Комментарии •

  • @meridian6042
    @meridian6042 2 года назад +2498

    Anthony doesn't go to parties, parties come to him! yeah boiiii

    • @kyb7795
      @kyb7795 2 года назад +75

      Anthony doesn't bgo to parties he is the party

    • @CyFr
      @CyFr 2 года назад +13

      That's a nightmare scenario if I ever heard one before.

    • @blunderingfool
      @blunderingfool 2 года назад +9

      I mean, he probably can't get up a flight of stairs to reach a party. Not without suffering a mild heart attack.

    • @shrimppasta5544
      @shrimppasta5544 2 года назад

      @@blunderingfool why ya gotta be an a*s?

    • @CyFr
      @CyFr 2 года назад +60

      @@blunderingfool plenty of stairs at LMG, don't be fat shaming.

  • @MegaMech
    @MegaMech 2 года назад +1229

    This is why those FBI or whatever forced data requests without accountability. (They claimed it was illegal to make the request public) should never have been a thing. Cause what's stopping an entity from falsely claiming they're the FBI? And this is exactly what happens. Accountability exists for a reason. And it's in the government's best interest to be accountable and public (in things that makes sense to do so).

    • @bradhaines3142
      @bradhaines3142 2 года назад

      lots of crooked shit makes plenty of sense, as long as you remember it's crooked shit. and if its any federal agency, it's 100% some crooked shit

    • @NightKev
      @NightKev 2 года назад +85

      The whole "emergency request to prevent imminent harm" angle *sounds* reasonable, I suppose... if there are extensive audits of *every* such request made after the fact and heavy penalties for misuse, along with strict guidelines on how they can be used in the first place. Given that such oversight would probably not actually be enforced though, it should then not be allowed period.

    • @Tommy50377
      @Tommy50377 2 года назад +43

      @@NightKev I think a good step forward would be needing an explanation of why the data is needed in the request, preferably with evidence attached. That way the company can see "Oh yeah, someone did just make a bomb threat on this account, so giving their data to the FBI makes sense". It should also only ever be used in emergencies, and absolutely nothing else.

    • @michaelkeudel8770
      @michaelkeudel8770 2 года назад +19

      Identification and a court approved warrant is required, we went through that at Nextel, standard policy everywhere in the communication industry.

    • @krazymeanie
      @krazymeanie 2 года назад +16

      @@Tommy50377 That's the thing. Some cases are classified and cannot offer an explanation for why sensitive data is collected. I don't really see an easy way around this tbh. A lot of people want privacy but with total privacy comes heightened crime that won't be traceable because of that privacy we fight so hard for. People have the mindset of "oh I don't want companies seeing or sharing my data" but when its the other way around, say for in court, they want the fbi to invade other people's privacy and telephone companies to bring up past messages for justice. We can't have both total privacy and legal safety. That's why I think privacy is not really a good thing in some situations. I'd rather be safe and leave the police work easy for them than rather a company not know what i was texting someone last night. I mean, if you ain't doing anything wrong there shouldn't be a problem right? Plus its not like the company employers sit down on an afternoon reading your messages lol

  • @merfax0000
    @merfax0000 2 года назад +176

    "Trust but Verify". One of the first things they teach you in cyber security.
    Got a court order? You have the right to verify it with authorities. If someone with a badge gives you a hard time be suspicious; legit police/FBI know the rules too.

    • @AL5520
      @AL5520 2 года назад +9

      True but that takes time and requires more workers. You expect them to spend money on your privacy?

    • @danielharvison7510
      @danielharvison7510 2 года назад +24

      @@AL5520 They should ask themselves which costs more: Retaining a legal advisor, or getting their pants sued off by angry customers who got all their data handed over to scammers?

    • @sune9578
      @sune9578 2 года назад +9

      @@danielharvison7510 They ask themselves that question all the time. It's why option 2 is the common outcome. It's cheaper.

    • @LKN117
      @LKN117 2 года назад +2

      They know the rules but VERY rarely play by them. 0 accountability on the 3 letter agencies of countries is very bad for the people that live in them.

    • @merfax0000
      @merfax0000 2 года назад

      @@LKN117 For the little guy this is true. But big companies are big employers and that gains a gentler touch.

  • @13loodLust
    @13loodLust 2 года назад +931

    Man half the reason I watch these days is cuz of the banter. Love the dynamics between the LTT team.

  • @hibikiholmes2867
    @hibikiholmes2867 2 года назад +335

    How do these multi-million dollar tech companies keep falling for the hacker equivalent of showing off a fake ID to a bouncer at a club?

    • @Thermalions
      @Thermalions 2 года назад +124

      Probably because the actual people who handle the requests on a daily basis are overworked and underpaid, or inexperienced graduates with little analytic skills.

    • @tumado7304
      @tumado7304 2 года назад

      Apple devices have a lot of dedicated hacker groups, it's nothing strange ,people think that iphones are safe...those people are so delusional

    • @MageTheEmperor
      @MageTheEmperor 2 года назад +47

      You probably forgot that the "company" is just a legal entity and not a superhuman, and in legal entities regular people work who can make mistakes and not know things (employees not knowing stuff is definitely the company's fault doe)

    • @triplehaudah
      @triplehaudah 2 года назад +16

      @@Thermalions Great point, social hacking is a real problem.

