My favorite part was when he asked, "Should we create animals for our entertainment." While putting a picture of a flipping pug in the back ground haha
It’s a good question. Pugs are foul abominations that humans bred for our amusement and enjoyment with no regard for the animal. Why not a Dino chicken.
@@darrylwayne1292 exactly I personally feet bad for pugs even though I personally don't think there ugly. There flattend snounts can cause serious health problems yet people still say look at the dumb ugly animal. We made it that way.
@@Supergecko8 well the secret blend of herbs and spices could be cretaceous DNA, I have seen Popeyes chicken and I think they are closer to the perfect chicken leg size, we just need the funding.
@@Dillon-bl3dz duhh really?????? Of course it’s not but my point is why even speak about ethics when we have made chickens go from baby to adult in less then a month and keep them chillin in fridge waiting to be eaten it like saying is it ethical to make trees that grow to full size in one day and then you go outside and just cut down a forest
"Should we create animals for our entertainment" I mean...look at Pugs, wtf else was that thing created for? Ah...well you did hit on that, I agree a lot of domesticated animals are messed up, so it's unfortunate that they are still bred.
One major difference between the chickensaurus and the pug. With the pug, the goal of the squashed in face IS the feature that causes suffering, while with a chickensaurus it is not obvious that any of the goal features would cause the animal suffering.
I’m really glad that your brought up breeding pets that we know will be sickly, because this is already relevant, and should have been widely discussed a long time ago.
I’m pretty sure I can speak for a vast majority of people when I say Jack and his team should just stop beating around the bush do what we all are thinking: use cassowaries instead of chickens. Come on scientific community, what are you? Chicken? Oh wait...
This makes me think of something my mom told me when I was rlly little and she was teaching me how to properly hold a rabbit “Remember this is an animal not a toy” I think the same concept can be applied here.
Why here, but not with most things in life? Most things that are not normally considered "toys" are very much considered toys by millions of people. Cars, audio equipment, cameras, weapons, etc. I agree in principle, but your logic is very shaky.
Me: "Direct genetic manipulation is comparable to opening Pandora's Box-we're probably gonna regret it." Also Me: "Dinosaurs and cat girls are by all means worthy of pursuing."
My question is, would the cat girls have human rights? Because if so then any weeb probably wouldn't be able to get into a relationship with one anyway.
You can find pugs cute, but still recognise that it's unethical to breed them. The damage has been done, but it can be undone but just mixing dog breeds again, so we need to make people stop caring so much about "pure-breeds", so that in the future, someone will just want a dog, any cute and healthy dog, rather than specifically a pug.
Morals are always a grey space in arguments like these. They change depending on too many factors. There will always be someone who thinks otherwise when it comes to questions like this.
No, no, no, you're all wrong... What we need? Isa *Cassowarisaurus*. Or a Cassoraptor. Cassowaries are terrifying, and are already very dangerous and territorial in the wild. Imaging making them *more* lethal!
Why not a turkey? Why not cross a turkey with a dinosaur ? Well judging by the majority of recent American presidents I strongly suspect that it's already been done.
It's the opposite XD Your scientists were so preoccupied with wether they could, they didn't stop to think if they should. Well, of course in real life, there's low chances that our scientific hubris came back to destroy us XD
@@krankarvolund7771 low... The problem is what people does with science, and what scientists allow people to do. And by that I mean that sometimes things shall stay unknown, if humanity isn't ready. Wait, not unknown, as we know consequences of many things by now. Scientists has already tried much of those stuff, as Trey rightfully stated. Is just that some things are pointless to do, you would just create monstruocities for no other purpose than see what you already know it is wrong. And if you don't know it is, go check old experiments and stuff. Life is something very delicate to deal with, it is just finally the time scientists are going to use more their brain on what they do before they do it, instead of having to always find out what they've done is damn bad after they've done it
@@krankarvolund7771 They weren't trying to make the quote from Ian Malcom. They were saying that scientists, instead of just going ahead with something that poses little to no threat, think about if the should do it. This has been an official r/woosh moment
Genetically engineered cat girls would, funny enough, be technically classified as a person in the US (Amendment 14, Section 1, Equal Protection Clause)
I'm still confused over what a genetically modified catgirl would even really be. Like, you take the cat genes and you make a person with a furry tail and head-ears, I guess? But this isn't anime, it's real life, so you've basically just taken a normal person and made them completely different without their permission for what? Just to get a tail and do something that can be accomplished with some bangs and a $20 cosplay hairband. It's like, there are pretty glaring concerns to be had with turning someone into a fetishized fantasy race against their will.
@@dracocrusher 1 - they would be newly born. people don't have a say with regards to being born. 2 - the most concerning part is the deformation of the skull and the new shape of the brain due to the ears being in a different place. it most likely would turn up to be some kind of lion looking monstrous abomination, like in the movies when they say "they used human DNA" (the creature comes to mind, which was a dolphin-shark hydrid with human DNA, and jurassic park).
"Before you even knew what you had you patented it and packaged it and slapped it on a plastic lunchbox, and now you’re selling it, you want to sell it." Yes i want dino-chicken
I owned a pug and I really cant explain I felt like an asshole I felt like this being could have such an easier time you can hear them having trouble breathing over the most minute thing it's kinda depressing
Please don't stop working on your videos. Your Voice and way of speaking is like a massage for my brain. .... And the topics are really interesting and well researched. Please don't stop. :)
Well the living members of the ratite family probably have a few suitable species we could start from (like the cassowary, emu, ostrich ect), go back one generation at a time taking it relatively slowly to allow for more successful results, I believe it could work
fatmelon jurassic park's dinosaurs were always too big for their actual size And the t rex skull aint accurate the jaw needs to be a bit thinner And the hands were pronated in a wrong way So i wouldnt say it was accurate for its time because we already knew this stuff
@@xanderomeister7828 most of the jp dinosaur was pretty much scaly tho,trex had protofeather covering its back but most of their body was covered in scale.yeah,they had 2 fully feathered dinosaur which is gallimimus and velociraptor and screwed it up real bad but most of their dinosaur was accurate scaly-wise.
Well it's not a movie but you can check the game prehistoric kingdom it features really cool more scientifically accurate prehistoric creatures and is in general a really awesome park/zoo builder game to check out!!!
ohhh only the first couple. Version 2.0 will look cool and taste great fried. Colonel Sanders is gonna love chickens you dont have to pluck before you cook them.
"your scientists were so preoccupied with whether or not they could that they never stopped to consider whether or not they should" -Ian Malcolm, Jurassic Park
@@shaggyspade2468 I don't even see the cuteness in a pug. Like, even if they didn't suffer from all their malformations, I find them ugly as fuck. Looking like a cartoon that just got hit in the face by a frying pan. Now a wolf, that's a beautiful animal right there.
I would absolutely love to watch a full-length video about someone considered "The Tiger King of Paleontology". That sounds like a wild, chaotic fun flume of a tale and I would want to be all in on it.
That had a completely different methodology though, it was basically just taking the biggest, beefiest, meanest cows in the world, getting them to fuck and seeing what happened. In fact it's a still ongoing experiment as the Pleistocene Park in Russia and several smaller rewildening projects have proven the current Eurasian ecosystems are missing a large herbivore grazer because we, humans killed them all. Rebreeding cows back into Aurochs and reintroducing them could have a ripple effect on the landscapes they're reintroduced to. Just look at the Pleistocene Park, what was once barren tundra has now become grasslands under the influence of the large grazers they've reintroduced.
Wasn't it "succesfull", atleast they got what they wanted, and they where only made because Göring (head of the German Airforce) wanted to feel like Ceaser, and they where Nazis so there is that
@@124Andro we have learned so much about genetics in the past 80 years. I think that de-extincting some of the megafauna that we may have had a hand in pushing over the edge is a noble endeavor.
