How Bad Leap Day Math Took Down Microsoft

Поделиться
HTML-код
  • Опубликовано: 20 ноя 2024

Комментарии • 532

  • @abebuckingham8198
    @abebuckingham8198 6 месяцев назад +1014

    "Double it and give it to the next person" - Automatic Service Healing, on bugs

  • @MasonBitByte
    @MasonBitByte 6 месяцев назад +1305

    Azure AD, also known as Microsoft Identity, also known as Entra ID, also known as sadness

    • @influx__
      @influx__ 6 месяцев назад +53

      no idea why they switched from azure to entra... Let's pick an even MORE arbitrary word

    • @JITSoftware
      @JITSoftware 6 месяцев назад +91

      Then they hit you with the "NOTE: Microsoft Entra ID is the new name for Azure AD. No action is required from you." On every single Microsoft documentation page

    • @yufgyug3735
      @yufgyug3735 6 месяцев назад +6

      fuck ad or entra, or whatever its called

    • @Dalamain
      @Dalamain 6 месяцев назад +22

      Spent the last 6 weeks studying and revising for a specific Azure Certification... and at the last minute they updated the exam material to reference Microsoft Entra instead of Azure AD.... FUCK MY LIFE.

    • @boomknuffelaar
      @boomknuffelaar 6 месяцев назад +10

      I just went through madness with their deprecated library passport-azure-ad, the npm listing for this package doesn't even mention that it's deprecated.

  • @hadipawar2539
    @hadipawar2539 6 месяцев назад +1538

    "instructed to do it 3 times cause 2 isn't enought and 4 is too many" I am dying at this

    • @theborg6024
      @theborg6024 6 месяцев назад +90

      well i do have it on good authority that 3 is the number of the counting

    • @rixxan
      @rixxan 6 месяцев назад +59

      ​@@theborg6024 And I have heard that 5 is Right Out.

    • @Bleenderhead
      @Bleenderhead 6 месяцев назад +33

      Two is not enough, excepting that thou then proceed to three.

    • @satunnainenkatselija4478
      @satunnainenkatselija4478 6 месяцев назад +17

      Next up: Microsoft removes leap day from calendar because it was too complex. This comes after Microsoft demanded leap second be removed because it's too complex.

    • @enderger5308
      @enderger5308 6 месяцев назад +2

      @@rixxanand that three is the third number

  • @Lustanda
    @Lustanda 6 месяцев назад +861

    Y2K wished it would be like this.

    • @Weissenschenkel
      @Weissenschenkel 6 месяцев назад +135

      Wait until Y2K38 and all legacy crap running on 32 bits...

    • @ShrirajGPethe
      @ShrirajGPethe 6 месяцев назад +2

      And on wider space

    • @1234567qwerification
      @1234567qwerification 6 месяцев назад

      It was already a problem for software dealing with near future, as 'now + 20 years' 🤷🏼‍♂️

    • @Twisted_Code
      @Twisted_Code 5 месяцев назад +1

      @@Weissenschenkel XKCD 2697 feels relevant here.

    • @Twisted_Code
      @Twisted_Code 5 месяцев назад

      @@1234567qwerification Good point.

  • @MidnightMidas
    @MidnightMidas 6 месяцев назад +719

    A libaba cloud, oracle cloud, IBM cloud, google cloud. Its golden

    • @orangejjay
      @orangejjay 6 месяцев назад +28

      I prefer Nimbus cloud but will settle for Cumulonimbus from time to time.

    • @jeanlasalle2351
      @jeanlasalle2351 6 месяцев назад +34

      I feel blue balled

    • @donatocapitella
      @donatocapitella 6 месяцев назад

      😂😂😂😂

    • @Twisted_Code
      @Twisted_Code 5 месяцев назад +5

      Yeah, especially with an orange smile on screen as he getting to... Google cloud. I mean that's obviously Google's logo, we don't know any other big name IaaS providers.

    • @RJ-qh2px
      @RJ-qh2px 4 месяца назад

      I'm sure Alibaba Cloud is the securest

  • @catcatcatcatcatcatcatcatcatca
    @catcatcatcatcatcatcatcatcatca 6 месяцев назад +394

    Imagine waiting 75 minutes for a VM initialisation. Why would it take 25 minutes? Is there an intern hand-delivering the public key across the facility?

    • @thewhitefalcon8539
      @thewhitefalcon8539 6 месяцев назад +48

      They usually spin up in minutes but they don't actually promise that.