    • @randomuserame
      @randomuserame 2 года назад +7

      I mean are they really hackers. Social engineering (see: lying) is one of oldest tricks in the book

  • @marcocunha
    @marcocunha 2 года назад +9

    I work in IT, and I was so surprised to see how many of my users have Internet Explorer as there default browser. Another surprising thing that I learned was that a banking institution that we use requires us to use IE8 compatibility mode in order to use their website. Some users found out the hard way when they upgraded to Windows 11 and the compatibility mode features for gone.

  • @zengrath
    @zengrath 2 года назад +609

    This is why it's a good idea to wait to switch to windows 11 or any new major release, the current windows 10 works perfectly fine but it takes time for companies to revers stupid decisions like not letting people easily change the default browser. It was absurd the way changing the default browser was in windows 11, whoever came up with that idea at Microsoft shouldn't be allowed to make design decisions in the future.

    • @milesfarber
      @milesfarber 2 года назад +60

      Wait, people are actually *considering* switching to 11? Isn't it made entirely with electron?

    • @AbiyBattleSpell
      @AbiyBattleSpell 2 года назад +8

      dats any major update in general. i do the same with ios. usually wait months or a yr till i feel its stable enuff and all the crap is gone.

    • @nikm5628
      @nikm5628 2 года назад +14

      Yeah... I'm still staying with 8.1... intentionally. I'm not the least bit ok with not having control over updates

    • @awesomusmaximus3766
      @awesomusmaximus3766 2 года назад +4

      I'm on win 11 and it's buggy I get an annoying audio stutter which the audio trouble shooter fixes only to return on next boot and file copy causes the drives to disappear so there's that

    • @Yackass
      @Yackass 2 года назад +26

      I waited a good 2½ years after windows 10 released to finally jump ship from windows 7 and I'm still not too happy about it.....

  • @RirtyDascal
    @RirtyDascal 2 года назад +442

    I absolutely love how progressively comfortable Anthony is doing videos. He’s just one of those guys you couldn’t hate even if you tried really really hard.

    • @Teh-Penguin
      @Teh-Penguin 2 года назад +29

      He was an instant celebrity with the very first video he's done. The most lovable of LTT staff and they're all pretty cute.

    • @Granhier
      @Granhier 2 года назад +18

      I like Anthony. The comments obsession with him however has the exact opposite effect.

    • @Teh-Penguin
      @Teh-Penguin 2 года назад +11

      @@Granhier Let others express their affection without taking it personally :)

    • @Granhier
      @Granhier 2 года назад +11

      @@Teh-Penguin Who said I'm taking it personally? I just find it very weird. Most of the LTT cast has very charismatic, entertaining people. But nobody gets fawned over like Anthony does, and to me, it feels like people are trying to compensate for obvious things, which just makes it worse.

    • @Teh-Penguin
      @Teh-Penguin 2 года назад +6

      @@Granhier I might be wrong, but considering how much attention you pay to the subject - I think you take it personally. Me, I don't see any other reason why people would be fawning over Anthony other than because he's who he is. Your theory that this is because of his looks doesn't work out for me because if anything, the internet is the place where you get judged by your looks more than anything else. Not only that, but if he was your typical good looking guy people would suspect he gets a fanbase only because of that. All in all I think it's more productive to enjoy the positive vibes rather than to question them :)

  • @vedaryan334
    @vedaryan334 2 года назад +57

    That's why privacy is important. Data leaks happen everytime and the only way to be safe would be to have less and less data on their servers

    • @Quantum-Bullet
      @Quantum-Bullet 2 года назад

      Uses VPN 🥴

    • @psp4gamer
      @psp4gamer 2 года назад +1

      The only real way of privacy is going offline

    • @vedaryan334
      @vedaryan334 2 года назад

      @Carl Gunderson i mean of course that's not exactly how it works but I didn't want to write a paragraph about it . Plus either way less data does help in case of leaks

  • @chadkrause6574
    @chadkrause6574 2 года назад +113

    The problem with internet explorer 8 is that there are tons of old internal business sites that use it. Every company I have worked for has them

    • @AbhinavKulshreshtha
      @AbhinavKulshreshtha 2 года назад +15

      Yup, Most websites of Indian government needs IE. I consult at a company which uses open source stack and linux machines. We lost a tender bid for IT park space, because, as we found out later, their portal needs IE-6, even though it could detect DSA keyfab in Firefox, it wouldn't work unless you have IE6-7.

    • @krazymeanie
      @krazymeanie 2 года назад +19

      Honestly I think its about time that companies hire more devs to migrate to newer web technologies. As a software developer its sucks having to support IE because companies are still using it after new web standards have been laid down. Staying on IE is not only cumbersome but expensive to maintain.

    • @chadkrause6574
      @chadkrause6574 2 года назад +5

      @@krazymeanie it’s easy to say that but it’s expensive, time consuming, and distracting to redevelop old IE apps. This is coming from someone who did a little bit of that at my old job. Sometimes, the tools were better/more well suited for the application than they are today

    • @krazymeanie
      @krazymeanie 2 года назад +14

      @@chadkrause6574 I've also had to rebuild build old ie apps and I don't disagree with those points. It is time consuming and expensive but it's worth it in the long run. It took about 7-12 months for my team to rebuild an old ie app and I could say without a doubt, whilst it was alot of work, after it's done it's smooth sailing from there (Plus because we had to rebuild it forced us to review the code immensely so we caught alot of bugs and performance bottle necks lmao). I do agree that some apps benefit in the use of old technology but I'd say that it's pretty rare that newer technologies can't suffice it's needs. Ask anyone on my team and I'd bet they choose the rebuild over supporting ie but that's just us lol.