I love how much you focus on ethics alongside science. The two are certainly interwoven and should always be discussed together like this. Great writing.
Oh Trey the Explainer, could you allow this humble viewer to subtitle your old videos like the Beast of Gévaudan so I can show it to my mates and people around the world can show it to their mates that too, like mine, do not understand the english language? Thanks in advance, oh mighty Trey the Enabler of Subtitles. Oh and nice intro animation, so cute!
Even from an ethical P.O.V there's a good chance the chicken will feel fine, the only way the project can turn out negatively for the chicken is if mutations occur but since this is a first time project, mutations indeed are likely but mutations need not always be bad, most mutations don't affect organisms much so there's a small chance that a major mutation can take place and the chicken does suffer. If a mutation does not occur the chicken will live life normally as no changes would be made to the existing organs or organ systems, I don't think it's unethical if the chicken is not hurt.
I guess it depends on how severely these atavisms will effect the chicken. If in the end it looks like something you show in 11:00 and it can live fairly normally all atavisms considered, then I don’t think its that bad, especially when looking at what fucked up breeds of chickens there are out there. And maybe we’ll learn something in the process. But I am not a fan of adding genes from other species, which as you say, pretty much undermines the initial research goals.
I agree. Heck, an ambitious breeding project just to breed longer tails and maybe teeth (or at least teeth-like structures) with the birds through careful selection would be better than introducing genes from other species...
We created chicken with blue skin, black meat, 5-6 toes (silky chicken). Could we breed a tail out? Well what's more plausible, blue skinned bird with black meat or bird with boney tail?
I completely agree. I am all for turning the genes on and off to make a dino chicken. We could learn a lot about it's evolution and even find new things out that we can't conceive of yet. But I don't like the idea of just making a chimera. I think it's ultimately pointless. I think a chicken with teeth, a tail and fewer feathers would get the job done both scientifically and aesthetically. And that creature could still function like a normal chicken. I raise chickens. They already hunt in packs and rip mice apart for food anyway. I really don't see it making them "more dangerous" I raise my birds from eggs and they love me and I love them. They are already smart and vicious with their prey and intruders. They are just missing a few things! All in all they really are little dinos. When you look into their eyes is when you see it the most. Anyone who raises large breed chickens will tell you the same. They are a LOT cooler than people think!
Some of the reasons why they are adding new genes in, is because over the generations, genetic information is lost. An example would be the enamel for their teeth. While they turned on the gene for jaws, they couldn't for tooth enamel.
@@veneficus582 It will still be half an elephant as it will still inherit some genes of it's mother, plus since mutations are very likely it'll probably be deformed.
When you mentioned a mini elephant as an example of novelty animals I remembered that a mini elephant appeared in Jurassic park as a Ingen fundraiser! Nice reference. Keep up the cool cat content.
I feel like Mammoths or Thylacines or Dodos are the first creatures we should recreate. Not as some way to disprove someone or play god but maybe as a way to acknowledge our influence on the earth’s biosphere and work to make our impact beneficial over destructive. Bringing back recently extinct species could acknowledge our awareness and sort of prove our separation from the idea that we are a violent invasive species that kills everything we make contact with.
Or just humans with furry hair rather than normal hair. A few furries might be happy but the cat person will have to live his life that way. Not that it would be bad but he wouldn’t be the same as everybody else. Which means racism and such.
I think we can draw a fairly clear and simple line in the sand. So long as it's possible to breed an animal that can live a feasibly torment-free existence and is capable enough to at least be able to attempt to live on its own, we are clear for chickensaurus.
A catguy, Ph.D in the year 3000: Let's reverse engineered catmans Some VRTuber: Should we do this? The comment section: He's trying to make us into humans, disgusting
@HempMasterNinja You probably are just mad because Dr. Malcolm advocates that the Dino's in Fallen Kingdom 2 - I am NOT putting Jurassic in front of that because that would just insult Jurassic Park l which was a fucking classic - should die when Isla Nublar's volcano wipes out the island. And I agree with that. EVERYTIME dinos and humans were " thrown back into the mix" countless people were killed or eaten, because Hammond wanted to give people something amazing that was real, that they could touch etc. And what happens? Oh people start either try to poach these constructs for two other parks or they are twice attempted to be use their DNA to make worse monstrous killing machines. And then a cloned CHILD was like there like me, clones, I'm going to let them live and releases breading dinos on North America So tell me how that's beautiful for the world when they are now the new Alpha predators replacing us on the food chain ?
I think the point of this video was not just the opinion, but to question all of the things he implored us to question. Are the already modified organisms we've made ethical? And what constitutes what is ethical to us and what is not? And he ends the video pretty open-mindedly, too -- "perhaps you can convince me otherwise." I appreciate that!
I think it is very considerate of him. He puts down all the information and lets us decide for ourselves. It's also respectful towards Jack Horner, even if Trey disagrees with him.
@@rokukouexactly. this guy us amazing. im normally only mildly interested in the topics he speaks on, but hes so enjoyable to listen to, ive been learning so much about dinosaurs and the bible and the related sciences lmao
I’d love to see a chicken Rex, but I’m firmly on the side of it having more risk than reward. Though How to Build a Dinosaur is genuinely an interesting read. I read it at 13 and still find it fascinating nearly a decade later.
@@koninggijsnlGames Damn me too. People complain about this but then they just say cute at things like the bubble eye goldfish and pugs. I feel either swing one way or the other. And looking at how the meat industry treats chickens, this sickly chicken would live a far better life than most of them.
@@derpychicken2131 You actually make a good point, I didn't think of that. It would most likely live a much better life and who knows, maybe it won't be as sickly as we think it will.
Its the same thing. Wobble head breeding, pug breeding none of these are ethical. We donot need those changes for practical reasons. Just making some creature's life miserable for fun is never ethical
@@nulliusinverba7732 people breed snakes to look a certain way and sometimes the breed or whatever its called is so inbred and they bob their heads and are often upside down cuz they don't know up from dowm.
@@nulliusinverba7732 Spider morph ball pythons, I believe. The 'spider wobble' is a neurological problem in this specific morph/pattern of snake and it makes them, well, wobbly. But not like 'oh cute he wiggles' wobbly, like, 'oh look he flipped himself upside down and slammed himself into a wall, and he can't eat' wobbly.
To be fair, I would imagine the life cycle of a chicken is much shorter than an ostrich, so it could be more practical for a scientist to start with that organism first.
Why would he start with an Ostrich? We're still at the experimental stage. A chicken is cheap and can grow to maturity in a matter of months. Suppose his Chickenosaurus project succeeds, then he can move on to an ostrich.
OMG I just tested positive for BRCA-1 and had extensive removal surgery remove the affected tissues. In listening to this video while 6weeks into recovery! It was cool to hear about it at such a time!
Listening about how the production of insulin has been streamlined I couldn't help having a negative feeling about the fact that it can be produced much cheaper and yet people are still having to choose between rent and insulin. That's the part about genetic engineering that isn't good enough for me. I don't expect companies to not make any money and I'm not anti capitalism however I think the subject of access should be part of the decision making progress in drug development, gmos etc. All of it really, it's the business side of biotechnology that really sucks sometimes.
It's a type of information technology so will spread and get less expensive with time. Just like pirating computer software or entertainment, pirating genetic creations will continue to become more accessible. If the corporations are not playing fair they will end up dealing with a strong black market.
And it's not actually that expensive. Here in the Philippines one vial of insulin costs about $10 USD retail (and there are programs to provide discounts and help for poor people). If the Philippines can do it, why can't the US?
