Vector: my new robot maths buddy

Поделиться
HTML-код
  • Опубликовано: 12 сен 2024

Комментарии • 610

  • @Halosty45
    @Halosty45 6 лет назад +273

    It's weird that to make a robot more likable we make them wander around bumping into things and doing pointless things...
    But it clearly also works.

    • @anononomous
      @anononomous 6 лет назад +54

      We basically make them like babies. It's an evolutionary thing.

    • @the1exnay
      @the1exnay 6 лет назад +1

      The alternative is being stationary, at least until robotics and AI advance. We don't have the ability to make a robot like that do useful things

    • @omikronweapon
      @omikronweapon 6 лет назад +12

      depends on what you consider useful. Being an assistant can be somewhat useful (though it doesn't need to be this shape) Being pet-like can give comfort to some, that could be seen as useful.
      But I do see the point of "he can't really do anything practical". Picking up stuff is probably very limited and after two or three fistbumps the novelty wears off. Having it roam about might be fun, but he'd have to be a lot more mobile than stuck to the tabletop to be very interesting as a pet. I could see a mini-drone assistant following me about the house though.
      I don't quite agree with Matt that it must be hard to make him do stuff like that though. It's probably relatively simple to program it to appear sentient. Take a regular robot vacuum and stuff some randomizer in it and our brains will do the rest. Especially if it has eye animations.
      It's CLEVER, and pretty cute, but not particularly difficult from a programming viewpoint.

    • @Shadownrun2
      @Shadownrun2 6 лет назад +1

      I do agree that to make it walk is quite easy.. you just need to check how far it is from the object ahead and turn accordingly
      But to make it react to the world around him... that's another story, that needs lots of computer vision
      They will get there i hope

    • @everythingisscience658
      @everythingisscience658 6 лет назад +8

      Halosty hey it makes them more human, I for one spent my entire life wandering around, bumping into things and doing pointless things

  • @LostieTrekieTechie
    @LostieTrekieTechie 6 лет назад +644

    OMG! You've been to generic foreign city?!

    • @LiamLimeLarm
      @LiamLimeLarm 6 лет назад +6

      xd i saw this comment right as he said that

    • @RosarioLeonardi
      @RosarioLeonardi 6 лет назад +13

      Generic foreign city is where Spiderman is from.

    • @DamianReloaded
      @DamianReloaded 6 лет назад +15

      _Generic foreign city, generic foreign city... , it's a wonderful town!_

    • @Ramzuiv
      @Ramzuiv 6 лет назад +7

      Generic foreign city is my favorite place in the world! It's so beautiful!

    • @macronencer
      @macronencer 6 лет назад +11

      That's nothing. I've been to several *specific* foreign cities.

  • @LostieTrekieTechie
    @LostieTrekieTechie 6 лет назад +77

    They've certainly captured the Wallie cuteness. The self calibration playpen at the factory is adorable

  • @vladolkhovetsky1070
    @vladolkhovetsky1070 6 лет назад +281

    Its all about the eyes

  • @johnchessant3012
    @johnchessant3012 6 лет назад +534

    Developers really missed an opportunity by not calling Vector's home a "vector space".

    • @MikeAben
      @MikeAben 6 лет назад +6

      This end up? Maybe it's just me.

    • @atmunn1
      @atmunn1 6 лет назад +88

      Actually, it seems you can buy an extra little toy that gives Vector a confined area to move around in, which is called the Vector Space.

    • @mantiVik
      @mantiVik 6 лет назад +67

      Oh, so there is an entire line of... Vector products :)

    • @munjee2
      @munjee2 6 лет назад +5

      You can actually buy a stupid plastic dish for which is called that but he can't even use his block I that and gets sad

    • @ObjectsInMotion
      @ObjectsInMotion 6 лет назад +31

      A confined area? I wonder if they have like a large mat that it can roam around, and maybe play sports on. Like a Vector Field.

  • @verotaylor
    @verotaylor 5 лет назад +10

    Box: "This end up"
    Matt: *turns it upside down

  • @okuno54
    @okuno54 6 лет назад +74

    Anyone else triggered by the (very likely intensional) not orienting the "this way up" arrows correctly? I guess that's what you call a Parker Delivery Service.