    • @semranger1
      @semranger1 2 года назад +2

      my local McDonald's uses Windows 7.

  • @kareemellebany3559
    @kareemellebany3559 2 года назад +16

    “Everyone would be upset, all the time”
    EXACTLY.

  • @obscure4847
    @obscure4847 2 года назад +154

    the hackers must of been a group of children stacked in a trench coat with aviator sunglasses and a fake mustache. it's the only way

    • @blunderingfool
      @blunderingfool 2 года назад +2

      I do love a good Bavarian Fire Drill.

    • @ty_teynium
      @ty_teynium 2 года назад +5

      I was thinking of Eric Andre at a dealership for some reason.

    • @kostasmira2933
      @kostasmira2933 2 года назад +1

      🤣🤣🤣🤣🤣🤣🤣

    • @craigvandenberg7554
      @craigvandenberg7554 2 года назад +2

      Must have been.

  • @flamevell3258
    @flamevell3258 2 года назад +130

    I feel like that double wifi thing should come into play asap. I've had hyperfusion on the rog 3 which uses wifi and data together

    • @Teh-Penguin
      @Teh-Penguin 2 года назад +3

      I can't think of a good use-case for this. When would you have access to two WiFi signals that do not converge on the same router/modem?

    • @flamevell3258
      @flamevell3258 2 года назад +6

      @@Teh-Penguin it's the frequency between 2.4 and 5 GHz. Being able to connect to both gives you more flexibility and stability. It's still the same Wi-Fi, just connecting to both types of it.

    • @Midz350i
      @Midz350i 2 года назад +1

      @@flamevell3258 I have this option in my Oppo phone. It's really useful.

    • @haydenw8691
      @haydenw8691 2 года назад

      Most phones already keep the mobile data connected even on WiFi by default, albeit so that no easily perceivable connection drop is noticed between the user when switching between the two.

    • @flamevell3258
      @flamevell3258 2 года назад +1

      @@haydenw8691 I'm talking literally fusing both of those signals into 1, you're talking about the "mobile data always active" setting. I'm talking about the hyperfusion setting

  • @Richard-mu2kn
    @Richard-mu2kn 2 года назад +52

    100 percent would buy if Hyper X sell grass keyboard and mice as decoration

    • @SodomySnake
      @SodomySnake 2 года назад +3

      Mold your own out of terra cotta and spread some chia seeds on them.

  • @RealKacho
    @RealKacho 2 года назад +93

    ill never forget getting my apple account taken,
    dude just added a prepaid card via phone to the account after lying about not having a password,
    then took off my card, making them the primary holder.
    took weeks to get it back, because god forbid you convince them youre the good guy.

    • @Kademo
      @Kademo 2 года назад +20

      At least u didn't wake up one day and find all ur iCloud data wiped 😢😢😢😢😢 I even used to pay $1 a month for extra storage and since that in 2015 I decided I'd never buy an apple product

    • @gownerjones
      @gownerjones 2 года назад +19

      @@Kademo That's why you only trust your files to local storage.

    • @the3nd3rmast3r3
      @the3nd3rmast3r3 2 года назад +13

      That's why you stop using apple products

    • @levelup1279
      @levelup1279 2 года назад

      Apple products are actually worst than google in some ways for privacy. Though android gives you more potential, such as using a privacy ROM like CalyxOS with MicroG, or go ultra hatdcore with GrapheneOS.
      Apple knows EVERYTHING about you if you use their products.

    • @gownerjones
      @gownerjones 2 года назад

      @@levelup1279 This is a nonsense argument. Unless you use a VPN every time you go online, fake different user agents in every browser you use, block cookies and local storage objects everywhere you go online and refrain from putting any information about yourself anywhere online, you already give all relevant info about yourself away to all major tech companies just by being online. Apple knows as much about an iPhone user as Facebook knows about you, even if you don't use Facebook at all. The data kraken will get your data unless you take extremely drastic measures every time you go online.

  • @captainyolo5628
    @captainyolo5628 2 года назад +64

    Anthony must be protected at all costs! 🙌🏼

    • @deejeh9494
      @deejeh9494 2 года назад

      Anthony must be unleashed upon the masses!

  • @andywillis9701
    @andywillis9701 2 года назад +9

    that Dell network thingy was standard on the Omen 15" 2018-2019 (i5, 8gb, 1060 6gb, 1 terra) as the "dual network switch" in the omen command center. allowed you to give apps exclusive access to either wifi or ethernet simulataneously and was for all intents and purposes an amazing feature to have.

  • @slippydouglas
    @slippydouglas 2 года назад +6

    _“We can’t all be Louis Rossmann, because the world would be just too sassy.”_ And now you understand what it’s like to live in New York City, my own little slice of heaven.

  • @AllTheCoolNamesWereTaken
    @AllTheCoolNamesWereTaken 2 года назад +3

    Imagine exploring around Pompeii at night, not knowing there's a robot dog patroling, Ans all you hear is the sound of the robot getting closer and closer to you

  • @davidsmart7506
    @davidsmart7506 2 года назад +26

    Fresh tech news right off the notification 🔔

  • @17tignau
    @17tignau 2 года назад +41

    Are they really “hackers” if the companies just hand over the information lmao

    • @karmanderdimdung223
      @karmanderdimdung223 2 года назад +9

      social engineering

    • @Furry_Lord
      @Furry_Lord 2 года назад

      If you have a million dollar company you will try to hide as many things you dont want the public to know. Its simple the news are likely lacking.