17:30 implying these mices and chickens would otherwise have had a good life? The vast majority of chickens on earth cannot move their limbs much more than this genetically modified mouse can, unfortunately
Yes battery turkeys are so massive they can’t breed naturally and have been modified so they grow quickly and put on weight quick so you end up with a suffering bird with tiny legs and a massive body. What has humanity done to the natural world?
@@zliu4208 But this one is for science. Besides the first few batch will be invalid but likely quickly killed, sooner or later they'll perfect em. Its really only a matter of time, even if we wait 100 years for us to perfectly and painlessly engineer em for our tech to catch up.
"should we create a dino-chicken?" the answer is clearly yes, but we do need to treat it ethically once we've done it. We don't wanna Malcolm it, after all
On the slice about GMOs, the term has always bugged me since, every time we reproduce, we’re kind of genetically modifying ourselves. But the agricultural modifications we’ve made genetically alter our food. 🤷🏼♀️ it’s always seemed like a redundant phrase.
I know Jurassic Park isn't the most scientifically accurate movie out there but what that Ian guy said was right: dinosaurs are probably not suitable for today's ecosystem. If we do bring back a dino we shouldn't bring more than one back. Also im scared of dinos
In the mobile game Temple Run 2, there is a bunch of bizarre fauna, including a "dino chicken". The description is just "it shouldn't exist, but it does."
@@gabriel9132-q1x id like to uh.. tell you to not go for birds then. Theyre oppertunistic. We had finches in my parents house, and they would attempt to steal fried chicken off of plates. Several other species are the same, id reccomend maybe get a crested gecko or maybe an aquatic snail. (Minus Assassin Snails)
Feynman was the man! I remember in a lecture someone was trolling him about anti gravity devices A.K.A U.F.O's he pointed out that the man was using one in the form of the bean bag he was laying on LOL
The Chickensaurus is the project that inspired the Indominous Rex isn't it. This man is literally John Hammond down to his look, all that's missing is a piece of amber on his cane.
I doubt Disney had the presence of mind to critique the Chickenosaurus project when they were making Jurassic World. Those films were written to be pure money-milkers and offer nothing in the way of intelligent commentary.
honestly cat girls in reality wouldn't be cute they'd probably be deformed genetically modified humanoid monsters with cysts tumors, every single health problem known to mankind, and begging for somebody to end its life. Just stick with dinosaurs and unicorns. No human genetic experiments unless its safe and it directly benefits our physical health like bio-engineering cells that could detect and kill cancer cells in our body.
@@derpherp1810 Absolutely, if the development is focused solely on the cat girls, but it would be unlikely to be so, since there would need to be a lot of work done on genetics, if nothing else knowing where the "ear" genes are located would necessitate us to understand the whole genome, or we'd get a cancerball. And that could lead to great advances in medicine. But yes, human testing should be left alone until we understand the field well enough. And even so, they'd most likely look worse than the cats from Cats (2019)
@@sokogekigoji8299 do you think that in most of the world they won't be given protection under the law. In all reality I see them being closer to adoption of a child (and if done by a university or a small institution with more protection) not developed as sex slaves.
well .... Main body:Human , with add on genes of a cat Main body:Mouse , with add on genes of a snake So pretty much if the snakemouse has any of the problems then likely catgirls will as well , if the snakemouse dosnt have that type of problem then catgirls should be fine as well. However i wonder why do people want catgirls so badly??? , i for one at lest agree that mammoths and other large ice age herbavore might infact be good to bring back , its a long story but it has to do that without them the trees are overcrowding at the ice cap areas and heating the area up , so at lest we have a good reason to bring them back. but catgirls? and dinochickens? like what is the main reason to bring them? and a other thing to note , what if there is no problem with the catgirls health , would they be counted as slaves? and even if all that problem is ok with all catgirls and humans having a good live toggether , the people making them , they could be using all that money to make some sort of horrible killer monster just for fun , as in jurrasic world style , trying to make the biggest scariest evilest dino ever just to make a show and boom backfires...
@@derpherp1810 depends how you make them, when you try to make a chimera, it might work. Just saw a interesting video on how to do that on the channel "sandman" one of the recent videos who talks about cats ladys
17:53 - Thanks for talking about this subject. Most people either steer clear of this topic publicly or just default to the opinion that it's not something even worthy of thought somehow and I think that's really unfortunate.
@@rubenb8653 Why? i get it if the chicken suffers, but why does the chicken care if she looks monstruous. If the chicken doesn't suffer and the "failed attempts" are ended without suffering of the animal, why is it sadist??
@@youngspinach you eat the chicken, in a world where people are hungry you can be sure that we need the chickens to survive, we don't need a dino chicken
I want to see real life cat girls, despite ethics thrown out the window as. I want to see a legitimate real life anime trope. Though if people would want to pound Cat Girls, would it be unethical as Bestiality or the lack of consent?
We’ve got a real life John Hammond on our hands Also I’d rather see us bring back Thylacine or other animals that went extinct mainly because of human stupidity
The problem with that is the same problem as bringing back any other extinct animal, the ecological niche either no longer exists or is filled by some other animal.
@@Bob-bs9ok Except it actually isn't in the case of the Thylacine, at least not on Tasmania itself. In the case of many island dwelling species the introduced species that "substituted them" are generally more harm than good anyways.
Kim Inseong Plus, any chicken nuggets I’ve ever eaten had Pterodactyls. My mom always got the cheap ones from aldi though. Maybe the expensive ones could afford to use all land reptile meat?
He turned a chicken into a dinosaur, the funniest shit I have ever seen
He calls it Chickenosaurus
you mean he turned (no?) a modern dinosaur into a so-called non-avian dinosaur (not, see the tail issue for example)
You've won, this is the most creative reference/joke here.
Comment: funny
Replies: akshtuuuully (actually)
named him "dino chicken" funniest shit I've ever seen
My favorite part was when he asked, "Should we create animals for our entertainment." While putting a picture of a flipping pug in the back ground haha
It’s a good question. Pugs are foul abominations that humans bred for our amusement and enjoyment with no regard for the animal. Why not a Dino chicken.
@@darrylwayne1292 exactly I personally feet bad for pugs even though I personally don't think there ugly. There flattend snounts can cause serious health problems yet people still say look at the dumb ugly animal. We made it that way.
People created something ugly and think it's cute
@@introvertion6460 yeah
@@introvertion6460 it's not cute, it's funny, people love to laugh at ugly people
Scientists "but what would we gain from this?"
All non-scientists "a cool dinosaur chicken.... Are you even listening to us?"
Better KFC
Bjørn again Christian underrated comment
true
@@Supergecko8 well the secret blend of herbs and spices could be cretaceous DNA, I have seen Popeyes chicken and I think they are closer to the perfect chicken leg size, we just need the funding.
But it wont even look cool
"is it unethical to make a dino chicken"
*takes a bite out of chicken sandwich
*takes a bite out a dino chicken nugget*
Delicious
thats what the dino chicken is gonna be when released
I dont think thats what he means...
@@Dillon-bl3dz duhh really?????? Of course it’s not but my point is why even speak about ethics when we have made chickens go from baby to adult in less then a month and keep them chillin in fridge waiting to be eaten it like saying is it ethical to make trees that grow to full size in one day and then you go outside and just cut down a forest
“Oh boy it’s 2020 I can’t wait for my chickenosaurus!”
[Coronavirus]
“Aww”
Coronasaurus
AIDEN the psycho AI well u got something
I want a 🧑🏻🐻🐷. 😂😂😂
Baby Yoda what the
I want to taste one. I don't GAF about feeling one, I just want to eat it.
"Should we create animals for our entertainment"
I mean...look at Pugs, wtf else was that thing created for?
Ah...well you did hit on that, I agree a lot of domesticated animals are messed up, so it's unfortunate that they are still bred.