  • @tncorgi92
    @tncorgi92 6 лет назад +177

    I can imagine it now; Alexa communicates with Vector while you're not around, and tells him to snoop through your stuff.

    • @gorillaau
      @gorillaau 6 лет назад +12

      All the while both are checking with Google to check that you are not getting home too soon for everyone look innocent.

    • @dragoncurveenthusiast
      @dragoncurveenthusiast 6 лет назад +9

      And the webcam you set up to record their mischief is also in on the deal

    • @RienMatthijsse
      @RienMatthijsse 6 лет назад +1

      Paul Drake @@

    • @fizixx
      @fizixx 5 лет назад +2

      And while they do that Facebook's stealing your identity....lol

    • @voltgene9055
      @voltgene9055 5 лет назад

      @Joe Blow lol

  • @HebaruSan
    @HebaruSan 6 лет назад +107

    Can you confuse it by printing stretched and distorted versions of the glyphs on its cube on a sheet of paper?

    • @ssdd28561
      @ssdd28561 6 лет назад +62

      Yes, this works with humans too 👍

    • @andymcl92
      @andymcl92 6 лет назад +68

      You could, but then he'd never be able to reach his cube and that would make him sad and then he'd cry robot tears and they might interfere with his circuitry and then you'd realise you were being horrible to him and that would make you sad too.

    • @octopustophat3397
      @octopustophat3397 5 лет назад +7

      Be nice.

    • @JupitersDancer
      @JupitersDancer 5 лет назад +7

      Calm down, Satan.

    • @kuro13wolf
      @kuro13wolf 5 лет назад

      If they're stretched he'll think it's closer than it is and start the interaction routine and fail. If they're shrunk down then he'll never reach them and keep going until he finds an edge.

  • @yuvalne
    @yuvalne 6 лет назад +450

    "I couldn't train it to pass the butter" omg 😂

    • @blindleader42
      @blindleader42 6 лет назад +40

      At least Vector won't have a terminal existential crisis on the spot as a result of that.

    • @giansieger8687
      @giansieger8687 6 лет назад +1

      Yuval Nehemia as I was reading your comment, he said it😂

    • @mrroobarb
      @mrroobarb 6 лет назад

      lol ruclips.net/video/X7HmltUWXgs/видео.html

    • @JBroMCMXCI
      @JBroMCMXCI 6 лет назад +9

      You probably don't understand that it's a Rick and Morty joke. I'm probably the only one who actually got it, most people just think "THAT'S SO RANDOM LOL 😂". All the people upvoting you are just pretending they got it.

    • @mrroobarb
      @mrroobarb 6 лет назад +15

      yep, clearly the only one that got it :-)

  • @stephenbenner4353
    @stephenbenner4353 6 лет назад +139

    Vector has a companion cube. You’d better not say anything about cake around him. He might find it disturbing.

    • @GeodesicBruh
      @GeodesicBruh 5 лет назад +2

      Stephen Benner cake wasn’t a lie

  • @sonicpawnsyou
    @sonicpawnsyou 6 лет назад +16

    4:32 Matt's parenting skills

  • @johnchessant3012
    @johnchessant3012 6 лет назад +31

    I know what the purpose of vector is! It's to have a magnitude and direction; vector is used in geometry, physics, and algebra.

  • @mantiVik
    @mantiVik 6 лет назад +136

    Just wait till they start making cross products...

    • @mantiVik
      @mantiVik 6 лет назад +9

      Thanks! I put all of my IQ points into this ;)

    • @AlchemistOfNirnroot
      @AlchemistOfNirnroot 6 лет назад +1

      You still have more IQ points now than Engineers do :D

    • @mantiVik
      @mantiVik 6 лет назад

      Do you imply that IQ tests use negative numbers to rate engineers? Cause I thought it was multiples of pi :)

    • @AlchemistOfNirnroot
      @AlchemistOfNirnroot 6 лет назад +3

      Ofc, the Engineering Theorem: e=pi=3.