    • @kv4648
      @kv4648 6 месяцев назад +64

      The intern had time to wander off, have a nap, do a lap and have a snack too

    • @hubertnnn
      @hubertnnn 6 месяцев назад +162

      Its the cloud. They are waiting for the correct weather.

    • @Caphalem
      @Caphalem 6 месяцев назад +10

      @@hubertnnn Meanwhile preparing the air balloon to go up there

    • @blikthepro972
      @blikthepro972 6 месяцев назад +5

      you aren't a real tech company if you haven't assigned a stupid job to an unpaid intern

  • @InspectorGadget923
    @InspectorGadget923 6 месяцев назад +470

    10:20 I love that you rolled the date over to 2/30.

    • @Anonymous-df8it
      @Anonymous-df8it 6 месяцев назад +13

      MDY is like putting the tens place before the ones place before the hundreds place

    • @magentamonster
      @magentamonster 6 месяцев назад +5

      @@Anonymous-df8it Irrelevant. MD is just as much a part of YMD as MDY. And YMD is the best. DMY may be in order, but DMYhmsp (11 May, 2024 at 12:42:18 PM) isn't, and neither is hmspDMY (12:42:18 PM on 11 May, 2024) for that matter. To be consistent, you'd have to use something like smHDMY (18:42:12 on 11 May 2024). No one uses this truly little endian time format, nor do they use smhpDMY (18:42:12 PM on 11 May, 2024).
      Also, as users of a left-to-right script, we use big endian numbers, making big endian the only truly consistent time order for us.

    • @Anonymous-df8it
      @Anonymous-df8it 6 месяцев назад +3

      @@magentamonster We should also get rid of months, hours, minutes, and seconds, and just represent every point in time as year-day, where the day is the number of (fractional) days that have passed since midnight on New Year's Day
      Also, the original video used MDY and not YMD, so your point is moot

    • @Pixiuchu
      @Pixiuchu 6 месяцев назад +3

      @@magentamonster YMD is in fact based! Seeing 2024/12/31 pleases me.

    • @andycivil
      @andycivil 5 месяцев назад +2

      @@Pixiuchu This is why it's the International Standard (ISO 8601). It pleases most people.

  • @Lars16
    @Lars16 6 месяцев назад +397

    Love that the datacenter in Australia was upside down. Nice touch

    • @magentamonster
      @magentamonster 6 месяцев назад +5

      Perhaps the one in South America should be upside down too. Given that the upside down Australia joke is due to Australia being in the Southern Hemisphere. But the joke says "Australia" rather than "Southern Hemisphere" to be funnier.

    • @oliverer3
      @oliverer3 5 месяцев назад

      ​@@magentamonsterisn't that more because south-up maps are much more common in Australia?

    • @magentamonster
      @magentamonster 5 месяцев назад

      @@oliverer3 No, because south-up maps are rare, even in Australia. Almost all the maps we use are north-up. Apparently south-up maps are used as souvenirs, but that's because of the joke.

    • @oliverer3
      @oliverer3 5 месяцев назад

      @@magentamonster Huh, the more you know. I appreciate the lesson. :)

    • @Bradleybus
      @Bradleybus 2 месяца назад

      I thought it was because australia was on the opposite end of the globe​@@magentamonster

  • @ShrirajHegde
    @ShrirajHegde 6 месяцев назад +386

    0:50 skipping AWS was a nice gag 😂

    • @JCel
      @JCel 6 месяцев назад +27

      Twice even 😂
      That was a real push and pull there lol

    • @31redorange08
      @31redorange08 6 месяцев назад +4

      What is AWS?

    • @williamdrum9899
      @williamdrum9899 6 месяцев назад

      Amazon Web Services

    • @uSkizzik
      @uSkizzik 6 месяцев назад

      @@31redorange08 Amazon's primary business - Amazon Web Services.

    • @FugaceFugite
      @FugaceFugite 6 месяцев назад +30

      @@31redorange08 an AWP with a typo, probably

  • @ShadowSlayer1441
    @ShadowSlayer1441 6 месяцев назад +306

    It's a good day when Kevin Fang uploads.

    • @kjyu
      @kjyu 6 месяцев назад +1

      It definitely wasn't a good day for those involved!

  • @eco_craft
    @eco_craft 6 месяцев назад +434

    I thought it was pronounced Azure

    • @johndoe4290
      @johndoe4290 6 месяцев назад +55

      Nah you are wrong, its pronounced Azure

    • @Dr-Zed
      @Dr-Zed 6 месяцев назад +35

      I'm pretty sure you're both wrong, it's definetely called Azure.