@Jeremiah Olson Not what I was gonna say, but you may have a point there
shine in the dark goldfish doesn't sound unethical. common goldfish have face tumors.
One major difference between the chickensaurus and the pug. With the pug, the goal of the squashed in face IS the feature that causes suffering, while with a chickensaurus it is not obvious that any of the goal features would cause the animal suffering.
@@Devin_Stromgren
Exactly!
Screw the ethics I wanna boop the snoot of a pet Dino And no god can stop me!!!
Screw a dino-chicken, if we want it to be truly impressive we need to make a dino-emu. They're already basically dinosaurs anyway.
We could try a cassowary but, really, I'm not confident that any laboratory could contain it.
Dino Cassowary
@@ItsButterBean1020 u mean Dinowary?
That’s what I was thinking 😂
D I N O S H O E B I L L
I’m really glad that your brought up breeding pets that we know will be sickly, because this is already relevant, and should have been widely discussed a long time ago.
I wonder if we could use CRISPR to undo the flaws from such breeding, by using genes from wolves or healthier dogs.
@Andrew Caulfield or just stop breeding dogs that are known to have big issues
yeah i think breeds like pugs for dogs and persians for cats should be outlawed personally
“Should we create animals for our entertainment?”
Ummmm,
*looks at all the different species of pets in existence *
people mutant pigs for meat,treating them inhumanely and called them stupid unclean creatures. human logic 🦧
@@zhumiss7054 not properly cooking their meat and then banning people from eating it because they got sick. human logic
@@siyacer not all of us are dumb
@@siyacer sand people always were special
i mean, most people have kids for entertainment
10:33
*BREAKING NEWS*
*Funds for the Chickensaurus project were all transferred to "Project: Catgirls"*
Elon Musk would be proud
Obviously the correct choice!
Ooooooooohhhhh that's how Cool Cat exists
Cat with human ears is clearly a better idea, come on people.
But we would need to modify thirty two individual muscles for cat ears
Who cares about dinosaurs. We need to bring back pre-Cambrian goo creatures
Unfortunately physically impossible unless we like, reevolve them from the ground up or something
Cambrium explosion 2!!!!!
Let's create a copy of first life and boost its gene mutations and let it evolve it woud be interesting to see evolution but fast
No no no we don't need another Evangelion
*I DO* _I do.._
"I'm sure it's a dream every child once had"
Bro, I'm 29
You can never be too old
Every adult that grew up adoring the Jurassic Park franchise is likely wanting this to happen.
Gallusaurus would be a more accurate name, given the domestic chicken’s scientific name is Gallus gallus domesticus.
Galli.... gallimimus!
Extreme Madness Are those meat eating...uh...Meatasauruses
Dr Bright that actually sounds a lot better and more accurate. I hope that’s the name they go with once it hatches.
I trust this man because he probably has one in his labs on site 19
That is actually a really good name for it. Scientific, and cool
I’m pretty sure I can speak for a vast majority of people when I say Jack and his team should just stop beating around the bush do what we all are thinking: use cassowaries instead of chickens.
Come on scientific community, what are you? Chicken? Oh wait...
Why cant we just use geese?
@@dirandrous7682 We have the same problem there as with cassowaries, just smaller with webbed feet.
@Jeremiah Olson same
I like how you think my guy
What abt emus
It's like the joke...
What do you get if you cross a cow with an octopus?
Immediate withdrawal of funding, and a visit from the Ethics Committee
If you manage to cross a mammal with a mollusc you're winning the Nobel Prize.
An octopus that produces milk instead of ink
A Cow that can milk itself?
@@zebradun7407 what about a genetically altered pickle that can rick itself?
a cocktopus
This makes me think of something my mom told me when I was rlly little and she was teaching me how to properly hold a rabbit “Remember this is an animal not a toy” I think the same concept can be applied here.
Why here, but not with most things in life? Most things that are not normally considered "toys" are very much considered toys by millions of people. Cars, audio equipment, cameras, weapons, etc. I agree in principle, but your logic is very shaky.
Me: "Direct genetic manipulation is comparable to opening Pandora's Box-we're probably gonna regret it."
Also Me: "Dinosaurs and cat girls are by all means worthy of pursuing."
I pretty much feel the same, personally.
Especially the cat girls. Mmm, cat girls... lol. xD
Why not dinosaur girls?
@@drsharkboy6568 SpaceX: _"Write that down! Write that down!..."_
My question is, would the cat girls have human rights? Because if so then any weeb probably wouldn't be able to get into a relationship with one anyway.
What we expect: Cute cat girls.
Reality: The Island Of Dr Moreau.
chickenosaurus: Novelty animal, ethically immoral
Pug: Cute dog
Where do we draw the line?
You can find pugs cute, but still recognise that it's unethical to breed them. The damage has been done, but it can be undone but just mixing dog breeds again, so we need to make people stop caring so much about "pure-breeds", so that in the future, someone will just want a dog, any cute and healthy dog, rather than specifically a pug.
Pugs are way worse. We forced them to be bred with crippling life threatening defects.
Morals are always a grey space in arguments like these. They change depending on too many factors. There will always be someone who thinks otherwise when it comes to questions like this.
Puts are absolutely immoral
dino chickens are immoral yet industrial chicken farms still exist
Why do it with a chicken, why not a turkey? You know, for dramatic effect
Or emus.
no no no nope ,, Emus defeated the Australian Artillery without a Dinosaur buff
Humans are supposed to survive this after all
chickens are like really common like 23700000000 chickens common
No, no, no, you're all wrong... What we need? Isa *Cassowarisaurus*. Or a Cassoraptor. Cassowaries are terrifying, and are already very dangerous and territorial in the wild. Imaging making them *more* lethal!
@@svon1 pretty sure a strafing from an A10 warthog or two would wipe them out
Why not a turkey?
Why not cross a turkey with a dinosaur ?
Well judging by the majority of recent American presidents I strongly suspect that it's already been done.
gets close to microphone: "CATGIRLS" I am dying of laughter
"Living-Biological Attraction"
Isn't that basically what a celebrity is?
In a nutshell; yea.
Yes, but with the difference that they weren't "made"
@Fuck Google and Facebook for tracking me k
@@parden3743 Granted, but why did the words "Botox" & "Silicon" just pop into my mind?
Why can’t we just clone a damn mammoth or saber tooth cat.
Both are way easier to clone since like Trey says, their D.N.A is much more intact.
Mammoth Meat
Release them into Siberia to revitalize the ecosystem
Yeah plus it would help bio diversity
I’m curious to when the thylacine will be brought back too.
short answer: shit's hard
"(catgirls) must be proven safe and efficient for its(their) intended use"
-FDA regulations
i sure hope they are
😳
Its time
Why do I get the feeling real life cat girls will look the characters in cats
@@maxthechosen1132 thats the beauty, with CRISPR we can add and subtract features as we like, like facial hair density and such
@@gewuerzwanze5627 the future
@Caesar The Infamous not catboys only catgirls
“You were so caught up with whether or not you could, you never stopped and wondered whether or not you should”
"Your scientists were so preoccupied with whether they should that they didn't stop to think if they could."
- Me, just now.
It's the opposite XD
Your scientists were so preoccupied with wether they could, they didn't stop to think if they should.