    • @NirateGoel
      @NirateGoel 2 года назад

      @@karmanderdimdung223 Doesn't that make them engineers?

    • @karmanderdimdung223
      @karmanderdimdung223 2 года назад +1

      @@NirateGoel correct. and that's why every bus conductor should use the title Dr. before their name.

    • @knipfer454
      @knipfer454 2 года назад +3

      LTT dropped the ball here on explaining what actually happened. Verified law enforcement domains were hacked, and the hackers used previous legitimate request form templates to send these new requests. This was a problem with law enforcement having terrible cybersecurity.

  • @antoniolewis1016
    @antoniolewis1016 2 года назад +84

    I can totally imagine a world where we're all louis Rossman and in that world, Apple doesn't sell computers without detachable power cords.

    • @blanchbacker
      @blanchbacker 2 года назад

      The studio display cable easily detaches with a quick tug. It’s just firmly fitted. It’s not a product I’d personally buy as I’m a gamer but the BS about the power cable is fake news.

    • @AaronShenghao
      @AaronShenghao 2 года назад +19

      @@blanchbacker Dude, Apple stated it isn't detached on their OWN website.

    • @cycl0n362
      @cycl0n362 2 года назад +2

      @@AaronShenghao hey mistakes happen.
      The guys who wrote the product information on the website were just not aware that it in fact does come off. For further information just watch this explanatory video: ruclips.net/video/oHg5SJYRHA0/видео.html

    • @ddc171
      @ddc171 2 года назад +8

      @@cycl0n362 nice video man, really explained it pretty well. Apple messed up big time by not making everything clear. I'm glad people like him exist to explain stuff to newbies like me

    • @robinarora8137
      @robinarora8137 2 года назад +1

      @@ddc171 and Linus channels are making it worse by spreading false information without actually thoroughly checking before making the videos … plenty of Apple haters love it and the toxic comments section community brings hella revenue for Linus channels …

  • @catcatcatcatcatcatcatcatcatca
    @catcatcatcatcatcatcatcatcatca 2 года назад +2

    I like how not only is all our stored data legally required to have specific backdoors, but also that those back doors are operated by what amounts to a secret way of knocking.

  • @tommykarrick9130
    @tommykarrick9130 2 года назад +65

    I think the real story here isn’t “a bunch of companies give up sensitive user data to people pretending to be law enforcement,” but rather, “a bunch of companies are willing to release sensitive user data to law enforcement at the drop of a hat”

    • @watema3381
      @watema3381 2 года назад +11

      Including Apple that's all about "Privacy, Privacy, Privacy!"

    • @mrbanana6464
      @mrbanana6464 2 года назад +7

      That's because they are legally obligated to do so. Administrative subpoenas, just like regular subpoenas have a penalty for failure to respond. Apple may also choose to challenge the subpoena and they have done so in the past according to their transparency report.

    • @tommykarrick9130
      @tommykarrick9130 2 года назад +8

      @@mrbanana6464 They have to respond, they don’t have to comply. You just said yourself, they have the right to challenge it. Here, they clearly immediately buckled without any pressure to someone simply because they claimed to be the government

    • @mrbanana6464
      @mrbanana6464 2 года назад +2

      @@tommykarrick9130 The email came from a compromised email account belonging to the FBI, not some random domain. Typically any objections, modifications, or motions to quash a subpoena occur when the recipient finds the relevancy, admissibility, and specificity of the subpoena materials to be unreasonable. Apple's legal department deals with reviewing these requests and not with verification.

    • @tommykarrick9130
      @tommykarrick9130 2 года назад +2

      @@mrbanana6464 that’s the entire point of what I’m saying. Even if they believed the emails to be real, they shouldn’t so easily cave and give away private information to law enforcement with a single email. I’m saying even if it was real, it would be bad.

  • @nolanwolf1828
    @nolanwolf1828 2 года назад +125

    Those NZXT keybs seem underwhelming, but hey at least NZXT didn't give hackers sensitive information when prompted to!

    • @bdhale34
      @bdhale34 2 года назад +3

      Wonder if they include screw holes that go through a power plane. They definitely are following the zero airflow model NZXT seems to love too.

    • @MDG509_
      @MDG509_ 2 года назад +3

      Look up RandomFrankP’s vid on them apparently they’re not so great.

    • @nolanwolf1828
      @nolanwolf1828 2 года назад +2

      @@MDG509_ I've seen quite a bit of coverage on this board and everyone's take away is that it's pretty bad.

    • @nolanwolf1828
      @nolanwolf1828 2 года назад

      ​@God of Girth I wouldn't go that far (cause they tried to make an interesting design and kinda did, so they deserve props for that).
      The issue is that they put the bare minimum effort in and clearly didn't even do basic research on the demographic that they're targeting. It's clear by the glued connectors, really shoddy top plate, unlubed stabs, cramped layout, and north facing LED's. Had they even done a lil research then we wouldn't have them messed up as many basic things.