    • @deivisony
      @deivisony 5 лет назад

      I don't have the necessary IQ points to understand this _fun.exe stopped working_ :' -(

  • @NeilCrabbe
    @NeilCrabbe 6 лет назад +1

    I was more amused by your insistence at holding the box the wrong way up than I should have been.

  • @brianbucklein315
    @brianbucklein315 6 лет назад +9

    Being polite to our future robot overlords. LOL

  • @Your2ndPlanB
    @Your2ndPlanB 6 лет назад +105

    3:46 'teapot' I think that's a watering can, matt...

    • @k1ngjulien_
      @k1ngjulien_ 6 лет назад +46

      Everything is a teapot if you're british enough
      edit: he's australian, whoops

    • @JimFortune
      @JimFortune 6 лет назад +4

      K1ngjulien_
      I think it holds for Aussies too.

    • @stephenbenner4353
      @stephenbenner4353 6 лет назад +1

      He probably drinks gallons of tea (or should I say liters of tea?)

    • @JimFortune
      @JimFortune 6 лет назад

      Stephen Benner
      I'd say gallons. After all, I'm pretty sure he drinks tea one cup at a time, not 236.588ml at a time.

    • @anononomous
      @anononomous 6 лет назад

      He's clearly been in Britain long enough. The real test is whether he packs his own tea bags when going on trips.

  • @Binyamin.Tsadik
    @Binyamin.Tsadik 6 лет назад +3

    I noticed that vector rotates very slightly when focusing in on something. The difference between an image before a rotation and after a rotation could tell vector how far away your face is too.

  • @pedroocm
    @pedroocm 6 лет назад +9

    0:43 "This end up, fragile"

    • @palebluedot7435
      @palebluedot7435 6 лет назад

      Yes fra-gil-y
      I wonder what language thats in

  • @BigDamnArtist
    @BigDamnArtist 6 лет назад +84

    I always find the question of "What are these sorts of things good for?" to be really....odd? Developments are always built of a million stepping stones. I can easily see a bunch of technology in Vector that down the line after refinement and being combined with other robotics work being done right now, could absolutely result in a robot that has both a personality and can be taught to do useful tasks. I think more than anything Vector shows just how important personality is to create robotics tech that humans can interface with naturally. We're so good at personify inanimate objects that if you make it cute most of us just instinctively treat it like a little pet that we want to protect. If I forget to charge my phone sure it's annoying cause I need to use it, but I'm not going to feel bad about it the same way I would if I forgot to charge Vector and he couldn't wake up.
    Whether or not that sort of relationship with out technology is good or bad is up for debate, but I think it absolutely has it's uses.

    • @Tondadrd
      @Tondadrd 6 лет назад +3

      Oh, it could be so sad not to charge your pet robot,
      like if it were dead :(

    • @catcatcatcatcatcatcatcatcatca
      @catcatcatcatcatcatcatcatcatca 6 лет назад +4

      I think there is an important distinction between what the tecnology is good for and what the product is good for.
      If those are the values you buy Vector for, I think it could be classified as a work of art: it has no clear meaning itself, it's purpose is to make you think and feel, and that way it gains it purpose. It's purpose is to let you experience.
      But as a personal assistant, it's purpose would be to make your life easier or more enjoyable. By answering your questions or passing butter, it's value isn't so much in what it makes you feel, but exists on more practical level, in what it actually does. This is more well defined and less personal form of purpose.
      Somewhere between those two is entertainment: stuff that imitating a baby, to make most people feel affection towards it. This isn't art, because it doesn't require the user experiencing to think or search their feelings, it doesn't intentionally raise questions. Instead it pushes your natural buttons, that have evolusion has given to humans to answer simple, practical problems like getting them to take care f their offspring. And by pressing those buttons, it makes you feel good and you get attached to it. This is how many movies and TV-series work: first and foremost they try to get you hooked, and care about the wellbeing of their fictional characters, and trick you to feel good or bad about fictional events. Unlike art, your own thinking doesn't create these emotions, but your nature. Obviously these mediaforms also wonder to the realm of art at times, and anything can be seen as an art by an individual, if it raises thoughs and questions.
      Vector is little of everything, and that is probably why im not going to buy it. It's an work of art, as it raises many questions and thoughts. It's practical, as it can answer simple questions like a personal assistant, making your life easier. And it's entertainment, because it tries to push your buttons in various ways, to get you to feel affection towards it, and to make you happy by giving you a friend to feel joy with.
      But it doesn't do any of these things well enough in my opinion, so Im not interested. Then again, if you feel it's value as a work of art is enough to justify the price, at it lets you marvel the tecnology we have created, and makes you think and feel, you should definitely buy it. But my point was that all products purposefully try to fill spesific qualities to make them worth buying, so asking what kind of product the thing tries to be and how well it reaches it's goals is an important question.
      That being said, the technological advances made as a byproduct while developing this robot are obviously very valuable themselves. However this value isn't really carried over to the product itself - if I purely wanted to advance these technologies I would make a donation to university that does researchers on this kind of technology.