Well, of course in real life, there's low chances that our scientific hubris came back to destroy us XD
@@krankarvolund7771 I think you missed the joke
@@krankarvolund7771 low... The problem is what people does with science, and what scientists allow people to do. And by that I mean that sometimes things shall stay unknown, if humanity isn't ready. Wait, not unknown, as we know consequences of many things by now. Scientists has already tried much of those stuff, as Trey rightfully stated. Is just that some things are pointless to do, you would just create monstruocities for no other purpose than see what you already know it is wrong. And if you don't know it is, go check old experiments and stuff. Life is something very delicate to deal with, it is just finally the time scientists are going to use more their brain on what they do before they do it, instead of having to always find out what they've done is damn bad after they've done it
@@krankarvolund7771 They weren't trying to make the quote from Ian Malcom. They were saying that scientists, instead of just going ahead with something that poses little to no threat, think about if the should do it. This has been an official r/woosh moment
I swear that quote will never be irrelevant.
Genetically engineered cat girls would, funny enough, be technically classified as a person in the US (Amendment 14, Section 1, Equal Protection Clause)
but the supreme court stated that XMEN are not humans
that clause refers to persons, catgirls wouldnt be people, but domestic animals. Hence they dont get the protection.
I'm still confused over what a genetically modified catgirl would even really be. Like, you take the cat genes and you make a person with a furry tail and head-ears, I guess? But this isn't anime, it's real life, so you've basically just taken a normal person and made them completely different without their permission for what? Just to get a tail and do something that can be accomplished with some bangs and a $20 cosplay hairband.
It's like, there are pretty glaring concerns to be had with turning someone into a fetishized fantasy race against their will.
Please, god.... not the cat girls....
@@dracocrusher 1 - they would be newly born. people don't have a say with regards to being born.
2 - the most concerning part is the deformation of the skull and the new shape of the brain due to the ears being in a different place. it most likely would turn up to be some kind of lion looking monstrous abomination, like in the movies when they say "they used human DNA" (the creature comes to mind, which was a dolphin-shark hydrid with human DNA, and jurassic park).
Imagine turning a dinosaur into a dinosaur.
How?!
@@اميوسفالعازمي-ف6س i think you missed the joke
Wowowlwlwkoww oh my godddde taht cwazy
That’s like turning a bird into a bird
Its like saying imagine making a dog into a wolf theyre two different species eben if wolfs are theyre ancestor they became theyre own species
"Before you even knew what you had you patented it and packaged it and slapped it on a plastic lunchbox, and now you’re selling it, you want to sell it."
Yes i want dino-chicken
I owned a pug and I really cant explain I felt like an asshole I felt like this being could have such an easier time you can hear them having trouble breathing over the most minute thing it's kinda depressing
At least you realised it, most people don´t...
dont breed pugs! just let them all die
@@kevinthiago413 or mix them with other species. E.g. beagles.
Emus, Ostriches, and Cassowary: "Are we a joke to you people?" 😆
I would prefer to modify a Cassowary, NOT A CHICKEN
@@gabriel9132-q1x God no! Those things are deadly as it is!
a chicken is way less likely to kill you.
emus? those guys won a war.
Yes, yes they are.
Bro how about a Turkey? *_*
Please don't stop working on your videos. Your Voice and way of speaking is like a massage for my brain. .... And the topics are really interesting and well researched. Please don't stop. :)
I think trying to bring back a terror bird is the real move. THATS a dinosaur within our reach
Imagine genetically-engineered predatory emus
@@cobinasaur remake sarckosuchus and meglania
But do we have any living relative or descendants of the Terror Bird.
Well the living members of the ratite family probably have a few suitable species we could start from (like the cassowary, emu, ostrich ect), go back one generation at a time taking it relatively slowly to allow for more successful results, I believe it could work
Ghost 7132 there is the seriemas the only surviving relatives of the terror birds
I just want a movie where they have feathers for once
Walking with dinosaur?!
fatmelon jurassic park's dinosaurs were always too big for their actual size
And the t rex skull aint accurate the jaw needs to be a bit thinner
And the hands were pronated in a wrong way
So i wouldnt say it was accurate for its time because we already knew this stuff
@@xanderomeister7828 most of the jp dinosaur was pretty much scaly tho,trex had protofeather covering its back but most of their body was covered in scale.yeah,they had 2 fully feathered dinosaur which is gallimimus and velociraptor and screwed it up real bad but most of their dinosaur was accurate scaly-wise.
Well it's not a movie but you can check the game prehistoric kingdom it features really cool more scientifically accurate prehistoric creatures and is in general a really awesome park/zoo builder game to check out!!!
That must be tougher to render and animate
Expectation: Raptor
Reality: Weird deformed chicken.
Prehistoric dinosaur: Gallimimus(Chicken mimic)
Horner mutant poultry: Mimigallus(mimic chicken?)
I mean chickens are maniraptors so Success!
Velociraptors were much like chickens, even in size
ohhh only the first couple. Version 2.0 will look cool and taste great fried. Colonel Sanders is gonna love chickens you dont have to pluck before you cook them.
@@syedmuhammadkhan I'd say that's, like, one of the only apt comparisons between the two lol
"your scientists were so preoccupied with whether or not they could that they never stopped to consider whether or not they should" -Ian Malcolm, Jurassic Park
Imagine the future, Robots fighting Catgirls riding Dinosaur-chickens
i was born in the wrong generation
The robots will cleanse the earth of GMOs
God would have indeed given up
*Terminator 2 theme playing*
dont forget the snakemice and mammoths , or the human chimps.
"Or cat boys"
Ah, I see Trey the Explainer. You are a man of culture as well
Serving up that fujoshi realness, wait, what are male fans of yaoi called?
@@tshred666 fudanshi
👌
A wise sir
@@tshred666 I think you are just gay or bi secretly 😂😂
"The genetic monstrosity that is the pug" 😂 😂 😂
"Look how cute it is!"
*Pug struggling to breath and see*
@@shaggyspade2468 I don't even see the cuteness in a pug. Like, even if they didn't suffer from all their malformations, I find them ugly as fuck. Looking like a cartoon that just got hit in the face by a frying pan.
Now a wolf, that's a beautiful animal right there.
Look how long ago that was
Fact
Ugliest footballs ive ever seen.
I would absolutely love to watch a full-length video about someone considered "The Tiger King of Paleontology".
That sounds like a wild, chaotic fun flume of a tale and I would want to be all in on it.
Fun fact: The first de-extinction attempt was carried out in Germany in the 30's. It was an attempt to bring back aurochs
That had a completely different methodology though, it was basically just taking the biggest, beefiest, meanest cows in the world, getting them to fuck and seeing what happened. In fact it's a still ongoing experiment as the Pleistocene Park in Russia and several smaller rewildening projects have proven the current Eurasian ecosystems are missing a large herbivore grazer because we, humans killed them all. Rebreeding cows back into Aurochs and reintroducing them could have a ripple effect on the landscapes they're reintroduced to. Just look at the Pleistocene Park, what was once barren tundra has now become grasslands under the influence of the large grazers they've reintroduced.
Wasn't it "succesfull", atleast they got what they wanted, and they where only made because Göring (head of the German Airforce) wanted to feel like Ceaser, and they where Nazis so there is that
Zlovenski_Človečnjak l
@@124Andro we have learned so much about genetics in the past 80 years. I think that de-extincting some of the megafauna that we may have had a hand in pushing over the edge is a noble endeavor.
Ironic
I love how much you focus on ethics alongside science. The two are certainly interwoven and should always be discussed together like this. Great writing.
I agree
Oh Trey the Explainer, could you allow this humble viewer to subtitle your old videos like the Beast of Gévaudan so I can show it to my mates and people around the world can show it to their mates that too, like mine, do not understand the english language?
Thanks in advance, oh mighty Trey the Enabler of Subtitles.
Oh and nice intro animation, so cute!
I like the animation for your opening scene you know it would be more exciting if you add the Dippersaurus twin sister "The Mabelsaurus".
But if you were opening scene the Dippersaurus will do the chalkboard while Mabelsaurus did some decorating with glitter.
"The only reason anyone would do this, which they can't, would be because they could, which they can't."