  • @Mohoutje015
    @Mohoutje015 2 года назад +50

    Always ready for some fresh tech news

  • @JayCeeCreates
    @JayCeeCreates 2 года назад +1

    Someone: Dude you're so sweaty pls touch grass
    Me with a TCH Grass keyboard:

  • @ChiralWolf
    @ChiralWolf 2 года назад +1

    Dual networking is actually huge. We have a ton of server and VM based applications we use at my workplace and they HATE transferring from a wired to wireless connection when we dock or undock our laptops. Being able to just do both would be incredible

  • @radomiami
    @radomiami 2 года назад +10

    4:47 Intel, Moore Threads, welcome to the GPU club. Hope you enjoy your stay and become a great option for future PC builders!

    • @danielharvison7510
      @danielharvison7510 2 года назад +1

      I'm a bit pessimistic about Intel's first gen gpu's, but I have hope. The Moore Threads thing can be dismissed for now, because native Chinese fabs are limited to 14nm at best, in the case of SMIC semiconductor, so it won't be competitive just yet.
      There's hope though, maybe in the future.

    • @ausfoodgarden
      @ausfoodgarden 2 года назад

      @@danielharvison7510 I happen to know for a fact (unless I'm not supposed to know) that China are producing 7nm processors as of Late Feb this year.
      While I agree these first graphics cards will be relatively low on the pecking order it's the first step into providing an alternative in the mid-range GPU market.
      The name is I believe a corny take on Moores law . Anyway just thought I'd post what little I know.

  • @SRC267
    @SRC267 2 года назад +12

    I want that NZXT handheld

  • @nordicest
    @nordicest 2 года назад

    That is so strange that some basic data is very private in another country.. I am used to that I can check who have matrimonial contracts, which property someone owns and how much loan they took etc.. it is public data in Estonia :)

  • @artiumromanov9798
    @artiumromanov9798 2 года назад

    "April fools! I don't go to parties." made me lol

  • @Shutterbun4
    @Shutterbun4 2 года назад +33

    Hilarious to me how "home addresses!" are seen as a huge data breach, considering the phone company used to literally publish a book with everybody's address in it and nobody gave much of a shit.

    • @Arigatex
      @Arigatex 2 года назад +11

      Different times. There was no cancel culture or online celebrities in the 90's. So the only public figures available to terrorize were already expected to have bodyguards and security. Also less tools to do so back then

    • @TurncoatTony
      @TurncoatTony 2 года назад +11

      Only if you wanted to be in it. I know I opted out. Damn I'm old.

    • @jayeshmahapatra7085
      @jayeshmahapatra7085 2 года назад +6

      Swatting wasn't a thing back then as well. World has changed considerably, and a lot more could be done with sensitive data now than back in the day.

    • @jb888888888
      @jb888888888 2 года назад

      @@TurncoatTony AIR it cost extra to have an unlisted number.

    • @TurncoatTony
      @TurncoatTony 2 года назад

      @@jb888888888 it never cost me anything other than the time to say no when they would ask if I wanted it listed and ask me what I wanted it listed as if I wanted to. It doesn't even have to be your name.

  • @dustt314
    @dustt314 2 года назад +6

    Hyper X's TCH Grass keycaps is hilarious

  • @Slowdr
    @Slowdr 2 года назад +1

    1:54 "We can't all be Louis Rossmann, the world would just be too sassy, could you imagine? Everyone would be upset all the time" 😂

  • @wyattnygaard2266
    @wyattnygaard2266 2 года назад

    I don't know if anyone has ever said this before; but, I have loved seeing Anthony go from Lawful Evil, to Neutral Evil, and slowly and ever more casually to Chaotic Evil....

  • @servicetosociety20
    @servicetosociety20 2 года назад +83

    Anthony is such a great host!

    • @Doramyplays
      @Doramyplays 2 года назад +6

      that's what I'm sayyyyiiing

    • @jackgm6325
      @jackgm6325 2 года назад +4

      4:09 you're welcome

  • @Mentohs
    @Mentohs 2 года назад +8

    I unironically want a few of those keycaps lmao

  • @Zatchillac
    @Zatchillac 2 года назад

    Man the first shot of the robot dog in those ruins gave me really heavy Talos Principle vibes

  • @Ty-ri7dy
    @Ty-ri7dy 2 года назад

    This is why you don't even establish a policy for ANYONE to have access to personal information.
    There is no such thing as "good guy"/"bad guy." It's only the bad guy, trying to get your information, and the so-called-"good guy" that you hope is good enough to prevent them from getting it. This is why policies like this are bad bad bad bad bad bad. The "good guys" get 40 hr. s a week to crunch on this shit, meanwhile, the actual bad guys why are looking to do harm to you have all day every day, weekends and holidays included.
    Giving government automatic (key word here is that one) access to your sensitive data is the worst idea ever, but no one ever talks about it.

  • @drdean2879
    @drdean2879 2 года назад +3

    4:59 "With 1080p League Of Legends Demo"
    Verge PC Guide: Best Benchmark Game Ever!

  • @little_forest
    @little_forest 2 года назад +12

    Microsoft is planning a new naming scheme for their future Windows versions. The version after MS Windows 11 will be MS Edge 12.

    • @ohioplayer-bl9em
      @ohioplayer-bl9em 2 года назад

      The next with just be called EDGE...

