Hanne Parks
Hanne Parks
  • Видео 9
  • Просмотров 320
Saving Shortleaf: Bringing Fire Back to the North Carolina Piedmont
Fire Ecology (FOR 533) Final Project
Please reach out to hjparks@ncsu.edu or hannejparks@gmail.com if you have any questions.
Music Credits:
First Song- River Run by Stoney Waters
www.premiumbeat.com/royalty-free-tracks/river-run
Second Song- Nature Walk by Jonathan Boyle
www.premiumbeat.com/royalty-free-tracks/nature-walk
Third Song- Faithful Mirror by L-Ray Music
www.premiumbeat.com/royalty-free-tracks/faithful-mirror
Fourth Song- Autumn Quiet by Rob Carwell
www.premiumbeat.com/royalty-free-tracks/autumn-quiet
Works Cited
Barden, L. S. (1997). Historic Prairies in the Piedmont of North and South Carolina, USA. Natural Areas
Journal, 17(2), 149-152. www.jstor.org/stable/43911660
Frost, Cecil C. 1998....
Просмотров: 88

Видео

My Moving Mammal MovieMy Moving Mammal Movie
My Moving Mammal Movie
Просмотров 302 года назад
Phylogenetic Tree of MemesPhylogenetic Tree of Memes
Phylogenetic Tree of Memes
Просмотров 364 года назад
Thank you for watching! Here's a link to a pdf of the meme tree: drive.google.com/file/d/1gDgcqS54zlASzPb_A94Mhqhy-8IJUMzt/view?usp=sharing Works Cited Halweg, C. (2020). 54 Phylogenetics. Lecture. The History of Meme. (n.d.). Retrieved November 16, 2020, from www.merriam-webster.com/words-at-play/meme-word-origins-history Rutherford, A. (2016, May 29). 'As long as we study life, it will be rea...
Developmental NetworksDevelopmental Networks
Developmental Networks
Просмотров 104 года назад
Thank you for watching! Gn 311 Module 6 Exam Video Prompt 2 Works Cited Davidson, E., & Levine, M. (2008, December 23). Properties of developmental gene regulatory networks. Retrieved November 01, 2020, from www.pnas.org/content/105/51/20063 Halweg, C. (2020). 51 Developmental Genetics Drosophilia melanogaster. Lecture. Halweg, C. (2020). 52 Developmental Genetics C. elegans A. thaliana Network...
Point MutationsPoint Mutations
Point Mutations
Просмотров 54 года назад
Gn 311 Module 5 Exam Video Prompt 2 Wild type mRNA: 5'- GCAUGGUCAGCAAGUAAUCCACAU -3' Missense mRNA: 5'- GCAUGGUCGGCAAGUAAUCCACAU -3' Silent mRNA: 5'- GCAUGGUGAGCAAGUAAUCCACAU -3' Nonsense mRNA: 5'- GCAUGGUCAGCUAGUAAUCCACAU- 3' Readthrough mRNA: 5'- GCAUGGUCAGCAAGUACUCCACAU- 3' Works Cited Halweg, C. (2020, October). Mutations Part 1. Lecture. Halweg, C. (2020, October). Mutations Part 2. Lecture.
Prokaryotic TranscriptionProkaryotic Transcription
Prokaryotic Transcription
Просмотров 124 года назад
Gn 311 Module 4 Prompt 2 Thanks for watching! Works Cited Griffiths, A. (1970, January 01). Transcription and RNA polymerase. Retrieved October 04, 2020, from www.ncbi.nlm.nih.gov/books/NBK22085/ Halweg, C. (2020). 36 Transcription Overview and Prokaryotic. Lecture. Jones, A. (2020). Problem Session 4B Transcription. Lecture. Libretexts. (2020, September 06). 7.6C: Prokaryotic Transcription and...
Genetic Synapsis Example WalkthroughGenetic Synapsis Example Walkthrough
Genetic Synapsis Example Walkthrough
Просмотров 384 года назад
Gn 311 Module 3 Prompt 2 Thanks for watching! Works Cited Halweg, C. (2020, September 14). Chromosomal Aberrations- Inversions Gn311. Lecture. Santos, J. (1999, January 01). The relationship between synapsis and recombination: Two different views. Retrieved September 21, 2020, from www.nature.com/articles/6884870
Single Dominant EpistasisSingle Dominant Epistasis
Single Dominant Epistasis
Просмотров 304 года назад
At 1:03, I meant to put the "aa" paper under enzyme 1 rather than under enzyme 2. Works Cited Halweg, C. (2020). Epistasis 1. Lecture. Halweg, C. (2020). Epistasis 2 Applications. Lecture. How do genes direct the production of proteins? - Genetics Home Reference - NIH. (2020, August 17). Retrieved September 07, 2020, from ghr.nlm.nih.gov/primer/howgeneswork/makingprotein Learning, L. (2020). Bi...
A look at Hemophilia in the Royal PedigreeA look at Hemophilia in the Royal Pedigree
A look at Hemophilia in the Royal Pedigree
Просмотров 814 года назад
Gn 311 Module 1 Video Works Cited Blood Disorders. (2020). Retrieved August 24, 2020, from www.rchsd.org/health-articles/hemophilia/ Family Tree Information: Veldman, M., & Williams, E. (2020, May 20). Victoria. Retrieved August 25, 2020, from www.britannica.com/biography/Victoria-queen-of-United-Kingdom Halweg, C. (2020). Sex Linkage. Lecture. Halweg, C. (2020). Pedigrees 1. Lecture. Halweg, C...

Комментарии

  • @brodydouglass8042
    @brodydouglass8042 4 дня назад

    Sadly, most landowners don’t give a crap about their land. Bradford pears, privet, tree of heaven, mimosas, kudzu, english ivy, and wisteria are making this state a dump. Can hardly drive down the road without seeing all of them. Ignorance. Glad to see NC State students are working with the few land owners who care.

  • @FaKe-oi2rm
    @FaKe-oi2rm 4 года назад

    Very useful video! Definetly using it to study for my genetics test on friday!

  • @FaKe-oi2rm
    @FaKe-oi2rm 4 года назад

    Best video ever