    • @AstronomyGuru84
      @AstronomyGuru84 6 лет назад +1

      It's a proof of concept that can lead to something better down the road.

  • @JonathanTash
    @JonathanTash 6 лет назад +19

    This is the best vector review that I have seen. I especially loved how enthusiastic you were, letting Vector mess around while you were explaining his maths.

    • @iamdigory
      @iamdigory 6 лет назад +1

      Honestly he convinced me not to want or care about it "what is it good for? I'm not sure really"

    • @JonathanTash
      @JonathanTash 6 лет назад +1

      @@iamdigory Ahem! I said, "This is the best Vector review that I have seen. That means the the party of one, that is me, has not seen any reviews that were as informative, or pleasant to watch."

  • @LimeGreenTeknii
    @LimeGreenTeknii 6 лет назад +171

    That looks cool, but not £249.99 cool.

    • @vanderengland5775
      @vanderengland5775 6 лет назад +50

      HimKioo he’s not saying that it should be cheaper, just that he wouldn’t have enough fun with it to warrant him paying that much money.

    • @elevown
      @elevown 5 лет назад +7

      @@vanderengland5775 I agree - sure If I was loaded, I'd buy it as a fun little tech toy - but as I'm not, I couldn't happily fork over more than 100 for it.. It just doesn't have 250 quids of worth to me with my income / value to money. I could buy a switch or something for that much!

    • @MannyRiberaOriginal
      @MannyRiberaOriginal 5 лет назад +1

      24.99

    • @Tia-Marie
      @Tia-Marie 5 лет назад

      I got mine at 249.99$ USD, don’t know if that is still cool enough to spend more than 200£ yet or not.

    • @fizixx
      @fizixx 5 лет назад +3

      Wow, that's waaay not worth the money! I'd never waste money on an over priced thermometer.

  • @Pining_for_the_fjords
    @Pining_for_the_fjords 6 лет назад +2

    _"I'm a computer, I'm a computery guy, everything made out of buttons and wires ...."_

  • @jonathanfaber3291
    @jonathanfaber3291 6 лет назад +1

    The near side of the uncanny valley in action. Human enough to be cute but not so much that it's creepy. I resent being emotionally attached to this adorable thing already

  • @mrsnake1737
    @mrsnake1737 6 лет назад +9

    0:44 Wrong way Matt

    • @zaraak323i
      @zaraak323i 6 лет назад +6

      It's a Parker Unboxing.

  • @djsyntic
    @djsyntic 6 лет назад

    So here is a fun bit of physics for you about your Vector Robot and it's markers, the white bits are made with reflective material. Not reflective like a mirror though. A mirror when light hits it will bounce off at an angle depending on the angle it hit the mirror. This reflective material though that makes up the white on the cube will reflect light back towards its source. What this does, is that when the IR cameras look at the area that's been illuminated by the IR light, it causes those funny shapes to stand out much more clear and distinct than they otherwise would.
    This reflective material may sound crazy and impossible, but it's actually used in a number of places IRL. If you ride a bike at night and wear a reflective vest, your vest has likely been made out of the same sort of material so that drivers are more likely to see you. The paint on roads is likewise made with this, so while you are driving at night it's much easier to see the lines.