    • @UNSCPILOT
      @UNSCPILOT 2 года назад

      I wouldn't be shocked if they did something that silly, don't really mind since I'm moved over to Linux now, but it'd still be a good laugh

  • @Joseki
    @Joseki 2 года назад +1

    I understand it was a joke, but the Pompeii looting is a serious and real issue, with a lot of tourists (mainly from North America) thinking they can just break down a piece and get it back home, and it's extremely damaging to one of the best preserved archeological sites in history.

    • @ThatNormalBunny
      @ThatNormalBunny 2 года назад

      >Mainly from North America
      Why am I not surprised 😂

  • @NeaGigel2008
    @NeaGigel2008 2 года назад

    The robot dogs guarding something gives me Generation Zero vibes

  • @mystirboy
    @mystirboy 2 года назад +6

    Those Boston dynamic dogs are the first that's gonna be looted.

  • @madorsey077
    @madorsey077 2 года назад +9

    its a big difference between having your user's data stolen from you and having your whole companies existence created for the objective to sell your user's data (Facebook , Google, Instagram, etc.)

    • @knipfer454
      @knipfer454 2 года назад

      Wrong on two fronts. First off, LTT misrepresented the story. What actually happened was that hackers got into verified law enforcement domains to send *seemingly legitimate in every way* requests. The problem here was that law enforcement had terrible cybersecurity, and that should be the focus. Second, companies like Google and Facebook are not in the business of selling your data. They're in the ad selling business, and giving up your data to others means they lose their unique edge. It's still creepy what is collected about you and known by those companies, but they aren't selling it to others.

  • @tyyuuuihycyctct
    @tyyuuuihycyctct 2 года назад

    I most of the time forget to hit the like button, but this very funny episode with this very funny and dynamic duo (who's Batman and who's Robyn?!) forced me to do so.
    Thank you guys! And l love dear words too.. it just sets the mood in the context perfectly.

  • @Phantogram2
    @Phantogram2 2 года назад +1

    Double network thing is actually an android feature already, this can be enabled on pretty much every phone. Enable developer settings and search for dual-channel download and intelligent network connection.

  • @desmond-hawkins
    @desmond-hawkins 2 года назад +4

    Great reporting, LMG! It sure sounds like these companies sent out private data to some random hackers whenever requested, right? Several of the companies listed reported they do this *only* for emails sent from verified law enforcement addresses. Not a word on all these dumb cops who clicked on some random .exe and got their accounts pwned, for "hackers" to use to request data. What would you do if you worked at one of these companies and received the 50th email this month from the same cop, following the same template?

    • @Aereto
      @Aereto 2 года назад +1

      Social Engineering is one of those things to keep training, especially people who aren't into being cautious, which is a stark majority.

    • @dealloc
      @dealloc 2 года назад +1

      Exactly. It's easy to put the blame on companies for not taking privacy seriously, without considering what caused this in the first place. With EDRs it's even more problematic, because there is a time limit; If you spend time to verify the source it could have real consequences in case it was a valid request. There's a lot of pressure.
      There's definitely something to be done on both sides, though. Better communication channels that makes it more difficult for MITM and impersonation attacks, as well as providing separate secure channels for sending this data. Email is just not cutting it. Of course it's a balance between speed and security. Speed is of utmost importance for emergencies, but security is important to avoid attacks like this.

  • @EricRosenfield
    @EricRosenfield 2 года назад +6

    The problem isn’t tech companies, it’s the law that says they have to hand over information to law enforcement immediately if they claim it’s an EDR, which is a privacy nightmare.

  • @Amphy2k
    @Amphy2k 2 года назад

    This is why companies should not comply with these orders unless it’s in paper and handed directly to a legal representative of the company or the head of the company. It poses a MASSIVE security risk.

  • @SunIsLost
    @SunIsLost 2 года назад

    5:50 I waited for something like that.

  • @samijouili
    @samijouili 2 года назад +14

    I bought a Huawei honor view 20 in 2018 for 200$ , it plays every game in ultra quality and it doesn't heat up because of the liquid cooling .During the pandemic they extended my phone warranty for an extra 3 months (impeccable service) . Apple probably made some connections to kick huawei out of the US because they would've definitely taken over .

    • @GSBarlev
      @GSBarlev 2 года назад +2

      I had to Google to check if that the "liquid cooling" comment wasn't an April Fool's joke.

    • @fusokku9212
      @fusokku9212 2 года назад

      i didn't know that some cellphones have liquid cooling. cool

    • @GSBarlev
      @GSBarlev 2 года назад +3

      @@fusokku9212 It's apparently somewhat of a marketing gimmick. It's a *single drop* of evaporated water enclosed in a heat pipe. I'm sure it gets better heat transfer than if there were no pipe at all, but I'm willing to bet a solid copper heat pipe would have done even better.

    • @samijouili
      @samijouili 2 года назад +2

      @@GSBarlev well my phone doesn't heat up when playing pubg or call of duty on Ultra graphics on a 200$ phone so it's probably working.

    • @Quantum-Bullet
      @Quantum-Bullet 2 года назад

      Couldn’t it be CCP funded phone to grab westerner data?

  • @imark7777777
    @imark7777777 2 года назад +6

    Thanks for the comic sands look on the forms I went there and it was already removed I guess that bug got fixed. Thanks to that very detailed bug report that I heard about on the WAN show.