Rick Sanchez on the topic of dino-chicken
so when are you going to school us in genetic engineering. you expert status is obvious.
Ethical?: No
Cool?: Hell yeah
Bigfoot Fighter not ethically made epically made
Ethics should never get involved in science. We need Dino-chicken for awesome pets.
@@jacobsockness571
"Ethics should never get involved in science." - Josef Mengele 1944
Even from an ethical P.O.V there's a good chance the chicken will feel fine, the only way the project can turn out negatively for the chicken is if mutations occur but since this is a first time project, mutations indeed are likely but mutations need not always be bad, most mutations don't affect organisms much so there's a small chance that a major mutation can take place and the chicken does suffer. If a mutation does not occur the chicken will live life normally as no changes would be made to the existing organs or organ systems, I don't think it's unethical if the chicken is not hurt.
@@DioBrando-yk5up What even are you to me
I guess it depends on how severely these atavisms will effect the chicken. If in the end it looks like something you show in 11:00 and it can live fairly normally all atavisms considered, then I don’t think its that bad, especially when looking at what fucked up breeds of chickens there are out there. And maybe we’ll learn something in the process. But I am not a fan of adding genes from other species, which as you say, pretty much undermines the initial research goals.
I agree.
Heck, an ambitious breeding project just to breed longer tails and maybe teeth (or at least teeth-like structures) with the birds through careful selection would be better than introducing genes from other species...
We created chicken with blue skin, black meat, 5-6 toes (silky chicken). Could we breed a tail out? Well what's more plausible, blue skinned bird with black meat or bird with boney tail?
Yeah it goes to far when you add genes
I completely agree. I am all for turning the genes on and off to make a dino chicken. We could learn a lot about it's evolution and even find new things out that we can't conceive of yet. But I don't like the idea of just making a chimera. I think it's ultimately pointless. I think a chicken with teeth, a tail and fewer feathers would get the job done both scientifically and aesthetically. And that creature could still function like a normal chicken. I raise chickens. They already hunt in packs and rip mice apart for food anyway. I really don't see it making them "more dangerous" I raise my birds from eggs and they love me and I love them. They are already smart and vicious with their prey and intruders. They are just missing a few things! All in all they really are little dinos. When you look into their eyes is when you see it the most. Anyone who raises large breed chickens will tell you the same. They are a LOT cooler than people think!
Some of the reasons why they are adding new genes in, is because over the generations, genetic information is lost. An example would be the enamel for their teeth. While they turned on the gene for jaws, they couldn't for tooth enamel.
You good sir have earned a subscribe for the mentioning of the oft forgotten catboys, please make it happen. Have a good day.
what about mammoths? they promised me mammoths
Indeed. I refuse to leave this earth before I've ridden a mammoth.
It is impossible to create a pure mammoth, sorry but that's the truth.
@@christopherdinoguy8346 yes it is possible. If gametes are genetically modified(or changed in some other ways), an elephant will birth a mammoth
The russians working on Paleocene Park are already on it to bringing back certain ice age mammals. It includes the mammoth.
@@veneficus582
It will still be half an elephant as it will still inherit some genes of it's mother, plus since mutations are very likely it'll probably be deformed.
We can make real Dino-Nuggets from them, so yeah, do it
Eat your Cereal
Or create a Ecosphere full of Neo-Dinos
Chickens are dinosaurs. You can already get dino nuggets.
@Techo The cat wtf
Heck yeah , the real deal dino-nuggets
When you mentioned a mini elephant as an example of novelty animals I remembered that a mini elephant appeared in Jurassic park as a Ingen fundraiser! Nice reference. Keep up the cool cat content.
I feel like Mammoths or Thylacines or Dodos are the first creatures we should recreate. Not as some way to disprove someone or play god but maybe as a way to acknowledge our influence on the earth’s biosphere and work to make our impact beneficial over destructive. Bringing back recently extinct species could acknowledge our awareness and sort of prove our separation from the idea that we are a violent invasive species that kills everything we make contact with.
Regarding genetically-engineered catgirls, they would look more like the ones from that awful CATS movie than the ones from your anime.
We have the ability to control which genes are spliced together, we aren't just mashing DNA together to see what sticks
So, we might have Lord Beerus then?
Well how about some pussycat, it’s not beastie at that point?🤔😥😥
That's make it even better
Or just humans with furry hair rather than normal hair. A few furries might be happy but the cat person will have to live his life that way. Not that it would be bad but he wouldn’t be the same as everybody else. Which means racism and such.
Jack Horner: yea imma make a dinosaur pretty soon lol
Trey: *SNAKE MICE*
_Snice_
Or at least one _Snouse_
I think the term “Gallisaurus” would be more apt.
@@KaiserEnergy Or Gallimimussauromimus
* ahem *
Birdosaurus
Hey there, fellow smart dinosaur
@@reelbytes6447 i'll one up that. Saurusaurus
@@janbelcher1896 that literally translates to "lizard lizard"
I think we can draw a fairly clear and simple line in the sand. So long as it's possible to breed an animal that can live a feasibly torment-free existence and is capable enough to at least be able to attempt to live on its own, we are clear for chickensaurus.
Agreed
If it can live without human assistance it's already better than the normal domestic chickens
A catguy, Ph.D in the year 3000: Let's reverse engineered catmans
Some VRTuber: Should we do this?
The comment section: He's trying to make us into humans, disgusting
"Your scientists were so preoccupied with whether or not they could, they didn’t stop to think if they should"
This
The problem is that Malcom is seen as being full of himself when his chaos "theory" is as humble as it gets.
I have always disagreed with that. we can find a way to make this world more beautiful. dr malcolm can go to hell
@@VictorianTimeTraveler i dont think a chickensaurus would make this world any more beautiful.
@HempMasterNinja You probably are just mad because Dr. Malcolm advocates that the Dino's in Fallen Kingdom 2 - I am NOT putting Jurassic in front of that because that would just insult Jurassic Park l which was a fucking classic - should die when Isla Nublar's volcano wipes out the island. And I agree with that. EVERYTIME dinos and humans were " thrown back into the mix" countless people were killed or eaten, because Hammond wanted to give people something amazing that was real, that they could touch etc. And what happens? Oh people start either try to poach these constructs for two other parks or they are twice attempted to be use their DNA to make worse monstrous killing machines. And then a cloned CHILD was like there like me, clones, I'm going to let them live and releases breading dinos on North America So tell me how that's beautiful for the world when they are now the new Alpha predators replacing us on the food chain ?
Trey: WE SHOULD NOT DO THIS!
Also Trey: Here's their donation link :)
@zany music nl but if there's only 2 that means every descendant would have to be inbred. That would reverse all the genetic breeding.
I think the point of this video was not just the opinion, but to question all of the things he implored us to question. Are the already modified organisms we've made ethical? And what constitutes what is ethical to us and what is not? And he ends the video pretty open-mindedly, too -- "perhaps you can convince me otherwise."
I appreciate that!
I think it is very considerate of him. He puts down all the information and lets us decide for ourselves. It's also respectful towards Jack Horner, even if Trey disagrees with him.
@@rokukouexactly. this guy us amazing. im normally only mildly interested in the topics he speaks on, but hes so enjoyable to listen to, ive been learning so much about dinosaurs and the bible and the related sciences lmao
I’d love to see a chicken Rex, but I’m firmly on the side of it having more risk than reward. Though How to Build a Dinosaur is genuinely an interesting read. I read it at 13 and still find it fascinating nearly a decade later.
"Director of Star Wars: The Phantom Menace" I laughed way too hard at that.