    • @mme725
      @mme725 6 месяцев назад +30

      Classic mistake, it's Azure

    • @aze4308
      @aze4308 6 месяцев назад +24

      no its azure duh

    • @Bajo85
      @Bajo85 6 месяцев назад +13

      I'm hearing a Nordic accent... Are you Swedish?

  • @jonathangawrych5195
    @jonathangawrych5195 6 месяцев назад +134

    Just wait for Y2K38. The Epochalypse will do this to tons of outdated, unmaintained, embedded systems, or just faulty code worldwide.

    • @WoolyCow
      @WoolyCow 6 месяцев назад +33

      i love that its called the epochalypse lol

    • @jan.tichavsky
      @jan.tichavsky 6 месяцев назад +18

      We already saw effects of outdated unmaintained software and embedded systems when the GPS epoch rolled over. Nobody expected it would work for more than 20 years.

    • @Nadia1989
      @Nadia1989 6 месяцев назад +9

      Airports, for sure. Some of them run on XP

    • @mfaizsyahmi
      @mfaizsyahmi 6 месяцев назад +11

      @@Nadia1989 apparently the entire airline industry's booking system runs on win3.11 or something.

    • @notyourfox
      @notyourfox 6 месяцев назад +8

      2106 will also be that, but won't really matter at that point
      ...legends say after Jan 19, 2038; 3:14:07 it will be Jan 01, 1970; 00:00:00 again...

  • @amyisreallybored
    @amyisreallybored 6 месяцев назад +49

    the AWS teasing at the beginning had me feeling the square hole trauma all over again

  • @C.I...
    @C.I... 6 месяцев назад +89

    The Zune also had a similar bug. I believe the solution was simply to wait until it was no longer the day in question.

    • @YoshiAsk
      @YoshiAsk 6 месяцев назад +9

      Zune mentioned, raahhhhh!

    • @spaghetto181
      @spaghetto181 6 месяцев назад +8

      microsoft

    • @renakunisaki
      @renakunisaki 5 месяцев назад +5

      As did the PlayStation 3, though that manifested on Dec 31, when the system couldn't comprehend that it was the 366th day of the year.

    • @spaghetto181
      @spaghetto181 5 месяцев назад

      @@renakunisaki true... and it was a disaster(plus it happened in the same timeframe playstation network got hacked severely)

    • @electric7487
      @electric7487 5 месяцев назад

      @@spaghetto181 megahard

  • @tryAGAIN87
    @tryAGAIN87 4 месяца назад +6

    "If something like this were to happen to Azure or AWS today, it would not be clickbait to say the internet blew up"
    This aged perfectly!
    Can't wait to see the Cloudstike video!

  • @Phroggster
    @Phroggster 6 месяцев назад +30

    These are so freaking good! I particularly loved the timeline at 10:19, as that is such a Microsoft thing: resolving an issue on February 30th.

    • @MSPaintOfficial
      @MSPaintOfficial 6 месяцев назад +3

      nice joke, there is no February 30th

    • @hyoroemongaming569
      @hyoroemongaming569 13 часов назад

      ​@@MSPaintOfficialr whoosh

    • @MSPaintOfficial
      @MSPaintOfficial 13 часов назад

      @@hyoroemongaming569 that was 6 months ago, i already knew it was a joke

  • @anarchymatt
    @anarchymatt 6 месяцев назад +106

    Everytime a coworker suggests building our own date library

    • @mangodude-nq6su
      @mangodude-nq6su 5 месяцев назад

      Bet it's the same guy who makes livecoding problems

    • @grumpy989
      @grumpy989 5 месяцев назад +6

      Force them to watch the tom scott video on timezones for 12 hours straight

  • @aeghohloechu5022
    @aeghohloechu5022 6 месяцев назад +31

    i like the fact that all the high availability/disaster recovery stuff inevitably ends up making the situation into something way worse than if we had just let it fail and tell customers to go take a break

  • @MHX11
    @MHX11 6 месяцев назад +46

    I'm in love with your visualizations, they're eye candy

  • @Berdes1
    @Berdes1 5 месяцев назад +10

    11:00 "0 UTC happens at the same time everywhere". I don't know how widespread this practice is, but I know of some large services that have a couple of instances running with a clock configured 24 hours and/or 7 days ahead of time to catch those kind of bugs.

  • @justicefool3942
    @justicefool3942 6 месяцев назад +91

    0:50-0:55 The lengths you went to avoid saying AWS is commendable.