  • @yawnhiccup
    @yawnhiccup 2 года назад

    4:10 Louis Rossmann really channeling through 🤣

  • @rcavicchijr
    @rcavicchijr 2 года назад

    I would love to see the looter looking for old pottery who suddenly comes upon expensive robots and drones that go right to them. Bonus! Thanks Pompeii.

  • @zt9233
    @zt9233 2 года назад +4

    I love that Anthony had to go serious with the concrete jungle bit. What an empath. Anthony was the perfect addition to this channel. I have to say lately seeing how unafraid they are to take on apple totally increased my respect for this channel.

  • @kentoriyama
    @kentoriyama 2 года назад +4

    The internet connection combining thing has been built into windows since at least 7. You just change multiple connections to the same interface metric.

  • @Neoxon619
    @Neoxon619 2 года назад +1

    Damn, hackers. You did it again.

  • @jpsp3901
    @jpsp3901 2 года назад +2

    "I don't wanna be upset all the time."
    LMAO

  • @sussyboii4732
    @sussyboii4732 2 года назад +10

    an Anthony a day keeps the stress away!!

  • @KeithStrang
    @KeithStrang 2 года назад +4

    I usually not one for smiling, but I did a bit here. Thanks Anthony.
    Also, the authorities just might be worse than hackers.

  • @PSkullKidDnazen
    @PSkullKidDnazen 2 года назад

    Anthony's windows 11 untamed agresiveness is my favorite
    if there ever was a channel dedicated to his uncensored rants i'd like, subscribe, hit the bell, share and even (perhaps) disable adblock

  • @roy04
    @roy04 2 года назад +1

    April Fools! We're not actually cops

  • @primozsagmeister7692
    @primozsagmeister7692 2 года назад +3

    Because of privacy I use add blocker. What do you think about that?

    • @chaos.corner
      @chaos.corner 2 года назад

      Have you tried sponsor block?

  • @MegaMech
    @MegaMech 2 года назад +3

    Wasn't Samsung always pretty good for parts?

  • @Pepsiman2006
    @Pepsiman2006 2 года назад

    I did get a chuckle out of Razer's Batman & Robin reference with the suit-up sequence.

  • @HauntedSheppard
    @HauntedSheppard 2 года назад

    Concrete jungles tend to offer enough oppertunity to touch a certain kind of grass

  • @snowyowlnugget
    @snowyowlnugget 2 года назад +4

    Anthony finally hosted one again! yay!

  • @user-wq9mw2xz3j
    @user-wq9mw2xz3j 2 года назад +23

    ah, the one reason to pick a 2x priced apple phone instead of another...

    • @krazymeanie
      @krazymeanie 2 года назад +4

      another what? 2x priced samsung phone?

    • @Konkov
      @Konkov 2 года назад

      @@krazymeanie 16gb of ram 120hz 4K display is not overpriced

    • @halcyonacoustic7366
      @halcyonacoustic7366 2 года назад +1

      @@Konkov cope lmao 🤣
      The iPhone SE and the Galaxy S2x FE edition are both reasonably priced options but all flagship phones over $1000 are way too expensive.

    • @bartomiejkomarnicki7506
      @bartomiejkomarnicki7506 2 года назад +9

      @@Konkov 16 gb of RAM is as useless as 4k display on a phone and both of those things drain battery, waste of money

    • @braydenmiranda6795
      @braydenmiranda6795 2 года назад

      @@Konkov while I’d understand that for a laptop or even a tablet, that is next to useless specs for a phone. If you have money to burn sure, but anyone wanting actual value out of their products could not justify having that kind of phone

  • @junkyatv
    @junkyatv 2 года назад +1

    The spot dogs at Pompeii remind me of Breath of the Wild guardians...

  • @tellur808
    @tellur808 2 года назад +2

    The two Internet connections at the same time is extremely interesting if it also means you can have two different VPNs open at the same time. Often you need to be connected to different clients with different VPNs, even if typically one is just to monitor something. Or maybe in a home office setting you want to be connected to your company's network and the client's.

    • @ohioplayer-bl9em
      @ohioplayer-bl9em 2 года назад

      The VPN I use at work and have been setting up for folks for a long while (fortigate) doesn't work at all with express connect on dells. We recently switch from using HP to Dell and I could not get some of the laptops to work on the VPN. Turns out you uninstall the Express Connect software and everything works again. It's garbage if you ask me. I pulled my hair out staring at packet tracers for a day so I maybe biased. That's the first thing I uninstall when setting up a new laptop for anyone now. Express Connect sucks

    • @tellur808
      @tellur808 2 года назад

      @@ohioplayer-bl9em networking is magic voodoo bullshit 80% of the time.
      One client's VPN refuses to work with a particular ISP (obviously the one I use privately and professionally). Took me an incredibly long time to find out that this particular VPN doesn't work wit IPv6 and the standard MTU setting basically everyone uses. Reduce it by 5 and the VPN works fine.

  • @MusicToTheEars141
    @MusicToTheEars141 2 года назад +5

    What if for April Fools they didn't give us the tech news?

  • @imark7777777
    @imark7777777 2 года назад +5

    So that's what I have to do to avoid getting forcibly upgraded to Windows 11! That's not a bug it's a feature!

    • @disketteguy
      @disketteguy 2 года назад

      it's a feature that no one wants

  • @BobSentell
    @BobSentell 2 года назад

    The Dell two network thing is huge. Corporate VPNs suck at setting up passthroughs. Being able to use my wired for intranet connections while still maintaining a real connection to the internet would be outstanding.