When he mentioned that one movie instead of the whole franchise. "It's like poetry, it rhymes"
“Science isn’t about why, it’s about why not!” -Cave Johnson
"So everybody grab a gun and kill some mantis men"
"When Life gives you lemons you make life take them back"
Read jurassic park... it preaches exactly the opposite of that line of thinking.
Cool name
oh my god that animation in the beginning was gold
Just because something was done before, doesn’t mean it should be done again.
Two wrongs don’t make a right.
I'd still really like to see a recreated dinosaur
Bryce McKenzie yeah I’d like to as well but I don’t have much faith in Jack Horner actually making a Dino it would be more like a chimera
@@Trike71171 tbh i just want to see the result
@@koninggijsnlGames Damn me too. People complain about this but then they just say cute at things like the bubble eye goldfish and pugs. I feel either swing one way or the other. And looking at how the meat industry treats chickens, this sickly chicken would live a far better life than most of them.
@@derpychicken2131
You actually make a good point, I didn't think of that. It would most likely live a much better life and who knows, maybe it won't be as sickly as we think it will.
Triceratops Horridus1021 it’s still be cool tho
19:21 Sadly, that might be more merciful than how we inbreed some snakes to the point of *literally* not knowing up from down.
Its the same thing. Wobble head breeding, pug breeding none of these are ethical. We donot need those changes for practical reasons. Just making some creature's life miserable for fun is never ethical
@@particularplaypaint5384
Indeed.
Compared to that, how bad is genetic engineering?
This sounds interesting. What's the source I wanna know more bout it. How'd n why'd they do it?
@@nulliusinverba7732 people breed snakes to look a certain way and sometimes the breed or whatever its called is so inbred and they bob their heads and are often upside down cuz they don't know up from dowm.
@@nulliusinverba7732 Spider morph ball pythons, I believe. The 'spider wobble' is a neurological problem in this specific morph/pattern of snake and it makes them, well, wobbly. But not like 'oh cute he wiggles' wobbly, like, 'oh look he flipped himself upside down and slammed himself into a wall, and he can't eat' wobbly.
The fact that he didn’t start with an ostrich so we get JP-sized “dinosaur” is the lamest part
imean, tbh that's more dangerous, and Velociraptors in real life were no where near that size. More like a normal to smallish dog (like a poodle).
To be fair, I would imagine the life cycle of a chicken is much shorter than an ostrich, so it could be more practical for a scientist to start with that organism first.
Yeah. That doesn't sound like a good plan for your first run.
Ostriches are dangerous enough as is.
Why would he start with an Ostrich? We're still at the experimental stage. A chicken is cheap and can grow to maturity in a matter of months. Suppose his Chickenosaurus project succeeds, then he can move on to an ostrich.
OMG I just tested positive for BRCA-1 and had extensive removal surgery remove the affected tissues. In listening to this video while 6weeks into recovery! It was cool to hear about it at such a time!
I don’t get what all the fuss is about, after all they clearly have already succeeded. Where do you think dino-nuggets come from :)
*flips desk* WHERE ARE MY DINO-NUGGIES
Soylent Green.
When your non avian Dino nuggets are made of avian dinosaurs.
*Jack a decade later* : "They called me a mad man".
*DEMONIC CHICKEN SCREECHING IN THE DISTANCE*
"RISE MY CHICKENOSAURUS ARMY! TAKE BACK THE WHITE HOUSE!"
He also thought that t-rex was a scavanger
Watch rick raptor
@@pp-wr7se CrAwLiNG iN mY sKiiInn... :D
@@RasseLTD Ayyyy
2220 be like:
Son: Mom what's our dinner?
Mom: Fried Dino
2220 be like
Kitchen robot: Would you like fried dino for dinner?
2220: mum my pet chickenosaurus is eating my fish 'n' chips
Dino chicken nuggets will have a new meaning
@@yourmother9834 no no no nONONONO NONONONO
Fried robot chicken
Makes me think of the old joke about Kentucky-fried-octopus: "Everyone gets a drumstick!"
Listening about how the production of insulin has been streamlined I couldn't help having a negative feeling about the fact that it can be produced much cheaper and yet people are still having to choose between rent and insulin. That's the part about genetic engineering that isn't good enough for me. I don't expect companies to not make any money and I'm not anti capitalism however I think the subject of access should be part of the decision making progress in drug development, gmos etc. All of it really, it's the business side of biotechnology that really sucks sometimes.
Couldn’t have said it any better.
It's a type of information technology so will spread and get less expensive with time. Just like pirating computer software or entertainment, pirating genetic creations will continue to become more accessible.
If the corporations are not playing fair they will end up dealing with a strong black market.
@nonya business probably because it's not true. The president doesn't have that much power
the good/bad thing is that if they continue to rise the prices for insulin, there will be nobody to buy it in some years from now
And it's not actually that expensive. Here in the Philippines one vial of insulin costs about $10 USD retail (and there are programs to provide discounts and help for poor people). If the Philippines can do it, why can't the US?
17:30 implying these mices and chickens would otherwise have had a good life? The vast majority of chickens on earth cannot move their limbs much more than this genetically modified mouse can, unfortunately
Yummy chiken taste good
Yeah that was a weak point. We torture billions of animals, some chickens are not going to taint our righteous moral code
Yes battery turkeys are so massive they can’t breed naturally and have been modified so they grow quickly and put on weight quick so you end up with a suffering bird with tiny legs and a massive body. What has humanity done to the natural world?
Is justified to creat more suffering just because of the pre-existence of other forms of suffering?
@@zliu4208 But this one is for science. Besides the first few batch will be invalid but likely quickly killed, sooner or later they'll perfect em. Its really only a matter of time, even if we wait 100 years for us to perfectly and painlessly engineer em for our tech to catch up.
"should we create a dino-chicken?"
the answer is clearly yes, but we do need to treat it ethically once we've done it. We don't wanna Malcolm it, after all
Malcom?
What do you mean by Malcolm?
Jurassic park, guys. Ian Malcolm played by Jeff Goldblum
Raithial you mean Hammond? Cause Malcom wanted them to be respected
Ethically, like the chickens and other birds we eat ? OK
On the slice about GMOs, the term has always bugged me since, every time we reproduce, we’re kind of genetically modifying ourselves. But the agricultural modifications we’ve made genetically alter our food. 🤷🏼♀️ it’s always seemed like a redundant phrase.
"should we create a dino-"
everyone: yes
i would bring them back if i could but I cant
Even after watching all the jurassic park films or any scientist for that matter I still say yes
I know Jurassic Park isn't the most scientifically accurate movie out there but what that Ian guy said was right: dinosaurs are probably not suitable for today's ecosystem. If we do bring back a dino we shouldn't bring more than one back. Also im scared of dinos
@@manmoy4104 The dinosaurs can wipe out every existing Cenozoic animal
but like according to jurassic park everytime you create dinosaurs it completely destroys the multiverse.
Trey: is it really ethical to create something like an elephant that can fit in your hand?
Me, a Canadian: HOUSE HIPPOS HOUSE HIPPOS HOUSE HIPPOS
Just get a Capybara bruh
@@rachelblack2165 but those aren't hippos you can keep in your house
@@AmaryInkawult close enough. They are basically furry rodent hippos.
how cute must be 20 cm Hippos
Wait for Christmas.
Pros: bigger KFC
Cons: IRRELEVANT
Con: none
@@selenajarv8763 ok... 1 con... I would buy/breed WAY to many...
@@theeggman1199 same tbh
I dont go to kfc but same
Ostriches: _Sighes, then buries heads back into holes_
Bro thank you so much for the sick band name "Serpentized"
In the mobile game Temple Run 2, there is a bunch of bizarre fauna, including a "dino chicken". The description is just "it shouldn't exist, but it does."
You CAN have a pet dinosaur! You can have budgies, parakeets, lovebirds, etc.