    • @bumboyy
      @bumboyy 4 месяца назад

      Probably would make the AI voice too obvious

  • @pdlbackup
    @pdlbackup 6 месяцев назад +164

    It was fixed the next day??? They might as well have done nothing and it would've fixed itself!

    • @redyau_
      @redyau_ 6 месяцев назад +47

      Well no, as whole clusters were HI by then.
      But you have a point 😅

    • @cskiller86
      @cskiller86 6 месяцев назад +22

      I was going to comment the same thing.
      Since they found the problem so late in the day, and the fix was ultimately deployed in March, why not reboot everything without the fix on March 1st? It would have been less downtime probably.
      And, after that, they had 4 years at their disposal to create and test the fix.

    • @ribstogo12
      @ribstogo12 6 месяцев назад +8

      They might have known that, but imagine what their bosses face would have looked like if they had just sat on their hands while support calls kept rolling in. Not a good look.

    • @xelspeth
      @xelspeth 6 месяцев назад +5

      And then 4 years later it all happens again

    • @tbuk8350
      @tbuk8350 6 месяцев назад +10

      Well, they still had to restore all the clusters. A couple VMs were corrupted because of the constant shifting, and a couple clusters were all stuck in the HI state.

  • @nicholascopsey4807
    @nicholascopsey4807 6 месяцев назад +85

    I’ll tell you why it took 5 hours to fix the bug, they spent 4 hours and 50 minutes in meetings strategizing about how the engineers would identify the bug and the procedure to test any changes that would go out.

    • @samuvisser
      @samuvisser 6 месяцев назад +38

      Absolutely. Also, these systems are massive and from experience i know sometimes u can know what the bug is based on observed behavior but it still take hours to identify the code that causes the bug because there are so darn many systems talking with each other all in their own git repo

    • @XxZeldaxXXxLinkxX
      @XxZeldaxXXxLinkxX 6 месяцев назад +26

      In incident response this is actually crucial.
      The last thing you want is to do something wrong and cause even more issues. Measure twice, cut once applies wholeheartedly here

    • @aeghohloechu5022
      @aeghohloechu5022 6 месяцев назад +8

      ​@@XxZeldaxXXxLinkxXthey fucked up 7 servers anyway though so uh

    • @XxZeldaxXXxLinkxX
      @XxZeldaxXXxLinkxX 6 месяцев назад +7

      @@aeghohloechu5022 OK and? If you have actually managed production servers you would understand why incident response takes time. If you haven't, maybe one day you'll get it when you footgun yourself while haphazardly trying to hotfix a production system.

    • @andyvirus2300
      @andyvirus2300 6 месяцев назад

      @@XxZeldaxXXxLinkxXwell not everywhere, I’m sshing and viming my way into fixing prod every other week.
      Losing time in useless meetings isn’t the way most of the time.

  • @TheHadrian54
    @TheHadrian54 6 месяцев назад +34

    Surprise PHP facts! PHP DateTime implicitly "fixes" impossible dates except instead of going to the last day of the month, it goes to the next month and adds the number of days missing. For example, 02-31 becomes 03-02.
    This means that adding 1 month to the following series of dates:
    01-28 01-29 01-30 01-31 02-01 02-02
    Will result in this:
    02-28 02-29 03-01 03-02 03-01 03-02
    Isn't that awesome? 😊

    • @williamdrum9899
      @williamdrum9899 6 месяцев назад +3

      Trying to wrap my head around how Microsoft couldn't think of this

    • @TheHadrian54
      @TheHadrian54 6 месяцев назад

      ​@@williamdrum9899 With the solution that PHP went with you're a lot less likely to cause a catastrophic failure but you still run into some issues just different ones 🤷‍♂
      At the end of the day the issue with dates is that our brain takes the way they work for granted when they're actually really complex

    • @HenryLoenwind
      @HenryLoenwind 6 месяцев назад +10

      Every good date library does that. But that requires people to actually use a date library and not do things "by hand".

    • @grumpy989
      @grumpy989 5 месяцев назад +1

      Rare PHP W

    • @LoonaStanGTNH
      @LoonaStanGTNH 2 месяца назад

      Rare PHP W

  • @donchaput8278
    @donchaput8278 6 месяцев назад +9

    "Because 2 isn't enough and 4 is too many" @6:15
    -Five is right out. Once the number three, being the third number, be reached......