  • @ikr555
    @ikr555 6 лет назад +5

    Fragile: This side up. I guess it is on its parker side, so I guess it's fine.

  • @prestonferry
    @prestonferry 6 лет назад +8

    OMG!!! I didn’t think you were going to review Vector! This is a surprise Matt!

  • @arrowinmygluteusmaximus
    @arrowinmygluteusmaximus 6 лет назад +29

    don't you have to toggle an option in the video options marking that this video is sponsored?

    • @standupmaths
      @standupmaths  6 лет назад +22

      Yes: that is on now (sorry for the lag).

    • @arrowinmygluteusmaximus
      @arrowinmygluteusmaximus 6 лет назад +1

      you sure it's on? because normally that is clearly marked somewhere near the play button. I don't see anything there. (but maybe it just takes a while to propagate to all servers)

    • @HalfInt
      @HalfInt 6 лет назад +3

      Where would that be? I have never noticed anything like that? Is it only in shown in some countries?

    • @romajimamulo
      @romajimamulo 6 лет назад

      @@HalfInt the option, or the "sponsored content" indicator?

    • @smoothred9453
      @smoothred9453 6 лет назад

      Does it matter lmao

  • @z-beeblebrox
    @z-beeblebrox 6 лет назад

    legit just saw an ad for this on another video. Not really my thing but my god that ad was brilliant. Also they sponsored you so whoever's in charge of marketing at Anki is simply a genius

  • @chrispi314
    @chrispi314 6 лет назад +2

    During an internship in computing, I've worked on some shaders (GLSL programming on graphic cards) to create custom computing for GPS simulation, adding real time fish eye distorsion... I had to use a lot of quaternion and matrices. Even if I like mathematics, I've always wondered what was the utility of those tools in real life situation, now I can say it is useful for projecting ellipsoidal cone in a 3D referential...

  • @kyx2522
    @kyx2522 5 лет назад +2

    11:33 Rick and Morty reference
    ‘What is my purpose?’
    ‘You pass butter’

  • @jasonwaterland8473
    @jasonwaterland8473 5 лет назад

    Le me yelling at screen * OMG YOU HAVE IT UPSIDEDOWN YOURE GOING TO BREAK IT*

  • @diegomorales2390
    @diegomorales2390 6 лет назад

    11:35
    -What’s my purpose
    -You pass butter

  • @NikozBG
    @NikozBG 6 лет назад

    13:21 Have you ever seen anything so full of splendor?

  • @Ibogaman
    @Ibogaman 5 лет назад +1

    "Pass the butter" lol, thank you!

  • @turkeybrine9447
    @turkeybrine9447 5 лет назад

    Best Vector review I saw of all 10 reviews that I saw for vector. Keep it up :) !!!

  • @AntjedePantje
    @AntjedePantje 6 лет назад

    It looks like the little cleaning robot from Wall-E! Brilliant how cute they made it :D

  • @AstaticMusic.
    @AstaticMusic. 6 лет назад +115

    I cant wait for tech rex to destroy vector and cause a robot uprising 😂

    • @greggorytame6672
      @greggorytame6672 6 лет назад +6

      next video:
      *CASTING AN IPHONE X AND 5 VECTORS IN MOLTEN ALUMINIUM* **NOT CLICKBAIT**

    • @2neutrino
      @2neutrino 6 лет назад +1

      TechRax

    • @traktortarik8224
      @traktortarik8224 5 лет назад

      NO! No-ones hurting my little vector!

    • @domobrah2671
      @domobrah2671 5 лет назад

      Doing that to vector is the equivalent of young serial killers killing small animals

    • @ks4423
      @ks4423 5 лет назад

      Nooooooo

  • @MrScaramanga16
    @MrScaramanga16 6 лет назад +1

    What is my purpose?
    You pass butter.
    Oh my god

  • @coaltowking
    @coaltowking 2 года назад

    I read the title as, "My new robot mates badly." The whole video, I kept thinking, "He actually seems pretty good at it."