  • @0s0sXD
    @0s0sXD 2 года назад

    Louis Rossman reference was top notch. Top notch

  • @_D3adB0y_
    @_D3adB0y_ 2 года назад +3

    I have to say, the MTT cards visually look amazing. Way better than the rgb nonsense companies make these days

    • @Artista_Frustrado
      @Artista_Frustrado 2 года назад

      i think that's what the Server AMD cards look like

  • @aidsman667
    @aidsman667 2 года назад +3

    Man, I love how unhinged Anthony gets in these videos

  • @FANLESS
    @FANLESS 2 года назад

    "We're talking about posting a link here." gave me Ted Lasso/Allen Iverson vibes!

  • @MementoMurray
    @MementoMurray 2 года назад

    1:28
    why is the page in comic sans lmfao

  • @SkylerB17
    @SkylerB17 2 года назад +6

    i love Anthony's Tech Linked Episodes. Also how the fuck do mega corps give information to fake authorities?!?!?! i mean literally, how does that happen? im asking a genuine question because im completely baffled as to how thats even possible. is there not a process for a company to give sensitive info to law enforcement? is there not some kind of confirmation happening like contacting that actual Agency to determine whether the people requesting the info are in fact legit? did these companies receive an email from these supposed Law Enforcement Agencies asking for sensitive data and Apple and them were just like, "yea ok, thats legit." Like i am completely fucking confused.... it doesnt even make sense!!!! They were hackers so how did they request the info? if it was in person face-to-face, then the companies should have contacted the agency itself confirming the identity of said individuals. if it was thru email or over the internet somehow... THEN THESE COMPANIES SHOULD HAVE CONTACTED THE ACTUAL FUCKING AGENCY CONFIRMING THE LEGITIMACY OF THE REQUEST!!!!! WHAT IN THE ACTUAL FUCK?!?!?!!??!

  • @chilpeeps
    @chilpeeps 2 года назад +3

    This is very disappointing that even spending 1000usd is not enough to safeguard your data , but I don’t have a choice now.
    I am missing blackberry os

    • @mycosys
      @mycosys 2 года назад

      pinephone on linux is a fair bit less

  • @WindySilver
    @WindySilver 2 года назад

    That "**** you, Riley" caught me off-guard even though I watched LTT's April Fool's video before this XD

  • @DarthCircuit
    @DarthCircuit 2 года назад

    My favorite part of this video is that the news articles are in Comic Sans

  • @AmeanAbdelfattah
    @AmeanAbdelfattah 2 года назад +3

    Happy Ramadan!

  • @yathuarulnanthy5822
    @yathuarulnanthy5822 2 года назад +6

    Who else loves Anthony?

  • @irontarkus7965
    @irontarkus7965 2 года назад

    6:30 gives me The Talos Principle vibes. Not sure if good thing or bad thing 😬

  • @zachross2214
    @zachross2214 2 года назад

    with the wifi + ethernet thing, killer already had this in gaming laptops and called it double shot pro, i own a sager (rebranded clevo) that has the double shot pro option from killer

  • @3v068
    @3v068 2 года назад +3

    I have to give Samsung credit. They are doing good with right to repair. Let's see how well this will actually hold up in the long run. It might actually make me buy a Samsung phone.

    • @3v068
      @3v068 2 года назад

      @Carl Gunderson not gonna lie, same here

  • @yousifkahin3117
    @yousifkahin3117 2 года назад +10

    first

  • @alexthemtaandr211weatherfa2
    @alexthemtaandr211weatherfa2 2 года назад

    6:50 that’s a boring job for a robot dog 🐶.

  • @lilythecat3687
    @lilythecat3687 2 года назад

    I CAN'T BELIEVE IT! When I could not get into my acc w a correct password, (many people claim it), I spent for 1 month, and a telephone operator changed to a senior engineer, and we finally gave up after 1 hour or more time. They said to keep it really strong, Apple doesn't keep my password. Only I can get into it. (and I could not.) He said actually he made his account 3 times, sometimes it happens ... or like that. I made a new acc... but, WHAT?

  • @ChiralWolf
    @ChiralWolf 2 года назад +1

    "customer-first care" is an excellent way to spin right to repair into a positive marketing thing for these greedy corporations

  • @saswatsarangi6669
    @saswatsarangi6669 2 года назад

    How can they not be sure or investigate or ensure they're real authorities

  • @simpleserpent1337
    @simpleserpent1337 2 года назад

    4:09 Andy goes savage for second video straight

  • @fanstalingibs5585
    @fanstalingibs5585 2 года назад

    *a year in, and windows 11 still has the stupid audio crackling and desync info for me*
    And i *CANNOT* find a solution

  • @Innuya
    @Innuya 2 года назад

    1:25 is that comic sans? A reference to the fact many Samsung users use it as their default font? If so, amazing editorial direction!

  • @gpturismo
    @gpturismo 2 года назад

    We need a LTT store "Companies aren't your friends" shirt that looks like the more you know graphic.

  • @matamanthemaster
    @matamanthemaster 2 года назад

    The perfect entry point into the mechanical keyboard community is the GMMK or the new GMMK 2. Glorious also have the glorious guild forums for enthusiasts, as part of a loyalty programme.

  • @awwastor
    @awwastor 2 года назад

    0:50 ah, the hackers got a phone book with emails