  • @iamfinkyuk
    @iamfinkyuk 6 месяцев назад +17

    I was working at Microsoft around 2008-9 and, whilst on a training course in Stockholm (or Prague, I forget which), the whole of Azure went down during day 1 or 2 of the course which resulted in a few of us jokingly saying to each other "did you just break azure?". It later transpired (publicly) that the entire platform went down because of an SSL certificate expiry that cascaded across the entire cloud infrastructure. Some time later, I asked the NOC to get a copy of the transcript of what happened and how it was handled and these guys were REALLY good. Abject professionals the whole way. The reason there are large time delays between "finding a fix" and "making it live" is the huge volume of testing needed for approval.

  • @seifenspender
    @seifenspender 6 месяцев назад +16

    Insane that this first happened only 12 years ago.
    I had to double check why this didn't occur earlier and made the realization that azure really is only 14 years old. Crazy.

  • @willpeterson3943
    @willpeterson3943 6 месяцев назад +47

    Can't wait for all the bugs in 2100, which is NOT a leap year

    • @guy7329
      @guy7329 6 месяцев назад +15

      why wait so long? We'll have tons of problems in 2038 when 32 bit system clocks just wrap back to 19xx or something.

  • @ChineseKiwi
    @ChineseKiwi 4 месяца назад +16

    10:29 - I wonder what happened today....

  •  6 месяцев назад +23

    Some months ago I was manually typing DAX formulas in Powerquerry and one consisted on subtracting one year. It only took me 5 minutes to realise "but what about leap years". How did Microsoft not think about this?
    Sadly, by the time a leap year comes, everyone at work will have forgotten my Excel.

    • @subanark
      @subanark 6 месяцев назад

      Powerquery is a language like DAX, PowerQuery can be used inside Excel and PowerBi, DAX can be used in PowerBi, but not Excel. Microsoft has a lot of engineers and there are a lot of places this could fail. We have leap year awareness notices, training and detection to mitigate something like this in the future.

  • @FinlayDaG33k
    @FinlayDaG33k 6 месяцев назад +104

    Man, if only there was a numeric standard that didn't really care about whether the date actually exists or not as long as the number isn't higher than the other number.
    But a'las, we'll have to wait for Apple to invent it in 5 years or so.

    • @Dr-Zed
      @Dr-Zed 6 месяцев назад +36

      *laughs in unix time*

    • @Aura_Mancer
      @Aura_Mancer 6 месяцев назад +5

      I assume this is a joke for the unix timestamp right. Because yknow, there's that

    • @Weissenschenkel
      @Weissenschenkel 6 месяцев назад +10

      @@Aura_Mancer true, but Y2K38 is coming. Everything in 32-bit will be kicked back to 1970-01-01 00:00.

    • @Aura_Mancer
      @Aura_Mancer 6 месяцев назад +36

      ​@@Weissenschenkel Most unix timestamp things use 64bit nowadays. So it is going to be a non-issue, if people have foresight. Which some will not, which will make for Kevin Fang videos. Win win if you ask me

    • @twentylush
      @twentylush 6 месяцев назад +17

      microsoft doing everything in their power to not use unix timestamp, even when it means using 3 different epochs in their kernel

  • @3rdalbum
    @3rdalbum 6 месяцев назад +83

    Whenever I watch a Kevin Fang video, I know my next piece of amateur hacky software at the office will be better designed and less vulnerable. And that's good for everyone in my directorate.
    EDIT: My software won't break on leap year, but every February it delays archiving a few days of support tickets until the following month, lol.
    EDIT 2: I'm impressed at the systems Microsoft had to try to heal its service automatically and migrate VMs onto other servers when there's a suspected hardware problem. Shame it blew up in their faces this time.

    • @boomknuffelaar
      @boomknuffelaar 6 месяцев назад +5

      Wouldn't a delayed archive make you MORE vulnerable? If the February bug required a rollback you'd lose more data.

    • @3rdalbum
      @3rdalbum 6 месяцев назад +5

      @@boomknuffelaar Archiving is just to "get this old resolved ticket out of my hair", it's not a backup. The data is all stored in SharePoint lists and as such it's all backed up and versioned automatically in the cloud, regardless of whether it's in the archive or the main list.

    • @efulmer8675
      @efulmer8675 3 месяца назад

      I'm surprised there wasn't a check like "If it's February 29, set the expiration date to February 28 or March 1 of the next year" or something.

  • @a_lethe_ion
    @a_lethe_ion 4 месяца назад +6

    Well today is gonna be a good new topic for this series

  • @leyasep5919
    @leyasep5919 4 месяца назад +6

    MS, 2024/7/19 : "ahahaha. Hold my Crowdstrike and let me bring half of Fortune 500 down !"