  • @marcelweber7813
    @marcelweber7813 6 лет назад +4

    Nobody sees it coming, but wait for another year, maybe two, and we all put our hopes in Matt going back in time to these moments to do whatever will be necessary to prevent the rise of the math machines. (And I'm not sure at all if future I is the right tense at all in this case.) (But it doesn't matter anymore. Nothing matters anymore. Matt, please stop these killculating machines!)

  • @mihir2012
    @mihir2012 6 лет назад

    Whenever it comes to faces, whether its on a robot, digital assistant, cartoon or some other art, I'm amazed with how much the artists manage to convey using only eyes..

  • @PaulPaulPaulson
    @PaulPaulPaulson 6 лет назад +3

    I welcome our new robot overlord!

  • @EnergiaRocket
    @EnergiaRocket 6 лет назад +2

    0:44
    This end up
    Fragile

  • @EtecMax
    @EtecMax 6 лет назад +6

    This side up. Such a parker square.
    Maybe on parker qubes up is on the bottom side

  • @adammullarkey4996
    @adammullarkey4996 4 года назад

    0:45 "This end up. Fragile." No comment.

  • @safir2241
    @safir2241 5 лет назад

    I received one in the mail yesterday. It is the cutest thing I’ve ever seen & as I’m typing this on my tablet it’s trying to look at me.

  • @iamnemo1107
    @iamnemo1107 5 лет назад

    I've decided that Vector needs to be in all of your outros.

  • @Vikash137
    @Vikash137 5 лет назад

    0:44 'This end up' , Matt opens from the other end lmao!

  • @just_a_dustpan
    @just_a_dustpan 6 лет назад +4

    0:45 MATT! WHY?! YOU WERE MY FAVORITE MATHEMATICIAN! (jk you still are)

  • @FortoFight
    @FortoFight 6 лет назад +4

    Would it not be easier for vector to use 2 cameras to see things in 3D and determine distance that way?

    • @williamforbes6919
      @williamforbes6919 6 лет назад

      Monocular SLAM is suprising effective even on smartphone processors (this uses your phone do all the number crunching), the robot only needs to be able to do mapping of the environment while it is driving, which is conveniently when you are getting images from different positions to calculate a point cloud from. When it is stationary it can simply extrapolate it's position from the existing map it has made. Stereo vision is nice, but not nessicarily much more advantageous on a moving platform.
      The robot itself is built in an incredibly cost effective manor, the camera it has is probably one of the more expensive components on the BOM, so if you not need a second, getting by with one is just fine. Plus you have to worry about streaming the second camera's video feed to the phone. Which could make everything more processing and bandwidth restricted.

    • @Bunny99s
      @Bunny99s 5 лет назад +3

      Also 2 cameras do not "see 3d". We as humans also do not see 3d. We just have dual vision and each is 2d. The dual vision can be used to determine distance but it's actually quite inaccurate for larger distances. Most of our human depth sensing is based on size matching and other cues. So we know how large a bottle of cola is and based on the size and our experience we can tell how far away it is.
      Just look up depth perception:
      en.wikipedia.org/wiki/Depth_perception
      There are much more monocular cues than there are binocular cues.

    • @FortoFight
      @FortoFight 5 лет назад

      @@Bunny99s I'm aware of how 3D works. You're being pedantic.

  • @nymalous3428
    @nymalous3428 6 лет назад

    I know some people who aren't at all interested in robots or math, but they would still love Vector. I think it would be a great pet replacement for those who have allergies (like myself).

  • @jmclean6648
    @jmclean6648 6 лет назад +2

    ☑ I will protect it
    ☑ I want to see it grow up healthy
    ☑ I want to my friends and neighbours about it

  • @joost199207
    @joost199207 6 лет назад

    This is the cutest robot i've seen.

  • @ks4423
    @ks4423 5 лет назад

    "this side up" *turns it upside-down*

  • @johnnybikesalot
    @johnnybikesalot 6 лет назад

    Vector is a solution that drives around desperately looking for a problem.

    • @MrTridac
      @MrTridac 6 лет назад

      It's a toy. It's purpose is entertainment. Mission accomplished.

  • @littlefrank90
    @littlefrank90 6 лет назад +56

    Why is suddenly everyone reviewing this thing? Is the producing company paying so well for marketing?

