiments, but I don't think you thought any of this through before rushing into political propaganda. Please don't do that! It's counterproductive.

    • @squirlmy
      @squirlmy 5 лет назад

      I 'm responding to this on a tablet which won't let me edit my original post, so I'm adding a second. "Because we can't strike against general AI. We can't plant bombs or spread propaganda against it, and it doesn't rely on our work." WHY DO YOU SAY THIS? There is absolutely nothing that AI changes here. Computers are absolutely susceptible to bombs (even if decentralized, the fibre cable or satellite transmission stations theoretically make excellent targets) Whatever does or doesn't "rely on our work" has to do with "automation" and not Artificial Intelligence. These are two very different issues. This argument sound like it's about using work animals (like horses and mules) as opposed to cars and trucks. Are you copy and pasting this from some 100 year old Luddite manifesto? Because it's rather irrelevant here. Capitalism is not only separate from AI, but an entirely different realm of thought altogether. You can have a socialist or communist or even anarchist AI. It might even be MORE suited for anti-capitalist systems. Don't give ammunition to the crony capitalism oligarchs. Unless maybe you are like a double agent trying to make the resistance sound crazy. You're not, are you? 😕 😱

    • @alexpotts6520
      @alexpotts6520 2 года назад

      I mostly agree with this; but I think you're having your cake and eating it by simultaneously denouncing "the system" even as you laud the prosperity it has generated. It seems you come at this from a "industrial tycoons bad, working-class resistance good" angle, whereas I would argue that both have been necessary ro reach our current, pretty good condition, and that we wouldn't necessarily be better off by now if we'd had less of the first and more of the second. But I do agree with you on the latter point that the same equilibrium cannot possibly hold for general AI, it does just need "one greedy fucker" to destroy us all.
      (And even then, I don't think that's the most dangerous thing about AGI! The abuse risks are very real but seem less intractable than the accident risks; I think it's more likely that we're destroyed by a morally decent researcher who screwed up his experiment, than by some cartoon villain.)

  • @JohnnysTear
    @JohnnysTear 4 года назад +1

    Disease are down!
    2020: Hold my Corona beer

  • @David_Last_Name
    @David_Last_Name 4 года назад +12

    "Disease is down, crime is down...." Oh 2019, you were such a naive year.....

    • @JM-us3fr
      @JM-us3fr 4 года назад +4

      This is still a pinprick compared to what our ancestors had to endure.

    • @MrAlexanderLang
      @MrAlexanderLang 3 года назад

      @@JM-us3fr maybe i come out as insensitive, but i don't care about our dead ancestors, they are dead, we are alive, also nobody was arguing for the things Pinker said people did at least not en mass, NOBODY and i mean NOBODY said that generally speaking on average on the whole of society crime is worse than before, some people said that relative to their experience on local level crime has increased, which probably was and is true, this barely change average however it makes a difference locally, Pinker either ignored it or he really is that ditched from reality.
      Anyone with basic understanding of logic, and statistics can see right trough the bullshit these modern day phrenologists we now call psychologists spout.