  • @richardfarrer5616
    @richardfarrer5616 6 месяцев назад +12

    Been there, done that (just on a much smaller scale). The product I work on reads in messages where some dates are fully represented, and some come in with just day and month specified. We know those are on or before certain other dates so we can calculate the correct year, but leap days regularly broke this. Just to add to the fun, the values have to be passed around as dates before we complete the validations. Since we know the dates will only be within a year or so of today, there is a marvellous bit of code which gives a dummy year of 1968 for these values prior to validation. Why 1968?
    1. It's long enough ago that no real date will be for that year.
    2. It's a leap year.
    3. It's the year the developer was born.
    And, yes, I do happen to be 56 as it happens.😀
    Oh, and then there's the code which adds one day by adding 24 * 60 * 60 seconds to a date - which works unless a day has 23 or 25 hours, i.e. daylight saving or local equivalent.

    • @hubertnnn
      @hubertnnn 6 месяцев назад +2

      It reminds me of a payment platform we used that accepted integers that could be both in dollars and in cents and decided which one it is based on the amount.
      Someone rewritten a library that had an overloaded method, that accepted integer in cents or float in dollars into language where all numbers are stored as a float.

  • @jayfraxtea
    @jayfraxtea 6 месяцев назад +6

    The way you pronounce Azure remembers me of the good old days in 2012, when almost every Microsoft marketing employee pronounced it differently. My favourite back then were some German Microsoft representatives who pronounced it like [aˈʒuːɐ̯] ... as it would be a blend of a Polish-German word.

    • @aboxinspace
      @aboxinspace 6 месяцев назад +2

      I work in a company that has folks from USA, India, Brazil, Mexico... saying the word "Azure" is a language bomb 😂 Almost leads to an argument every time, then everyone just says "Microsoft Cloud"

    • @jayfraxtea
      @jayfraxtea 6 месяцев назад

      @@aboxinspace, speaking about a language bomb ... better don't use Azure Cognitive Services Translator Service, now re-named as Azure AI Translator, to translate sentences that contain the word "Azure" 😜

  • @Twisted_Code
    @Twisted_Code 5 месяцев назад +4

    I laughed so hard when you showed Amazon's smile at 0:52 and said Google cloud.
    I hope your editor is well-paid (whether that's you or someone you hired, obv)

  • @megamasterbloc
    @megamasterbloc 6 месяцев назад +7

    negative leap seconds are gonna be fun to watch

  • @gamerk316
    @gamerk316 5 месяцев назад +3

    To be fair: Any software engineer who's had to work with time zone/leap day/year/second(!) logic knows that every time format we have *sucks*. The only acceptable solution is to do everything in UTC and convert back to the users desired time zone after the fact.

    • @PanduPoluan
      @PanduPoluan 2 дня назад

      I'm actually flabbergasted to learn that some servers in my company are configured to have local time in their hardware.

  • @shkron
    @shkron 6 месяцев назад +3

    Man, I just want to tell you that your videos are amazing, and every time a new one comes out, it is like the happiest day of my life

  • @francescourdih
    @francescourdih 6 месяцев назад +35

    10:20: the graphics says it’s the 30 of February
    **azure cluster**: wanna see me going down again?

    • @cirkulx
      @cirkulx 6 месяцев назад +9

      feb. 31:
      patch again 💀

    • @francescourdih
      @francescourdih 6 месяцев назад +8

      @@cirkulx I wouldn’t blame the developers for forgetting the 30th of February

    • @Anonymous-df8it
      @Anonymous-df8it 6 месяцев назад +3

      @@francescourdih That was actually a real date in Sweden at one time

  • @wardrich
    @wardrich 6 месяцев назад +5

    0:06 I've always found it weird how people fumble over the word "azure". It's a shade of blue. There was also a once popular torrent client named Azureus (named after the dart frog. It's now called Vuze). Anyway, every one of those pronunciations said in that section were wrong too 😂. It's like.. a-zhur where the zh is like an "sh" but not quite lol

  • @alternyte
    @alternyte 3 месяца назад +5

    1:52 i did learn something new as you said: microsoft + amazon = google

    • @QuisUtDeus828
      @QuisUtDeus828 8 дней назад

      I'm cracking up at that part right now

  • @baconerie
    @baconerie 6 месяцев назад +30

    why is it always the dates

  • @AraniWendinah
    @AraniWendinah 6 месяцев назад +7

    Let's go Kevin upload their videos again. Grab snacks!