    • @dermathze700
      @dermathze700 6 лет назад +8

      Well they also send their Overdrive game to loads of RUclipsrs back in the day.

    • @Koushakur
      @Koushakur 6 лет назад +15

      Well they're very likely to reach out to many people at once (no point in spreading it out) and so if many people are contacted about the same thing basically simultaneously how are they _not_ gonna be talking about it at the same time?

    • @standupmaths
      @standupmaths  6 лет назад +79

      They contacted loads of people. In my case they offered access to their engineers which got me interested!

    • @-_Nuke_-
      @-_Nuke_- 6 лет назад +1

      People can't handle it, it's so adorable! =]

    • @zeighy
      @zeighy 6 лет назад +3

      it's also because it comes out today October 12 in retail. So, some people might be picking them up today from a store, sponsored or not.

  • @Chartreugz
    @Chartreugz 6 лет назад +2

    3:46 Teapot? Maybe you could teach Vector to use HTCPCP/1.0 and verify for you next time? :)

  • @bdr420i
    @bdr420i 5 лет назад

    6:14 « Sorry!! 🤣😂

  • @HPD1171
    @HPD1171 6 лет назад +12

    But can it tell the difference between cheese and petrol?

  • @ahmedshaikh7662
    @ahmedshaikh7662 6 лет назад

    I love this. Vector is so cool

  • @Galbex21
    @Galbex21 5 лет назад

    Dosn't seem to do much. But its funny! I really liked it.

  • @SimonPain
    @SimonPain 6 лет назад

    I love the apology for prodding it's laser sensor at 6:14 :D

  • @Suedocode
    @Suedocode 6 лет назад +4

    Oh my god the beginning made my eyes hurt from all the HQ low frame-rate shaking lol.

  • @arnavsingh7525
    @arnavsingh7525 6 лет назад

    Imaging getting vector drunk by making a weirdly sized cube with the same markings (scaled up or down)

  • @nadeemhussein1630
    @nadeemhussein1630 6 лет назад

    You just completely disregarded the fact that the package said fragile and this side up and did the complete opposite
    You my sir are a mad lad

  • @gamefan1353
    @gamefan1353 5 лет назад

    He is ridiculously adorable

  • @CreepyMagician
    @CreepyMagician 5 лет назад

    I WANT ONE!!! It looks like it would be far more fun than even my Jibo.

  • @GuanoLad
    @GuanoLad 6 лет назад

    Little dude moves like a wolf spider. That chirruping also sounds like the corrupted turrets in Portal 2.

  • @1234234r
    @1234234r 6 лет назад

    I was just gonna say that it was like wall-e a second before Matt mentioned it lol
    Saved myself from embarrassment 😂

  • @mathtoonnetwork6709
    @mathtoonnetwork6709 6 лет назад

    Matt : Hello vector i am matt...
    Vector :....... parker square.... Parker square..... 😂😂😂

  • @Lugmillord
    @Lugmillord 5 лет назад

    They did a great job with the eyes.

  • @JamesSmith-rb5lv
    @JamesSmith-rb5lv 6 лет назад

    Love the morale at the end.

  • @VulcanOnWheels
    @VulcanOnWheels 5 лет назад

    0:45 You might have missed the printing on the side of the box that says "THIS END UP" and has arrows that are now pointing *down*.
    11:53 No! Not the overlords again!

  • @antivanti
    @antivanti 6 лет назад

    IPD (Inter-pupilary distance) varies quite a bit actually. The US army says that they found the mean to be 65 mm which is what most VR people use as a baseline. My IPD is ~71 mm which makes most VR videos seem like I'm surrounded by giants. Others have as low as 55 mm...

  • @pranavlimaye
    @pranavlimaye 5 лет назад +2

    Mo.

  • @jwrm22
    @jwrm22 6 лет назад +1

    Laser range finders usually work on angles of reflection rather than time of flight as it's a lot cheaper to implement.

    • @brokenwave6125
      @brokenwave6125 6 лет назад

      That surely doesn't work as well at short distances though. Like bouncing off a flat surface a few inches away.