You can also have real life dino chicken nuggies
@@thekrusad3r290 now thats cruel dude.
@@thekrusad3r290 i would like to have a HERBIVORE pet.
@@gabriel9132-q1x id like to uh.. tell you to not go for birds then.
Theyre oppertunistic.
We had finches in my parents house, and they would attempt to steal fried chicken off of plates.
Several other species are the same, id reccomend maybe get a crested gecko or maybe an aquatic snail. (Minus Assassin Snails)
@@sparklepupfaeri7069 crested geckos will eat bugs too so maybe something like a uromastix would be better
“To every man is given the key to the gates of heaven. The same key opens the gates of hell. And so it is with science.” - Richard Feynman
Hellorhighwater88 sounds smart don’t get it though
Feynman was the man! I remember in a lecture someone was trolling him about anti gravity devices A.K.A U.F.O's he pointed out that the man was using one in the form of the bean bag he was laying on LOL
@@tinyrogue1459 Its a tool, like the allegory of when you teach a child to use a knife, it can cut a sandwich or murder, yah dig?
Imagine a world in which incredibly clever men do not resort to the language of superstitious cavemen...
Sick quote you got from reddit, teenager
The Chickensaurus is the project that inspired the Indominous Rex isn't it. This man is literally John Hammond down to his look, all that's missing is a piece of amber on his cane.
I doubt Disney had the presence of mind to critique the Chickenosaurus project when they were making Jurassic World. Those films were written to be pure money-milkers and offer nothing in the way of intelligent commentary.
I must say, the chickenasaurus has a bad ass logo! 😂❤️
"Should we create a Dino-Chicken?"
Me: "Are they taste delicious as present chicken?"
Same taste, but bigger.
@@pinkdaruma8942 *well then i don't see the problem*
Your going to be the delicious one this time
@@mythicalkhan7465
oof
we like three legged chickens.. Theres a leg for Beryl, my son Frank and me
what do they taste like?
Dunno, never caught one
10:37
That is possibly the least enthusiastic reaction to catgirls that I have seen.
honestly cat girls in reality wouldn't be cute they'd probably be deformed genetically modified humanoid monsters with cysts tumors, every single health problem known to mankind, and begging for somebody to end its life. Just stick with dinosaurs and unicorns. No human genetic experiments unless its safe and it directly benefits our physical health like bio-engineering cells that could detect and kill cancer cells in our body.
@@derpherp1810 Absolutely, if the development is focused solely on the cat girls, but it would be unlikely to be so, since there would need to be a lot of work done on genetics, if nothing else knowing where the "ear" genes are located would necessitate us to understand the whole genome, or we'd get a cancerball. And that could lead to great advances in medicine. But yes, human testing should be left alone until we understand the field well enough.
And even so, they'd most likely look worse than the cats from Cats (2019)
@@sokogekigoji8299 do you think that in most of the world they won't be given protection under the law. In all reality I see them being closer to adoption of a child (and if done by a university or a small institution with more protection) not developed as sex slaves.
well ....
Main body:Human , with add on genes of a cat
Main body:Mouse , with add on genes of a snake
So pretty much if the snakemouse has any of the problems then likely catgirls will as well , if the snakemouse dosnt have that type of problem then catgirls should be fine as well.
However i wonder why do people want catgirls so badly??? , i for one at lest agree that mammoths and other large ice age herbavore might infact be good to bring back , its a long story but it has to do that without them the trees are overcrowding at the ice cap areas and heating the area up , so at lest we have a good reason to bring them back.
but catgirls? and dinochickens? like what is the main reason to bring them?
and a other thing to note , what if there is no problem with the catgirls health , would they be counted as slaves?
and even if all that problem is ok with all catgirls and humans having a good live toggether , the people making them , they could be using all that money to make some sort of horrible killer monster just for fun , as in jurrasic world style , trying to make the biggest scariest evilest dino ever just to make a show and boom backfires...
@@derpherp1810 depends how you make them, when you try to make a chimera, it might work. Just saw a interesting video on how to do that on the channel "sandman" one of the recent videos who talks about cats ladys
17:53 - Thanks for talking about this subject. Most people either steer clear of this topic publicly or just default to the opinion that it's not something even worthy of thought somehow and I think that's really unfortunate.
"turn a bird back into a dinosaur"
ssssalready a dinosaur though.
This.
9:40
Commenting to see people debate taxonomy
@@rawovunlapin8201 Same.
Say what you will, but I will do everything in my power to bring brontoscorpio back!
“We shouldn’t do this it’s unethical to chickens!”
-Eats Chicken-
yeh but, killing a chicken still sounds a lil less sadist than mutating one into a monstrosity IMHO
And luckily you're vegan
@@rubenb8653 Why? i get it if the chicken suffers, but why does the chicken care if she looks monstruous. If the chicken doesn't suffer and the "failed attempts" are ended without suffering of the animal, why is it sadist??
@@rubenb8653 well even if it's less sadist it still is sadist (by the logic of your statement only)
@@youngspinach you eat the chicken, in a world where people are hungry you can be sure that we need the chickens to survive, we don't need a dino chicken
Doctor: Wild Banana doesn't exist and won't hurt you
TREY: THIS MONSTROSITY
🍌 your doctor lied
Super fair analysis. Really enjoyed this!!
pros and cons of gen spilcing.
pros : CAT GIRLS
cons : none.
I want to see real life cat girls, despite ethics thrown out the window as. I want to see a legitimate real life anime trope. Though if people would want to pound Cat Girls, would it be unethical as Bestiality or the lack of consent?
@@MaoRatto
It depends on what elon says
@@MaoRatto Bestiality is not unethical. People just have a disgust response, no good ethical reasons against it.
@@coz. Asking the real questions
See: Red Dwarf.
‘There’s nothing wrong with playing God as long as you know what you’re doing!’
-The Medic TF2
When it said "TAAAGTCGTACAGTGTAACACGG"
I felt that
What? The pug trying to breathe?
Huh. Big jack horner musta moved on from magic item collecting to dinosaurs. Cool
Ironically, the chickenosaurus would be less of a dinosaur than a regular chicken.
a chicken would be more dino than the chickenosaurus cus they are using other animal breeds 😂😂
“Your scientists were so preoccupied with whether they could that they didn’t stop to think if they should.”
-Ian Malcolm
Joshua Strittmatter you know he ain't real?
@@Ohhiohh That's not a point...
It was the script
Extreme Madness get it right
@@Ohhiohh wow really . impossible
We’ve got a real life John Hammond on our hands
Also I’d rather see us bring back Thylacine or other animals that went extinct mainly because of human stupidity
The problem with that is the same problem as bringing back any other extinct animal, the ecological niche either no longer exists or is filled by some other animal.
@@Bob-bs9ok Except it actually isn't in the case of the Thylacine, at least not on Tasmania itself.
In the case of many island dwelling species the introduced species that "substituted them" are generally more harm than good anyways.
I would like to see what a living dodo would look like
Brilliant!
Title:
MuH brAIn: “....isn’t that where dinosaur shaped chicken nuggets come from!?”
Such a posthumous humiliation for the non-avian dinosaurs!
Kim Inseong
Posthumous is an odd word. I’ve never seen it spelt before. Pronounced like Post-you-muss, right?
Kim Inseong
Plus, any chicken nuggets I’ve ever eaten had Pterodactyls. My mom always got the cheap ones from aldi though. Maybe the expensive ones could afford to use all land reptile meat?
Turok, not the dinosaur hunter, the adult film star yeah my mom got the ones from Costco, I can confirm that they have trex, and triceratops
@@jesusdiscipledon1499 Exactly. Luckily I didn't mispronounced it as "posthumorous" 😂
I don’t feel like this was made a month ago more like a year