  • @jamescollier3
    @jamescollier3 6 месяцев назад +134

    As a materials engineer, I know the words "Automated service healing," is not created by men who work past 5pm

    • @Fay7666
      @Fay7666 6 месяцев назад +14

      That is, until they work past multiple 5pms in a row.

  • @Buffalo_Soldier
    @Buffalo_Soldier 2 месяца назад +2

    Who keeps date in separate "year, month, day, etc."? They should just use timestamps.
    I would never come to idea of keeping date in such unnecesarily complex way and I'm not working for multi-billion company. . . Maybe I would if I was making super simple project in school...

  • @pixelsafoison
    @pixelsafoison 2 месяца назад

    Chuckled for the entirety of the video - amazing job. Delivering both humor and information at the same time is hard, and you aced it

  • @rabik_dev
    @rabik_dev 6 месяцев назад +14

    You need to post more videos Kevin

  • @tgz39j4ndywmm7
    @tgz39j4ndywmm7 6 месяцев назад +3

    That VR headset analogy was very good. As a VR headset i approve of this

  • @BerlingoQC
    @BerlingoQC 6 месяцев назад +2

    There is not enough of your video , can't wait for the next

  • @Xavier-xb7is
    @Xavier-xb7is 6 месяцев назад +1

    Best tech channel by a tremendously large margin. Can't get enough of these.

  • @muizzsiddique
    @muizzsiddique 20 дней назад

    Hey, I watched this almost 5 months ago, and this time I did understand the opening. Thanks!

  • @UltimatePerfection
    @UltimatePerfection 6 месяцев назад +3

    It's because of Microsoft's wonderful engineering - even when using Linux, they manage to frick stuff up.
    Buy your own servers. Install Linux. Make your own cloud. Be a man.

  • @NicosLeben
    @NicosLeben 6 месяцев назад +4

    10:19 Nice touch with the 2/30.

  • @氷語
    @氷語 6 месяцев назад +2

    The VM was like “Double it and give it to the next cluster”

  • @hockdudu
    @hockdudu 4 месяца назад +2

    11:06 he made sure to portray Australia servers upside down 😂

  • @Lolinatorishere
    @Lolinatorishere 4 месяца назад +2

    the irony of microsoft being down again today

  • @magic_pink_horse
    @magic_pink_horse 6 месяцев назад +1

    The stock explosions are still my favorite ❤

  • @ItsVingtdeux
    @ItsVingtdeux 5 месяцев назад +2

    how to make a kevin fang video:
    1. add stock footage
    2. represent programs with amogus characters
    3. overuse that one explosion sound effect

  • @evocorporation6537
    @evocorporation6537 3 месяца назад +3

    Azuuureeee did it again

    • @kwak0
      @kwak0 3 месяца назад

      yeah i can't wait on a video on why I can't play minecraft rn

  • @Juniperrrrrr
    @Juniperrrrrr 6 месяцев назад +1

    This story is why you don’t write your own date time logic.

  • @shubhamsawant1551
    @shubhamsawant1551 6 месяцев назад +1

    the funniest part in 2018 in My Diploma in computer Engineering i wondered why we write code to print dates today i understand specially i understand why we calculate leap month and all

  • @earthling_parth
    @earthling_parth 6 месяцев назад

    Finally, a new video! Banger as usual 😆
    Rhat restart logic being 3 times was hilarious

  • @Manabender
    @Manabender 5 месяцев назад

    10:20 Can we talk about how you have "February 30th" on the timeline?
    Brilliant.

  • @riddixdan5572
    @riddixdan5572 6 месяцев назад

    Love your videos. Very educational and entertaining. Keep em coming

  • @Akaterial
    @Akaterial 6 месяцев назад

    I love your videos. You make theses dry and boring subjects entertaining.

  • @harsha1306
    @harsha1306 6 месяцев назад +1

    I love that you included a Feb 30th

  • @AnindoSarker
    @AnindoSarker 6 месяцев назад +1

    The irony of my laptop crashing exactly at 5:38 is too surreal. Crashed twice

  • @Caphalem
    @Caphalem 6 месяцев назад

    This is... easily the most entertaining developer channel on RUclips. As a mainly BE oriented developer, I'm dying xD

  • @foxs49er
    @foxs49er 2 месяца назад +1

    "Saying the entire Internet blew up would not even be clickbait." CloudStrike enters the chat.

  • @Nico-qq7xl
    @Nico-qq7xl 5 месяцев назад

    such a good explenations keep up the good work boss!