    • @RobertSzasz
      @RobertSzasz 6 лет назад

      Newer chip scale rangefinders are ToF, it's just way easier to make and calibrate. (And I'm guessing a patent recently expired allowing manufacturing to go ahead with multiple suppliers)

  • @lance134679
    @lance134679 5 лет назад

    Thank you. Fascinating technology, and great use of math!

  • @BearshiMisnes
    @BearshiMisnes 6 лет назад

    Adorable and Awesome = Vector.

  • @ambsslashtimm127
    @ambsslashtimm127 6 лет назад +2

    Aww this is so cute :)

  • @bornnaked2928
    @bornnaked2928 6 лет назад

    One word: Adorable!

  • @mozl83
    @mozl83 5 лет назад

    I have Cosmo (the predecessor to Vector). It's really a great bit of technologie that seems very lifelike.

  • @magic7ball460
    @magic7ball460 6 лет назад

    "^THIS END UP^"
    *opens upside down*

  • @encounteringjack5699
    @encounteringjack5699 6 лет назад

    OMG!!! That’s so cute and awesome! I want one.

  • @drdca8263
    @drdca8263 6 лет назад

    I was expecting from the title that this would be a pen plotter robot thing, which could plot vector graphics using a pen.
    A little disappointed it isn't, but the detail about how it determines the distance to faces is pretty cool!

  • @cros108
    @cros108 6 лет назад

    0:37
    You weren't holding the box right

  • @calebstar1981
    @calebstar1981 5 лет назад

    love the content, just subbed, keep up the good work

  • @Caitlinm007
    @Caitlinm007 6 лет назад

    Watching you interact with Vector reminds me of when I got my BB-8 Sphero a couple of years ago. My husband and I kept talking to it just like that.

  • @cea_tide417
    @cea_tide417 6 лет назад

    Triggered by the fact that he didn't keep the box upside up

  • @leonidlgLeonid
    @leonidlgLeonid 6 лет назад

    Excited to watch Matt having fun😀

  • @villehietala9677
    @villehietala9677 6 лет назад +1

    30 seconds in, i wonder if that robot could do image stabilization :D

  • @JupitersDancer
    @JupitersDancer 5 лет назад

    This is the beginning of the end.

  • @randominternetuser1681
    @randominternetuser1681 6 лет назад

    This robot sponsorship is literally everywhere: LTT, unbox therapy now standupmaths!

  • @freshlimelemon
    @freshlimelemon 5 лет назад

    I think, I found the best review of Vector. Thank you :)

  • @paaaaaaaaq
    @paaaaaaaaq 5 лет назад

    Vector is terrifying.

  • @GameCyborgCh
    @GameCyborgCh 6 лет назад +1

    "What's my purpose?" "You pass butter." "Oh my god."

    • @-_Nuke_-
      @-_Nuke_- 6 лет назад +1

      Spy on people
      Oh wait, I shouldn't have said that...

    • @GameCyborgCh
      @GameCyborgCh 6 лет назад

      it can't spy on you

    • @-_Nuke_-
      @-_Nuke_- 6 лет назад +1

      Does the company who made it collect stats from its various sensors and send it back to the cloud? If yes then its spying on you. Plus if it is connected to the internet, then it can be hacked, so other people can spy on you. Just like your phone...

    • @GameCyborgCh
      @GameCyborgCh 6 лет назад

      Anki doesn't collect data and when Vector accesses the internet it encrypts the data sent

  • @Kuratius
    @Kuratius 6 лет назад

    Anki is a flashcard program and I'm sticking to that.

  • @pauldoan1610
    @pauldoan1610 6 лет назад

    Matt i regret missing out on your talk at a generic college outside of boston! I had to take a math midterm when you were giving your talk!

    • @standupmaths
      @standupmaths  6 лет назад +1

      That will probably help your results more than seeing me talk. See you next time at Generic College!

  • @anastasiaklyuch2746
    @anastasiaklyuch2746 5 лет назад

    1:40 Pressing "on" button and waiting with excitement and love for the beloved baby to wake up,
    "please download soul" error message looks at you.
    Le greatest "...huh" face with a pause follows.
    The perfect awakening!
    And the resurection ritual only took a few days!