  • @AndersonPEM
    @AndersonPEM 6 месяцев назад +11

    HONEY! STOP EVERYTHING! KEVIN FANG DROPPED A VIDEO! GRAB THE POPCORN!

  • @exodus_20_15
    @exodus_20_15 6 месяцев назад +1

    Saw a Microsoft Azure ad before this #badtiming

  • @davefellows
    @davefellows 6 месяцев назад

    I remember very well when this happened, it wasn't a good day for cloud computing. Amazing how far things have come since then.

  • @Froschkoenig751
    @Froschkoenig751 6 месяцев назад

    Your humor and animations are the greatest!

  • @alejandroalzatesanchez
    @alejandroalzatesanchez 6 месяцев назад +1

    Timezones are lovely!

  • @What-ez6im
    @What-ez6im Месяц назад +1

    this would have been solved if they just used UTC instead.

  • @nessitro
    @nessitro 6 месяцев назад

    the missile blast got me rofl. keep em' coming :D

  • @MonochromeWench
    @MonochromeWench 6 месяцев назад +1

    This is the sort of bug I would expect from a beginner programmer not the experienced ones that Microsoft would have working on Azure but i guess anyone can do it and that would be why Microsoft is updating their C++ compiler to detect some leap year bug.

  • @DanielSmedegaardBuus
    @DanielSmedegaardBuus 2 месяца назад

    "... just like how a bunch of virtual reality headsets can run in the same reality."
    That threw me off for a bit. Love it 😂

  • @SegNode
    @SegNode 6 месяцев назад

    Great video, I was chuckling the whole way through lol

  • @ThompYT
    @ThompYT 6 месяцев назад +3

    They should've just added 31536000 to unix time

  • @hadipawar2539
    @hadipawar2539 6 месяцев назад +1

    welcome back Kevin!

  • @mrmarkom
    @mrmarkom 6 месяцев назад +2

    Once they figured the source of problem, they could have just wait for a day to pass. Next day the bug would not manifest, and they would have 4 years to deploy fix. Recovery lasted until tomorrow anyway :)

  • @DevReaper
    @DevReaper 6 месяцев назад

    The insurance company I was working at had a fucking meltdown due to the 29day February breaking proportional premium adjustments and invoices. Accts that were supposed to be generated with 365 days were done with 366 and vise versa. Thank you programmers, very cool.

  • @DiamondLegends
    @DiamondLegends 6 месяцев назад

    That VR headset analogy was perfect

  • @TickUwU
    @TickUwU 6 месяцев назад +3

    Now my brain is HI

  • @YusefdoesEducation
    @YusefdoesEducation 4 месяца назад

    the sister is always accepting these dumb challenges without miwu's consent

  • @MasanaAnta
    @MasanaAnta 6 месяцев назад

    love how you always find new ways to present information!

  • @chuckfarley7642
    @chuckfarley7642 6 месяцев назад

    Hard to believe this was over 12 years ago. I remember it like it was yesterday. I was working for Microsoft at the time and my service got impacted by this. It was a long 12 hours. There was no laughing at that rookie mistake!

  • @Kwazzaaap
    @Kwazzaaap 28 дней назад

    The Kessler syndrome will continue until uptime improves - Hyper-V

  • @dom1310df
    @dom1310df 6 месяцев назад

    Great code review picking up on that error ahead of time.

  • @muriellemermaid
    @muriellemermaid 2 месяца назад

    I do hope you are not causing Thors illustrious goblin army of this

  • @zidaryn
    @zidaryn 5 месяцев назад

    This is like "Mayday" but for the tech world. Love it. Just wish I knew more about coding. Still entertaining.

  • @xiao2634
    @xiao2634 6 месяцев назад

    My Microsoft Teams shows time as 12:10 AM, making me think something like this will happen to them again.

  • @hamburgerfatso
    @hamburgerfatso 6 месяцев назад

    Holy shit i just searched to see if you had any videos recently and there's one 15 minutes ago

  • @codeman99-dev
    @codeman99-dev 6 месяцев назад

    Oh my goodness! I kid you not... I received an in-video ad for Azure right as Kevin is explained the VM crashes (roughly 6:25).

  • @BenMclean007
    @BenMclean007 6 месяцев назад

    There are actually companies that currently provide rentable computing power in space. So not literally in the cloud, but literally above the cloud

  • @nathanr136
    @nathanr136 6 месяцев назад

    You need a patreon, greatly explained videos I always enjoy watching and would like to contribute :)